DNA Methylase Activity as a Marker for the Presence of a Family of Phage-Like Elements Conferring Efflux-Mediated Macrolide Resistance in Streptococci

Abstract

Recently, two related chimeric genetic elements (Tn1207.3 and Φ10394.4) were shown to carry the macrolide efflux gene mef in Streptococcus pyogenes (group A streptococci [GAS]). The dissemination of elements belonging to the Tn1207.3/Φ10394.4 family in recent isolates of GAS, Streptococcus dysgalactiae subsp. equisimilis, Streptococcus pneumoniae, and Streptococcus agalactiae recovered in Portugal was surveyed. In total, 149 GAS, 18 S. pneumoniae, 4 S. dysgalactiae subsp. equisimilis, and 5 S. agalactiae isolates from infections, presenting the M phenotype of macrolide resistance and containing the mef gene, were screened for the presence of Tn1207.3/Φ10394.4 by PCR targeting open reading frames (ORFs) specific for these related elements. All the GAS isolates tested and one of the S. dysgalactiae subsp. equisimilis isolates carried Tn1207.3. However, neither of these elements was found in the isolates of the other streptococcal species. It was also noted that the DNAs of the isolates carrying Tn1207.3 were resistant to cleavage by the endonuclease SmaI. Cloning and expression of ORF12 of Tn1207.3 in Escherichia coli showed that it encoded a methyltransferase that rendered DNA refractory to cleavage by SmaI (M.Spy10394I). Using this characteristic as a marker for the presence of the Tn1207.3/Φ10394.4 family, we reviewed the literature and concluded that these genetic elements are widely distributed among tetracycline-susceptible GAS isolates presenting the M phenotype from diverse geographic origins and may have played an important role in the dissemination of macrolide resistance in this species.

Macrolide resistance in streptococci is usually associated with the presence of specific macrolide resistance genes encoding ribosomal target modification or macrolide efflux systems (erm and mef genes, respectively) (30). The mef-encoded efflux system mediates resistance to 14- and 15-membered macrolides but not to 16-membered macrolides or lincosamides (M resistance phenotype) (30).

The mef gene family was identified in Streptococcus pneumoniae as part of nonconjugative elements such as the 7.2-kb transposon Tn1207.1 (38) or the 5.4-kb mega-element (22). Recently, a composite element resulting from the insertion of the mega-element into Tn916, designated Tn2009, was described (17). Tn1207.1 was also found in Streptococcus pyogenes (group A streptococci [GAS]) as part of larger mobile elements, such as a ∼60-kb tet(O)-mef(A) element (23), a 52.4-kb element (Tn1207.3) (37), or a 58.8-kb element (Φ10394.4) (3, 4). The last two elements seem to be chimeric and are composed of two regions that represent distinct functional units: a 7.2-kb region located towards the left end of the element that is identical to Tn1207.1 of S. pneumoniae and a 45.2-kb region consisting of a prophage-like element (4, 37). Although the major parts of these two elements are identical at the DNA sequence level, Φ10394.4 has an additional variable region (∼6 kb) upstream of Tn1207.1, which contains an open reading frame (ORF) encoding an R28-like protein with an LPXTG amino acid motif located at the carboxy terminus (4). Both the mega-element and variants of Tn1207.3 were also observed recently in Streptococcus agalactiae (32), and the presence of mef genes in group C and group G streptococci is also documented (28), suggesting that the same genetic elements may be responsible for dissemination of these macrolide resistance genes in the Streptococcus genus.

Increases in the prevalence of macrolide-resistant isolates, particularly among GAS, were associated with a surge in isolates presenting the M phenotype (1, 25, 29, 49). These increases are generally not attributable to a single clone but are polyclonal, suggesting horizontal dissemination of the genetic elements carrying the mef gene (49). It was also noted that the DNAs of a significant proportion of these M type isolates were resistant to SmaI digestion, preventing the analysis of their genetic backgrounds using this endonuclease and pulsed-field gel electrophoresis (PFGE) (12, 43). The DNAs of these isolates were shown to carry SmaI recognition sequences, since they generated multiple fragments upon digestion with Cfr9I, an isoschizomer of SmaI (11, 43). These observations suggest that some of the genetic elements responsible for the M resistance phenotype may be the cause of the inability to type these isolates by using SmaI and PFGE.

In this report it is demonstrated that the recently described prophage-like elements belonging to the Tn1207.3/Φ10394.4 family in S. pyogenes encode a DNA-modifying methyltransferase that acts on the SmaI recognition sequence and is responsible for resistance to digestion with this endonuclease. Using resistance to cleavage by SmaI as a marker for the carriage of the prophage-like elements Tn1207.3/Φ10394.4, the presence of this family of elements in Streptococcus dysgalactiae subsp. equisimilis was demonstrated, and the literature was searched to determine the importance of this family in the rise of macrolide-resistant GAS.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

A total of 149 S. pyogenes isolates presenting the M phenotype and isolated in different areas of Portugal during 1998 to 2003 were further characterized (43, 44). The isolates presented 23 different T/emm type combinations and 14 different PFGE clusters. Also, four strains of S. dysgalactiae subsp. equisimilis (all of Lancefield group G) (35), 5 of S. agalactiae (21), and 18 of S. pneumoniae (41, 42), all isolated from infections and presenting the M phenotype, were also analyzed. Genotypically, all isolates carried the mef gene as the only erythromycin resistance determinant (44). Isolates were grown on tryptic soy agar plates (Oxoid, Hampshire, England) supplemented with 5% sheep blood at 37°C, except for S. pneumoniae, which were grown in an atmosphere enriched in 5% CO₂. For the preparation of DNA, isolates were grown in liquid brain heart infusion medium (Oxoid, Hampshire, England) at 37°C.

Escherichia coli DH5α was used as the host for recombinant plasmids constructed using pGEM-3Z. E. coli was grown in LB (Oxoid, Hampshire, England) or in LA (Oxoid, Hampshire, England) supplemented with ampicillin (100 μg/ml) as appropriate.

PFGE.

Preparation of genomic DNA and PFGE analysis of SmaI-digested DNA were done as described elsewhere (35, 42, 43). Ten isolates of S. pyogenes, representative of the major clones of this collection, were also digested with MspI and HpaII (MBI Fermentas, Vilnius, Lithuania). For digestions with either endonuclease, one plug was incubated overnight at 37°C with the buffer supplied by the manufacturer, containing 15 U of MspI or HpaII. The electrophoresis conditions for HpaII and MspI digests were as follows: 1% agarose gels in 0.5× Tris-borate-EDTA; run time and temperature, 16 h and 14°C; voltage, 6 V/cm; switch time ramp, 1 to 2s.

Preparation of genomic DNA for PFGE analysis of E. coli DH5α strains was carried out as described previously (5). SmaI digestion was performed as described above. For Cfr9I (MBI Fermentas, Vilnius, Lithuania) digestion, one plug was incubated overnight at 37°C with the buffer supplied by the manufacturer, containing 3 U of the enzyme. The electrophoretic parameters for SmaI and Cfr9I digests of E. coli genomic DNA were as follows: 1% agarose gels in 0.5× Tris-borate-EDTA; run time and temperature, 16 h and 14°C; voltage, 6 V/cm; switch time ramp, 1 to 2s.

PCRs.

The primer pairs used in PCR experiments are listed in Table 1. A scheme illustrating the regions amplified by PCR is presented in Fig. 1. The PCRs for the amplification of the orf8-orf39 and orf38-orf58 regions were performed using the Expand long-template PCR system (Roche, Basel, Switzerland) according to the supplier's instructions.

TABLE 1.

Primers used in this study

Primer		Reference	Product size (bp)	Amplified region [PCR product designation]a
Designation	Sequence (5′→3′)
MEFA1	AGTATCATTAATCACTAGTGC	46	1,923	mef-msr(D) [A]
CDS10-r1b	CTCCGCAGCCCTTTCCAATC	This study
CDS13-d1b	CACCATAAGACACACCGATTTG	This study	1,163	orf8 [B]
CDS13-r1b	TGACATAGCCTTCCTCGATATGAAG	This study
MET-d2b	CCAGCGATTGCAGTCTGTGATAAC	This study	1,406	orf12 [C]
MET-r1b	GCATTGACCTTTGATAGACACATTTTAG	This study
TSS1	TCTGTTATATGCGGATGGTG	24	445	orf39 [D]
TSS2	ATAAACAACTGGGTAGAACG	24
CDS8-d3b	GGAGAATGTCATCTGGAGCAGCATAGTCTTG	This study	24,473	orf8-orf39 [E]
CDS39-r1b	GAGTTCTTATCTGTACCTGCGGTAGTGATG	This study
CDS38-d1b	GGTAAGCGTCCTCTCAACCATAAAGAAC	This study	20,918	orf38-orf58 [F]
CDS58-r1b	CAATACATCCTTCCACTTGTGCTGATTC	This study
G-d1	CGAGGAGTTAGTATGGAAAC	18	473	Tn1207.3/Φ10394.4 right junction [G]
G-r1	CCCATAATAGGCAACTGGTCTCCAGC	18
MS34	TCTTCGCCGCATAAACCCTATC	37	453/6,807c	Tn1207.3/Φ10394.4 left junction [H]
MS54	CCTTTGACCAATGAAGTGACCTTT	37
CDS1-d1d	GATTGGCGGAGAACAAGGAAAG	This study	675	R28-like ORF [I]
H-r	GCTTCTTCTGCTTGCTTCTCG	18

^aSee Fig. 1 for a diagram of the regions amplified by each PCR.

^bThe primer was designed from the reported sequence of Tn1207.3 (accession no. AY657002).

^cThe expected amplicon size was 453 bp according to the reported organization of the Tn1207.3 element (accession no. AY657002), whereas a larger size (6,807 bp) was expected according to the reported sequence of the Φ10394.4 element (accession no. AY445042).

^dThe primer was designed from the reported sequence of the Φ10394.4 element (accession no. AY445042).

FIG. 1.

Schematic representation of the genetic structure of the Tn1207.3/Φ10394.4 family of elements. The locations of the regions amplified by PCR are shown as boxes labeled with capital letters. PCR products were generated with the primers listed in Table 1. ORF numbering is indicated according to Tn1207.3 (accession no. AY657002). The region containing the ORF encoding the R28-like protein is a variable region existing only in the Φ10394.4 element (accession no. AY445042).

Recombinant DNA techniques and transformation procedures for type II modification methyltransferase gene cloning.

The primers MET-d2 and MET-r1, used to amplify and clone the type II modification methyltransferase gene of strain 2000V1004P, are listed in Table 1. The PCR product was digested with BamHI (MBI Fermentas, Vilnius, Lithuania) and PaeI (MBI Fermentas, Vilnius, Lithuania) under the conditions recommended by the supplier. Plasmid pGEM-3Z DNA was extracted from E. coli DH5α by using the Roche High Pure plasmid purification kit (Roche, Basel, Switzerland) according to the supplier's instructions. Ligation reactions were performed using T4 DNA ligase (MBI Fermentas, Vilnius, Lithuania). Transformants were selected on LA plates containing ampicillin (100 μg/ml). The presence of an insert of the appropriate size was confirmed by PCR.

RESULTS AND DISCUSSION

PFGE and detection of the mef and msr(D) genes.

We had previously abandoned the use of SmaI to type M-phenotype GAS, since it did not digest the DNAs of a subgroup of GAS isolates presenting this phenotype and resorted to its isoschizomer Cfr9I (11, 43). To identify any isolates that would be susceptible to SmaI digestion, the entire collection of 149 isolates was tested and the DNAs of six isolates were found to be digested with SmaI. The DNA of one of the S. dysgalactiae subsp. equisimilis isolates was also found to be refractory to SmaI digestion, whereas the DNAs of all pneumococci and S. agalactiae isolates were susceptible to cleavage by this endonuclease. Using specific primers, the presence and linkage of the mef and msr(D) genes, which are involved in macrolide resistance (14), in different streptococcal species were investigated by PCR. Of the 149 S. pyogenes isolates tested, 146 were positive for the presence and linkage of these genes, although the presence of the mef gene had previously been confirmed for all these isolates (44). Since the msr(D) gene was shown to be cotranscribed with the mef gene and to play an important role in erythromycin resistance in S. pneumoniae (14), the absence of a PCR product was possibly due to interstrain variability in the region targeted by the PCR primers, since variation in these genes was reported previously (2). For S. pneumoniae, S. agalactiae, and S. dysgalactiae subsp. equisimilis, all isolates showed the presence and linkage of both genes. These results are summarized in Table 2.

TABLE 2.

Susceptibility to SmaI digestion and PCR analysis of the macrolide-resistant streptococci analyzed

Species (n)	SmaI restriction	No. of isolates with the following ORF of the Tn1207.3/Φ10394.4 family of elementsa:
		mef-msr(D) [A]	orf8 [B]	orf12 [C]	orf39 [D]	Right junction [G]	Left junction [H]b	R28-like ORF [I]
S. pyogenes (149)	143 nontypeable	142	141	143	143	103	143
	6 typeable	4	5	4	4	3	6
S. pneumoniae (18)	18 typeable	18
S. agalactiae (5)	5 typeable	5					3
S. dysgalactiae subsp. equisimilis (4)	1 nontypeable	1	1	1	1	1	1
	3 typeable	3	2	3

^aThe number of isolates yielding a positive PCR product is indicated. For the regions amplified and the primers used, see Table 1 and Fig. 1. The PCR product designation is in brackets.

^bThe size of the PCR product, when present, is consistent with the presence of the Tn1207.3 element (see text).

PCR detection of the specific ORFs and discrimination of Tn1207.3 and Φ10394.4 elements.

In order to identify the general structure of the mef genetic elements in the streptococcal species analyzed, the presence of three phage-related ORFs belonging to the Tn1207.3/Φ10394.4 family was investigated. The ORFs are located in the conserved prophage-like region and include ORF8, putatively encoding an umuC-mucB-like product protein; ORF12, putatively encoding a protein similar to type II modification methyltransferases; and ORF39, putatively encoding a protein similar to large subunit terminases of bacteriophages (according to the annotations of the deposited sequence of Tn1207.3 [accession no. AY657002]). In order to discriminate between Tn1207.3 and Φ10394.4 genetic elements, the left junction between these elements and the comEC locus, their insertion site in the bacterial chromosome, was amplified by PCR. The expected amplicon size was 453 bp, according to the reported organization of the Tn1207.3 element (38), or 6807 bp, according to the reported sequence of Φ10394.4 (4) (Table 1 and Fig. 1). The presence of a Φ10394.4-specific ORF located in this region and annotated as encoding an R28-like protein was also investigated.

The results of PCR mapping experiments are summarized in Table 2. The amplification of the left junction of the insertion of either Tn1207.3 or Φ10394.4 at the comEC locus revealed that in most S. pyogenes isolates and in a single S. dysgalactiae subsp. equisimilis isolate, the element is inserted at the same site. Moreover, the size of the amplicon as well as the absence of a PCR product specific for the ORF encoding the R28-like protein establish Tn1207.3 as the element of the Tn1207.3/Φ10394.4 family present in these isolates. The absence in 43 GAS isolates of a PCR product targeting the Tn1207.3/Φ10394.4 right junction with the comEC locus is not consistent with these findings and may be due to alterations in the regions targeted by these primers in some isolates. Unexpected PCR products targeting the junctions of this element were also reported previously for a minority of GAS isolates (18).

In order to further confirm the presence of the same mef element, two long-range PCRs were performed, using as templates the DNAs of six S. pyogenes isolates representative of the major clones in Portugal (43) and the single S. dysgalactiae subsp. equisimilis isolate refractory to digestion with SmaI. The primers for these reactions were designed in order to amplify two overlapping regions covering most of the phage-like region of Tn1207.3 (Fig. 1). All isolates tested yielded PCR products of the same size and consistent with the presence of the entire Tn1207.3 element.

ORF12 of Tn1207.3/Φ10394.4 encodes M.Spy10394I.

Database searches identified M.ScrFIA (15) as the highest-scoring BLAST hit and a conserved domain of cytosine-C5-specific DNA methyltransferases (conserved domain database motif cd00315.3) in the product of ORF12.

To test the hypothesis that ORF12 of the chimeric elements encoded a type II modification methyltransferase responsible for the resistance to SmaI cleavage, it was decided to express this protein in E. coli. The sequencing of pMET10394.4 confirmed that the entire reading frame of ORF12 (GenBank accession no. DQ904353) was cloned in frame with the LacZα peptide. The total DNA of the recombinant E. coli harboring pMET10394.4 was then digested with SmaI and Cfr9I (a SmaI isoschizomer with different susceptibility to DNA methylation) (10). SmaI digested the total DNA of the control E. coli strain with plasmid pGEM-3Z but not the DNA of the strain carrying pMET10394.4. Cfr9I on the other hand, digested the total DNAs of both strains irrespective of the carried plasmid (data not shown), in agreement with our previous observations with S. pyogenes (11, 43).

In order to obtain further insights into the type of methylation promoted by this modification enzyme, the DNAs of 10 S. pyogenes isolates resistant to SmaI, representatives of the major clones in Portugal, were digested with MspI and HpaII. The recognition sequence of these endonucleases (CCGG) is contained within that of SmaI, and these two isoschizomers have different susceptibilities to the various modifications in their recognition sequence (10). All the tested isolates were digested by both enzymes, which indicated that the type II modification methyltransferase studied does not promote the methylation of the CCGG target sequence. These observations argue that the product of ORF12 is a type II methyltransferase with specificity for the CCCGGG sequence that was designated M.Spy10394I.

In conformity, the DNAs of all GAS isolates refractory to digestion by SmaI carried the Tn1207.3 chimeric element, and so did the single S. dysgalactiae subsp. equisimilis isolate resistant to cleavage by SmaI, while all the isolates of the species in which the chimeric element was absent were susceptible to cleavage by SmaI (Table 2).

Importantly, the single tetracycline-resistant GAS isolate presenting the M phenotype in this collection was susceptible to SmaI digestion, similar to what was previously reported (12, 24, 36), and showed none of the ORFs characteristic of the Tn1207.3/Φ10394.4 family. Contrary to the original hypothesis of Cocuzza et al., suggesting that the tet determinant repressed the SmaI modifying activity (12), it now appears that the methyltransferase and the tet determinant are carried by different genetic elements. Our findings offer further support to the recent suggestion that tetracycline-susceptible GAS presenting the M phenotype carry one of the two related elements Tn1207.3 and Φ10394.4, whereas among tetracycline-resistant isolates the tet(O)-mef(A) element was associated with a different prophage (9, 24). The good correspondence between tetracycline susceptibility and the presence of the Tn1207.3/Φ10394.4 elements observed in GAS was not found among S. pneumoniae and S. dysgalactiae subsp. equisimilis isolates, where tetracycline-susceptible isolates that did not carry either of these elements were found among the isolates analyzed.

A surprising observation was the detection of both PCR products targeting the phage region in four isolates whose DNAs were susceptible to cleavage by SmaI (Table 2). Since the entire coding region of ORF12 is amplified by PCR, this observation suggests that in these isolates either there are point mutations that impair the activity of M.Spy10394I or there are alterations in the promoter region that result in not enough M.Spy10394I being produced during the lysogenic state to prevent digestion of the DNA by SmaI.

Importance of the Tn1207.3/Φ10394.4 family in the rise and spread of macrolide resistance.

In order to evaluate the importance of the Tn1207.3/Φ10394.4 family in the rise and spread of macrolide resistant GAS presenting the M phenotype, the literature was reviewed for reports of isolates refractory to SmaI cleavage as a surrogate marker for the presence of this family of mef elements (Table 3). The earliest isolates of GAS reported to be resistant to cleavage with SmaI were recovered in Italy in 1992 (13), suggesting that this element may have arisen in Europe in the early 1990s. The earliest GAS isolates presenting the M phenotype in Europe, recovered in Sweden in the early 1980s, were T12, but this changed in 1989 to 1990, when T4 isolates started to dominate (27). This change paralleled an increase in macrolide-resistant GAS in Finland, also mainly due to the T4M4 serotype (40). Isolates of this serotype still account for large numbers of GAS isolates with the M phenotype in Europe and were shown to be resistant to cleavage by SmaI (see reference 43 and the references in Table 3), and the evidence presented here indicates that it carries the Tn1207.3 element. These observations further support the notion that this genetic element either arose or arrived in Europe in the early 1990s.

TABLE 3.

Studies presenting SmaI PFGE analysis of M-phenotype GAS

Reference	Yr of isolation	Location	Total no. of isolates	No. (%) of isolates with:
				Erythromycin resistance	M phenotype	M phenotype and resistant to SmaI cleavage
13	1992-1997	Central Italy	299	85 (28)	40 (47)	15 (38)
48	1993-1996	Northern Italy		31	21 (68)	4 (19)
6	1994-2002	Northern Italy	182	71 (39)	49 (69)	12 (24)
12	1996	Northern Italy	104	53 (51)	17 (32)	4 (40)a
39	1997	Northern Italy	221	106 (48)	30 (28)	Not determinedb
36	1997-1998	Italy	370	370 (100)	157 (42)	29 (18)
45	1997-1998	Italy	77	66 (86)	7 (11)	7 (100)
50	1997-1998	Southern Italy	152	152 (100)	44 (29)	15 (34)
19	1993-1997	Belgium	2014	131 (6)	110 (84)	92 (84)
31	1999-2003	Belgium	4031	506 (13)	279 (55)	Not determinedb
34	2001	Central Greece	300	58 (19)	40 (69)	40 (100)
49	1992-1998	Taiwan	204	129 (63)	83 (64)	0 (0)
47	1996-2002	Poland	816	98 (12)	5 (5)	3 (60)
8	2002-2003	France	322	72 (22)	19 (26)	19 (100)
20	1994-1999	Brazil	357	6 (2)	3 (50)	3 (100)
16	1997	Canada	3205	67 (2)	47 (70)	36 (77)
33	2000-2001	United States	318	153 (48)	153 (100)	Not determinedb
26	2002	United States	196	15 (8)	7 (58)	6 (86)
7	2000-2002	Japan	300	29 (10)	22 (76)	22 (100)

^aThe authors characterized by PFGE only 10 isolates presenting the M phenotype.

^bIn these studies the authors indicated that an alternative endonuclease was used to type isolates presenting the M phenotype due to extensive resistance to SmaI cleavage but did not state the exact number of isolates that were refractory to digestion.

Several reports from Italy documented isolates resistant to SmaI digestion, but they differed greatly in the proportion of these isolates among GAS presenting the M phenotype (Table 3). For Portugal, the data presented here document the dominance of isolates carrying the Tn1207.3 element among M-phenotype GAS. Similarly, elements of the Tn1207.3/Φ10394.4 family also seem to dominate among M-phenotype GAS in other European countries, such as Belgium, Greece, Poland, and France (Table 3). Although this element was absent in an older collection from Taiwan (1992 to 1998), it is well represented among recent M-phenotype GAS isolates from Brazil, Canada, the United States, and Japan, arguing for a worldwide dissemination of these related elements among macrolide-resistant GAS.

The data presented in this paper demonstrate that the Tn1207.3/Φ10394.4 family encodes a methyltransferase responsible for the resistance of the DNAs of the isolates carrying these elements to cleavage with SmaI. To date, the Tn1207.3/Φ10394.4 elements seem to be widely distributed in S. pyogenes but restricted in S. dysgalactiae subsp. equisimilis and S. agalactiae and absent from S. pneumoniae. Using resistance to this endonuclease as a marker for the presence of Tn1207.3/Φ10394.4, we argue for an important role of these related chimeric elements and their associated prophage in the worldwide emergence of macrolide-resistant GAS expressing the M phenotype.