Abstract
Among 313 Enterobacteriaceae from the United States with a ciprofloxacin MIC of ≥0.25 μg/ml and reduced susceptibility to ceftazidime, aac(6′)-Ib was present in 50.5% of isolates, and of these, 28% carried the cr variant responsible for low-level ciprofloxacin resistance. aac(6′)-Ib-cr was geographically widespread, stable over time, most common in Escherichia coli, equally prevalent in ciprofloxacin-susceptible and -resistant strains, and not associated with qnr genes.
Quinolone resistance is traditionally mediated by chromosomal mutations in bacterial topoisomerase genes, genes regulating expression of efflux pumps, or both (4, 5). In addition, qnr genes responsible for plasmid-borne quinolone resistance have been found in clinical isolates of Enterobacteriaceae (7). These genes encode pentapeptide repeat proteins that block the action of ciprofloxacin on bacterial DNA gyrase and topoisomerase IV (11). Recently, a new mechanism of transferable quinolone resistance was reported: enzymatic inactivation of certain quinolones. The cr variant of aac(6′)-Ib encodes an aminoglycoside acetyltransferase that confers reduced susceptibility to ciprofloxacin by N-acetylation of its piperazinyl amine (9). Aac(6′)-Ib-cr has two amino acid changes, Trp102Arg and Asp179Tyr, which together are necessary and sufficient for the enzyme's ability to acetylate ciprofloxacin. When both qnrA and aac(6′)-Ib-cr are present in the same cell, the level of resistance is increased fourfold more than that conferred by qnrA alone, with an MIC of ciprofloxacin of 1.0 μg/ml, a value near the clinical breakpoint for susceptibility. In addition, the presence of aac(6′)-Ib-cr alone increased substantially the frequency of selection of chromosomal mutants upon exposure to ciprofloxacin (9).
The three known qnr genes, qnrA, qnrB (6), and qnrS (3), and their variants have widely penetrated clinical isolates of Enterobacteriaceae from the United States and are present in a substantial minority of ceftazidime-resistant organisms (10). Among clinical Escherichia coli isolates collected in Shanghai, China, in 2000 to 2001, 51% had the cr variant of aac(6′)-Ib (9). No previous survey, however, has evaluated clinical isolates in the United States for the presence of aac(6′)-Ib-cr.
Test isolates were drawn from the Focus Diagnostics collection of Enterobacteriaceae from the years 1999, 2000, 2001, and 2004. This same strain set was previously surveyed for qnr genes (10), allowing a direct comparison of the distribution of qnr genes and aac(6′)-Ib-cr. No isolates were available from 2003, and only an incomplete set was available from 2002. Between January and March of each study year, participating clinical microbiology laboratories from each of the nine continental U.S. census regions provided 6,979 nonrepeat clinical isolates of requested enterobacterial genera without regard to antibiotic resistance phenotype. All Klebsiella pneumoniae, Enterobacter, and E. coli isolates with a ceftazidime MIC of ≥16 μg/ml and a ciprofloxacin MIC of ≥0.25 μg/ml were selected from this collection for study. Of 323 such isolates, 313 (97%) were available. Thirty-one (29%) of 106 K. pneumoniae isolates, 54 (34%) of 160 Enterobacter isolates, and none of 47 (0%) E. coli isolates were ciprofloxacin susceptible (MIC ≤ 1.0 μg/ml).
aac(6′)-Ib was amplified by PCR with primers 5′-TTGCGATGCTCTATGAGTGGCTA and 5′-CTCGAATGCCTGGCGTGTTT to produce a 482-bp product. Primers were chosen to amplify all known aac(6′)-Ib variants. PCR conditions were 94°C for 45 s, 55°C for 45 s, and 72°C for 45 s for 34 cycles. Strains positive and negative for aac(6′)-Ib were included as controls. All positives were further analyzed by digestion with BstF5I (New England Biolabs, Ipswich, MA) and/or direct sequencing of the PCR products with primer 5′ CGTCACTCCATACATTGCAA to identify aac(6′)-Ib-cr, which lacks the BstF5I restriction site present in the wild-type gene. Screening for qnrA, qnrB, and qnrS was carried out by multiplex PCR amplification as previously described (10).
MICs were determined by a broth microdilution method for ceftazidime, ciprofloxacin, trimethoprim-sulfamethoxazole, and gentamicin. Susceptibility interpretations were defined according to the Clinical and Laboratory Standards Institute (2). Statistical analysis used SPSS 14.0 software package (SPSS, Chicago, IL). A Mantel-Haenszel χ2 test was used for the comparison of dichotomous variables and trend analysis.
aac(6′)-Ib-cr was detected in 15 (32%) of 47 E. coli isolates, 17 (16%) of 106 K. pneumoniae isolates, and 12 (7.5%) of 160 Enterobacter isolates collected during the study period (Table 1). There was no statistically significant change in the overall prevalence of aac(6′)-Ib-cr over time, although aac(6′)-Ib-cr was detected in a slightly smaller proportion of isolates in 2004 than in the prior years studied.
TABLE 1.
Prevalence of aac(6′)-Ib-cr and qnr genes in Enterobacteriaceae from the United States
| Year | Variant | No. of isolates with aac(6′)-Ib variant/total no. of isolates (%)
|
||
|---|---|---|---|---|
| K. pneumoniae | Enterobacter spp. | E. coli | ||
| 1999 | cr | 5/21 (23.8) | 9/45 (20.0) | 3/9 (33.3) |
| Any | 9/21 (42.9) | 28/45 (62.2) | 4/9 (44.4) | |
| 2000 | cr | 4/33 (12.1) | 1/38 (2.6) | 4/8 (50.0) |
| Any | 19/33 (57.6) | 15/38 (39.5) | 7/8 (87.5) | |
| 2001 | cr | 5/20 (25.0) | 0/39 (0.0) | 2/5 (40.0) |
| Any | 13/20 (65.0) | 12/39 (30.8) | 3/5 (60.0) | |
| 2004 | cr | 3/32 (9.3) | 2/38 (5.2) | 6/25 (24.0) |
| Any | 23/32 (71.9) | 13/38 (34.2) | 12/25 (48.0) | |
| Total | cr | 17/106 (16.0) | 12/160 (7.5) | 15/47 (31.9) |
| No. of isolates with qnr/total no. of isolates (%) | 21/106 (20) | 50/160 (31) | 2/47 (4) | |
The Middle Atlantic region provided the largest number of isolates meeting inclusion criteria and the largest number of aac(6′)-Ib-cr-positive K. pneumoniae and E. coli isolates (Table 2). The Pacific region had the highest prevalence of aac(6′)-Ib-cr (22%) overall, but aac(6′)-Ib-cr-positive isolates of K. pneumoniae were found in all but three census regions, and isolates of Enterobacter and E. coli were found in all but four. Overall, there was no geographic clustering of aac(6′)-Ib-cr, but in comparison to other regions, the prevalence of Enterobacter isolates was higher in New England (4/14, 29% versus 8/146, 5.5%) (P = 0.005), and the prevalence of E. coli was higher in the Pacific region (5/7, 72% versus 10/40, 25%) (P = 0.03).
TABLE 2.
Geographic distribution of aac(6′)-Ib-cr-positive isolates
| Region | No. of isolates with aac(6′)-Ib-cr/total no. of isolates (%)
|
||
|---|---|---|---|
| K. pneumoniae | Enterobacter spp. | E. coli | |
| East North Central | 2/12 (16.7) | 1/22 (4.5) | 0/3 (0.0) |
| East South Central | 2/6 (33.3) | 0/27 (0.0) | 1/4 (25.0) |
| Middle Atlantic | 7/56 (12.5) | 3/30 (10.0) | 6/16 (37.5) |
| Mountain | 0/1 (0.0) | 0/9 (0.0) | 1/6 (16.7) |
| New England | 2/11 (18.2) | 4/14 (28.6) | 0/2 (0.0) |
| Pacific | 0/4 (0.0) | 2/21 (9.5) | 5/7 (71.4) |
| South Atlantic | 2/6 (33.3) | 2/21 (9.5) | 2/7 (28.6) |
| West North Central | 0/0 (0.0) | 0/6 (0.0) | 0/0 (0.0) |
| West South Central | 2/10 (20.0) | 0/10 (0.0) | 0/2 (0.0) |
There was no relationship between aac(6′)-Ib-cr prevalence and patient age, patient gender, or inpatient status. There was also no relationship between the presence of qnrA, -B, or -S genes and aac(6′)-Ib-cr. qnr genes were present in 7 of 44 (15.9%) aac(6′)-Ib-cr-positive strains compared to 66 of 269 (24.5%) aac(6′)-Ib-cr-negative strains (P = 0.26 by a two-tailed Fisher's exact test), indicating that the qnr genes and aac(6′)-Ib-cr can circulate independently (Table 3).
TABLE 3.
Characteristics of aac(6′)-Ib-cr-positive and aac(6′)-Ib-cr-negative isolates
| Characteristica | No. of isolates with characteristic/total no. of isolates with aac(6′)-Ib-cr result (%)
|
Odds ratio (95% confidence interval) | P valued | |
|---|---|---|---|---|
| Positive (%) | Negative (%) | |||
| Patient characteristics | ||||
| Age ≥ 65 years | 17/44 (38.6) | 105/269 (39.0) | 0.9 (0.5-1.9) | 0.96 |
| Maleb | 21/44 (47.7) | 137/267 (51.3) | 0.9 (0.5-1.6) | 0.66 |
| Inpatientc | 21/44 (47.7) | 158/262 (60.3) | 0.6 (0.3-1.1) | 0.12 |
| qnr positive | 7/44 (15.9) | 66/269 (24.5) | 0.6 (0.3-1.5) | 0.26 |
| Strain characteristics | ||||
| K. pneumoniae | ||||
| CIP-R | 12/17 (70.6) | 63/89 (70.8) | 1.0 (0.3-3.1) | 0.99 |
| GEN-R | 7/17 (41.2) | 55/89 (61.8) | 0.4 (0.2-1.2) | 0.12 |
| SXT-R | 12/17 (70.6) | 72/89 (80.9) | 0.6 (0.2-1.8) | 0.34 |
| Enterobacter spp. | ||||
| CIP-R | 8/12 (66.7) | 98/148 (66.2) | 1.0 (0.3-3.6) | 0.98 |
| GEN-R | 7/12 (58.3) | 74/148 (50.0) | 1.4 (0.4-4.6) | 0.58 |
| SXT-R | 10/12 (83.3) | 83/148 (56.1) | 3.9 (0.8-18.5) | 0.09 |
| E. coli | ||||
| CIP-R | 15/15 (100) | 32/32 (100) | ||
| GEN-R | 13/15 (86.7) | 18/32 (56.3) | 5.8 (1.1-29.6) | 0.04 |
| SXT-R | 9/15 (60.0) | 25/32 (78.1) | 0.4 (0.1-1.6) | 0.20 |
CIP, ciprofloxacin; GEN, gentamicin; SXT, trimethoprim-sulfamethoxazole; R, resistant.
Information on sex was not available for two patients.
Information on inpatient status was not available for seven patients.
P values were determined by a two-tailed Fisher's exact test.
We analyzed the relationship between aac(6′)-Ib-cr and susceptibility to ciprofloxacin, gentamicin, and trimethoprim-sulfamethoxazole. Among all isolates, the aac(6′)-Ib-cr allele was present in almost equal proportions of ciprofloxacin-susceptible (MIC, 0.25 to 1.0 μg/ml) and -resistant (MIC ≥ 2.0 μg/ml) isolates, and neither ciprofloxacin nor trimethoprim-sulfamethoxazole resistance was associated with aac(6′)-Ib-cr prevalence. In E. coli isolates, however, the risk of harboring aac(6′)-Ib-cr was significantly associated with gentamicin resistance (odds ratio, 5.78; 95% confidence interval, 1.1 to 29.6). Thirteen (42%) of 31 gentamicin-resistant isolates harbored aac(6′)-Ib-cr, in contrast to 2 (12%) of 16 gentamicin-susceptible isolates (Table 3), an unexpected association since aac(6′)-Ib-cr confers resistance to kanamycin but not to gentamicin (10).
Among ceftazidime-nonsusceptible enteric bacteria collected between 2000 and 2004 from across the United States, the prevalence of aac(6′)-Ib-cr was 44/313 (14%). The distribution of this variant, however, differed among species. It was detected most often in E. coli isolates, next most often in K. pneumoniae isolates, and least often in Enterobacter isolates (Table 1), a relative prevalence that is the reverse of that for the qnr genes (12). The reason for these differences is not yet understood, since it is known that some plasmids can carry both aac(6′)-Ib-cr and qnrA (10).
The most striking finding of our study was the wide penetration of the aac(6′)-Ib-cr allele. In nearly one-third of cases in which an allele of aac(6′)-Ib was identified, it was the cr variant. Although this variant gene was not reported until 2006, it was already present in more than half of multidrug-resistant E. coli isolates in Shanghai, China, in 2000 to 2001 (13), and it is now present in the majority of census regions of the United States. The various antibiograms and the range of species of the isolates studied suggest that the dissemination of aac(6′)-Ib-cr does not occur through clonal spread or the spread of a single plasmid. The diversity of plasmids on which this gene circulates is not yet known, but its presence as part of an integron cassette (1, 9) suggests that it could be widely mobile among plasmids.
Our analysis also indicated that there was no association between the aac(6′)-Ib-cr gene and qnr genes. This result is consistent with our previous results showing that E. coli strains from Shanghai carrying aac(6′)-Ib-cr are substantially more prevalent than those carrying qnrA, although a few strains carried both genes on plasmids that transferred higher levels of quinolone resistance than plasmids carrying either gene alone (9, 13).
The overall proportion of isolates harboring aac(6′)-Ib-cr was stable over time. Although the cr variant of aac(6′)-Ib encodes an enzyme that had slightly reduced efficiency in acetylation of kanamycin (9), it is not yet known whether there are any additional biological costs of this variant over other variants of aac(6′)-Ib. Selection pressures from the use of aminoglycosides that are enzyme substrates (kanamycin, tobramycin, and amikacin) and the use of quinolones with a piperazinyl amine that is subject to N-acetylation by the cr variant enzyme would be predicted to promote gene prevalence but have not yet been studied in clinical settings. It is interesting to speculate that future shifts in the choice of quinolones used to those that are not substrates for Aac(6′)-Ib-cr might reduce selection pressures for this variant but not for the qnr genes.
Acknowledgments
This work was supported in part by grants AI57576 (to D.C.H.) and AI43312 (to G.A.J.) from the National Institutes of Health, U.S. Public Health Service.
Footnotes
Published ahead of print on 5 September 2006.
REFERENCES
- 1.Casin, I., F. Bordon, P. Bertin, A. Coutrot, I. Podglajen, R. Brasseur, and E. Collatz. 1998. Aminoglycoside 6′-N-acetyltransferase variants of the Ib type with altered substrate profile in clinical isolates of Enterobacter cloacae and Citrobacter freundii. Antimicrob. Agents Chemother. 42:209-215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Clinical and Laboratory Standards Institute. 2005. Performance standards for antimicrobial susceptibility testing; 15th informational supplement. CLSI/NCCLS M100-S15. Clinical and Laboratory Standards Institute, Wayne, Pa.
- 3.Hata, M., M. Suzuki, M. Matsumoto, M. Takahashi, K. Sato, S. Ibe, and K. Sakae. 2005. Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother. 49:801-803. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Hooper, D. C. 1999. Mechanisms of quinolone resistance. Drug Resist. Updates 2:38-55. [DOI] [PubMed] [Google Scholar]
- 5.Hooper, D. C. 2000. Mechanisms of action and resistance of older and newer fluoroquinolones. Clin. Infect. Dis. 31:S24-S28. [DOI] [PubMed] [Google Scholar]
- 6.Jacoby, G. A., K. E. Walsh, D. M. Mills, V. J. Walker, H. Oh, A. Robicsek, and D. C. Hooper. 2006. qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob. Agents Chemother. 50:1178-1182. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Martínez-Martínez, L., A. Pascual, and G. A. Jacoby. 1998. Quinolone resistance from a transferable plasmid. Lancet 351:797-799. [DOI] [PubMed] [Google Scholar]
- 8.Nordmann, P., and L. Poirel. 2005. Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J. Antimicrob. Chemother. 56:463-469. [DOI] [PubMed] [Google Scholar]
- 9.Robicsek, A., J. Strahilevitz, G. A. Jacoby, M. Macielag, D. Abbanat, K. Bush, and D. C. Hooper. 2006. Fluoroquinolone modifying enzyme: a novel adaptation of a common aminoglycoside acetyltransferase. Nat. Med. 12:83-88. [DOI] [PubMed] [Google Scholar]
- 10.Robicsek, A., J. Strahilevitz, D. F. Sahm, G. A. Jacoby, and D. C. Hooper. 2006. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 50:2872-2874. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Tran, J. H., and G. A. Jacoby. 2002. Mechanism of plasmid-mediated quinolone resistance. Proc. Natl. Acad. Sci. USA 99:5638-5642. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Wang, M., D. F. Sahm, G. A. Jacoby, and D. C. Hooper. 2004. Emerging plasmid-mediated quinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinical isolates in the United States. Antimicrob. Agents Chemother. 48:1295-1299. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Wang, M., J. H. Tran, G. A. Jacoby, Y. Zhang, F. Wang, and D. C. Hooper. 2003. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother. 47:2242-2248. [DOI] [PMC free article] [PubMed] [Google Scholar]