Skip to main content
PMC home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2006 Aug 25;72(11):6948–6954. doi: 10.1128/AEM.00976-06

Minireplicon from pBtoxis of Bacillus thuringiensis subsp. israelensis▿

Mujin Tang 1, Dennis K Bideshi 1, Hyun-Woo Park 2, Brian A Federici 1,3,*
PMCID: PMC1636135  PMID: 16936050

Abstract

A 2.2-kb fragment containing a replicon from pBtoxis, the large plasmid that encodes the insecticidal endotoxins of Bacillus thuringiensis subsp. israelensis, was identified, cloned, and sequenced. This fragment contains cis elements, including iterons, found in replication origins of other large plasmids and suggests that pBtoxis replicates by a type A theta mechanism. Two genes, pBt156 and pBt157, encoding proteins of 54.4 kDa and 11.8 kDa, respectively, were present in an operon within this minireplicon, and each was shown by deletion analysis to be essential for replication. The deduced amino acid sequences of the 54.4-kDa and 11.8-kDa proteins showed no substantial homology with known replication (Rep) proteins. However, the 54.4-kDa protein contained a conserved FtsZ domain, and the 11.8 kDa protein contained a helix-turn-helix motif. As FtsZ proteins have known functions in bacterial cell division and the helix-turn-helix motif is present in Rep proteins, it is likely that these proteins function in plasmid replication and partitioning. The minireplicon had a copy number of two or three per chromosome equivalent in B. thuringiensis subsp. israelensis but did not replicate in B. cereus, B. megaterium, or B. subtilis. A plasmid constructed to synthesize large quantities of the Cry11A and Cyt1A endotoxins demonstrated that this minireplicon can be used to engineer vectors for cry and cyt gene expression.

The various subspecies of Bacillus thuringiensis are characterized by the synthesis of parasporal crystals during sporulation. These crystals are typically composed of one or more highly specific insecticidal or nematocidal endotoxin proteins (28). Most isolates of B. thuringiensis harbor an array of plasmids with sizes ranging from 2 kb to 600 kb, and the genes coding for endotoxins are typically located on large plasmids (10, 16). The cis elements and genes required for replication of small plasmids, such as pTX14-3 (2), have been well characterized. However, little is known about the cis elements or mechanisms involved in replicating and partitioning the large endotoxin-encoding plasmids.

One of the most important subspecies of B. thuringiensis is B. thuringiensis subsp. israelensis. This subspecies is highly insecticidal for the larvae of mosquitoes and blackflies and is presently used in many countries to control pest and vector species of these flies. The insecticidal activity of B. thuringiensis subsp. israelensis results principally from synergistic interactions of major endotoxin proteins, Cry11A (previously CryIVD), Cry4A, Cry4B, and Cyt1A (14, 27, 28). Recently, the nucleotide sequence of the large 128-kb plasmid, pBtoxis, that encodes these proteins was reported (7). Interestingly, comparative analyses of the 158 known and putative proteins encoded by pBtoxis revealed no homology with known plasmid replication proteins. However, comparative nucleotide analysis of pBtoxis and pXO1 of B. anthracis (25) suggested that a putative replication origin is present near the assigned first nucleotide position of pBtoxis (7). The region to the right of this position contains an open reading frame (ORF), pBt001, that encodes a putative peptide that shares about 76% amino acid identity with that encoded by pXO1-49, a gene located close to a putative replication origin of pXO1. Based on the relative positions of these genes and the sequence similarity between pBt001 and pXO1-49, it was suggested that they potentially play a role in plasmid replication (7). In addition, ORF pBt156, which occurs to the left of pBt101, encodes a peptide with weak amino acid similarity to the FtsZ/tubulin-like proteins of Pyrococcus (BAB17294) and pXO1-45. As the FtsZ protein family is known to function in cell division by forming a ring structure at the dividing septum, it was proposed that pBt156 functions in plasmid partitioning (7).

To determine whether the putative origin of replication, along with pBt001 and pBt156, plays a role in pBtoxis replication, we cloned and performed nested deletions and site-directed mutagenesis of nucleotide sequences within this region. Our results suggest that pBt156 and its flanking ORF (pBt157), but not pBt001, are essential for replication of pBtoxis. In addition, we show that these minimal sequences, referred to here as a minimal replicon (minireplicon), can be used as a replicon to construct plasmids for expression of the cry and cyt genes of B. thuringiensis, thereby providing a new plasmid vector for engineering various combinations of endotoxins into this species.

MATERIALS AND METHODS

Bacterial strains, plasmids, and DNA manipulation.

Bacterial strains and plasmids are listed in Table 1. DNA from B. thuringiensis and Escherichia coli were extracted using QIAGEN plasmid Midi and Maxi kits (QIAGEN), the Wizard plus miniprep DNA purification system (Promega), and the Bactozol kit (Molecular Research Center). DNA fragments were isolated from agarose gels using the QIAquick gel extraction kit (QIAGEN) and ligated using a Fast-Link DNA ligation kit (Epicenter).

TABLE 1.

Bacterial strains and plasmids

Strain or plasmid Description Source or reference
B. thuringiensis
    4Q7 Acrystalliferous strain of B. thuringiensis subsp. israelensis Bacillus Genetic Stock Center
    IPS82 Wild-type strain of B. thuringiensis subsp. israelensis harboring pBtoxis Bacillus Genetic Stock Center
    4Q5 Plasmid-cured mutant of B. thuringiensis subsp. israelensis; bears only pBtoxis plasmid Bacillus Genetic Stock Center
B. cereus NRRL B-569 Bacillus Genetic Stock Center
B. subtilis PY79 Global Bioresource Center
B. megaterium VT1660 Global Bioresource Center
Escherichia coli DH5α
Plasmids
    pUC19 High-copy-number E. coli vector containing multiple cloning sites; Ampr 36
    pHT3101 Shuttle vector of E. coli and B. thuringiensis 23
    pBtoxis 127-kb endogenous B. thuringiensis subsp. israelensis plasmid harboring entomocidal crystal toxin genes 7
    pBU4 7.3-kb plasmid containing a tetracycline resistance gene 8
    pC194 2.9-kb plasmid containing a chloramphenicol resistance gene 18
    pUCE pUC19 containing the erythromycin resistance gene from pHT3101 This work
    pBtKp(+) pUCE containing a 6.3-kb KpnI fragment of pBtoxis; the orientation of pBt001 is the same as lacZ promoter This work
    pBtKp(−) pUCE containing a 6.3-kb KpnI fragment of pBtoxis; the orientation of pBt001 is opposite to lacZ promoter This work
    pBtAg1 Deletion derivative of pBtKp containing a 2.6-kb KpnI/AgeI fragment This work
    pBtAg2 Deletion derivative of pBtKp containing a 3.7-kb KpnI/AgeI fragment This work
    pBtSa1 Deletion derivative of pBtKp containing a 4.5-kb KpnI/SalI fragment This work
    pBtSa2 Deletion derivative of pBtKp containing a 1.8-kb KpnI/SalI fragment This work
    pBtBs Deletion derivative of pBtKp containing a 2.4-kb KpnI/BstAPI fragment This work
    pBtXm Deletion derivative of pBtKp containing a 2.9-kb XmnI fragment This work
    pBtSw Deletion derivative of pBtKp containing a 2.2-kb SwaI fragment This work
    pBtΔ156 pBtSw derivative with ATG of pBt156 replaced by CCC This work
    pBtΔ157 pBtSw derivative with ATG of pBt157 replaced by TTT This work
    pUCEG pUC19 containing the erythromycin resistance gene from pHT3101 and the gyrb gene from the chromosome of B. thuringiensis subsp. israelensis This work
    pBtH pBtSw containing ∼10-kb HindIII fragment of pBtoxis This work
Open in a new tab

PCR.

PCR was performed with the Expand Long Template PCR System (Roche Molecular Biochemicals) in a Px2 system thermocycler (Thermo Hybaid) for 30 cycles as follows: 94°C, 30 s; 55°C, 30 s; 68°C, 2 min.

Construction of recombinant plasmids.

To construct pUCE, the 1.2-kb fragment containing the erythromycin resistance gene (erm) from pHT3101 (23) was amplified using primers Em-S-F and Em-S-R (Table 2), digested with SalI, and cloned into the same site in pUC19. Plasmid pUCEG was constructed by inserting a 1.2-kb gyrB gene (AY461780) (21) obtained by PCR with primers gyr-F and gyr-R (Table 2) into the SmaI site of pUCE.

TABLE 2.

Primers used for PCR amplification

Primer Sequence (5′→3′)a
Em-S-F ACGCGTCGACAGAAGCAAACTTAAGAGTGTG
Em-S-R ACGCGTCGACATCGATACAAATTCCCCGTAG
ORF156-F TTATCCCTTATTAAACAGTAATGAACTA
ORF156-R AATTCCTCCCCTATACTTATAAATTA
ORF157-F AAACATTTAATAGGGATCACTTTTATAC
ORF157-R AACTCCCATCTGTTTAATTAATTCTTGA
gyr-F AATAATAACTTTATGATAGCGTGC
gyr-R CGGTGGCGGTTACAAAGTTTCTGG
Open in a new tab
a

Restriction endonuclease cleavage sites for SalI are in boldface, and the mutated codons are underlined.

The plasmids pBtKp(+) and pBtKp(−) were obtained by inserting the 6.3-kb KpnI fragment from pBtoxis (AL731825), which spanned nucleotides (nt) 123999 to 2408, into the KpnI site of pUCE. This fragment contains the putative replication origin of pBtoxis (7) and ORFs pBt001, pBt156, pBt157, and pBt158 (Fig. 1). The orientations of pBt001 and the lacZ gene in pUC19 are the same in pBtKp(+) but opposite in pBtKp(−). Plasmid pBtKp(+) was double digested with either SmaI and AgeI, SmaI and SacI, or SmaI and XbaI, and the largest fragment from these digests, containing the parental plasmid pUCE and various deletions within the 6.3-kb fragment, were blunted with Klenow enzyme (Biolabs) and self-ligated to generate the pBtKp derivatives pBtAg1, pBtSa1, and pBtXb (Fig. 1). Similarly, pBtKp(−) was double digested with either SmaI and AgeI, SmaI and BstAPI, or SmaI and SacI, and the largest fragments were self-ligated to generate pBtAg2, pBtBs, and pBtSa2 (Fig. 1). Plasmids pBtXm and pBtSw (Fig. 1) were constructed by inserting the 2.9-kb XmnI fragment (nt 124124 to 127052) and the 2.2-kb SwaI fragment (nt 124407 to 126636), from the 6.3-kb KpnI fragment, into the SmaI site of pUCE.

FIG. 1.

FIG. 1.

Open in a new tab

Deletion mutants of the KpnI fragment used to identify a minireplicon of pBtoxis. The ability of each of the mutants to replicate in B. thuringiensis subsp. israelenses 4Q7 is indicated (+, capable; −, incapable).

Plasmid pBtH was constructed by inserting the 10-kb HindIII fragment from pBtoxis (nt 14238 to 24460), which contained the 20-kDa gene (34), along with the cry11Aa and cyt1Aa genes, into the HindIII site of pBtSw (Fig. 1). All constructs were confirmed by restriction enzyme and DNA sequence analyses.

Transformation.

Transformation of B. thuringiensis subsp. israelensis 4Q7, B. megaterium VT1660, B. cereus NRRL B-569, and B. subtilis PY79 with vectors bearing the minireplicon was performed as described previously (29, 31, 34, 35). For controls, B. cereus was transformed with pC194 (18) and B. subtilis and B. megaterium with pBU4 (8).

Site-directed mutagenesis.

The putative translational start codons (ATG) for ORFs pBt156 and pBt157 were replaced with CCC and TTT, respectively, by PCR using plasmid pBtSw as the template and primer pairs ORF156-F and ORF156-R, and ORF157-F and ORF157-R (Table 2), which were designed in inverted tail-to-tail directions to amplify the entire pBtSw. After PCR, the amplified linear DNAs were self-ligated to generate pBtΔ156 and pBtΔ157.

DNA probes.

The 2.4-kb fragment containing the erm and gyrB genes in pUCEG (see above) was amplified by PCR with primers gyr-F and Em-S-R (Table 2) and labeled using the Oligonucleotide 3′-end labeling kit (second generation; Roche).

Relative copy number determination.

The plasmid copy number was determined according to the method of Devine et al. (13), using the chromosome-specific gyrB and plasmid-specific erm probes. Fragments that hybridized were analyzed with the AlphaEaseFC software, and the ratio of signals from the erm gene to the gyrB gene was used to estimate of the number of plasmid copies per chromosome equivalent.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Bacterial strains were grown in 20 ml of NBG broth (26) at 30°C for 5 days, by which time the cells had sporulated and lysed. An equal volume (1.2 ml) from each culture was sedimented, and the proteins were seperated in a 10% polyacrylamide gel by SDS-PAGE (27).

Segregation stability assay.

The stabilities of plasmids pBtKp(+), pBtKp(−), and pBtSw in B. thuringiensis subsp. israelensis 4Q7 were determined using methods described previously (22).

RESULTS

Cloning the pBtoxis minireplicon.

To determine whether the region in pBtoxis (nucleotide positions 123999 to 2408) identified by Berry et al. (7) contained a replication origin, we cloned the 6.3-kb KpnI fragment containing this region into pUCE, a pUC19-based vector, to generate pBtKp. Following electroporation of B. thuringiensis subsp. israelensis 4Q7 with pBtKp, the recombinant strain B. thuringiensis subsp. israelensis 4Q7/pBtKp bearing this plasmid was recovered on LB agar plates containing erythromycin. No B. thuringiensis subsp. israelensis 4Q7 transformants were recovered after electroporation with pUCE. Plasmid analysis of B. thuringiensis subsp. israelensis 4Q7/pBtKp showed that pBtKp was present in the strain, demonstrating that the 6.3-kb KpnI fragment contained a replicon.

Minimal sequences (minireplicons) sufficient for replication.

In addition to the presence of a replicon, the 6.3-kb KpnI fragment contains four ORFs, pBt001, pBt156, pBt157, and pBt158, the last three of which putatively code for, respectively, a FtsZ/tubulin-related protein, a DNA-binding protein, and a transcriptional regulator. Using a series of overlapping deletion derivatives of pBtKp, the minimal sequences required for replication included those that contained intact ORF156 and ORF157, i.e., plasmids pBtAg2, pBtXm, and pBtSw (Fig. 1). Plasmids containing intact ORF156 but deficient or partially deficient in ORF157 sequences, or vice versa (pBtXb, pBtAg1, pBtSa1, pBtSa2, and pBtBs), did not replicate (Fig. 1). Thus, the smallest autonomously replicating DNA sequence was located on a 2.2-kb SwaI fragment in pBtSw (Fig. 2). This fragment is defined here as a minireplicon of pBtoxis.

FIG. 2.

FIG. 2.

Open in a new tab

Nucleotide sequence of the 2.2-kb SwaI region of pBtoxis from B. thuringiensis subsp. israelensis. The fragment contains a putative operon composed of two ORFs, ORF156 (pBt156) and ORF157 (pBt157). The predicted amino acid sequences are shown beneath the nucleotide sequence. Direct- and inverted-repeat sequences (a, b, c, and d) are indicated by arrows. Signature ribosome binding sequences (RBS) are underlined. Iterons and potential DnaA boxes are boxed and shaded, respectively. The tubulin superfamily signature motif in pBt156 is double underlined, and the helix-turn-helix motifs at positions 43 to 65 with residues that form alpha (α) helices in pBt157 are underlined in boldface.

Sequence analyses of the pBtoxis minireplicon.

Sequence analyses of the minireplicon in the 2.2-kb SwaI fragment (Fig. 2) suggested that it contained an operon composed of ORFs pBt157 and pBt156. Signature ribosome binding sites were found upstream of these ORFs, at positions 181 to 185 (GGAGT) and 514 to 518 (GGAGG), respectively. Our analyses also revealed the presence of a 12-bp direct-repeat DNA motif (TAAAGGTTTAAA; A+T% = 87%) upstream of pBt157 (Fig. 2) that resembled the so-called iteron motif, common in replication origins of theta-replicating plasmids, which serves as a site for interactions of replication proteins (12). In addition, an 8-bp inverted repeat (AAATTTAA) was present upstream of pBt157 at the start of the sequence and within the putative iteron. Four putative DnaA boxes (TTA/TTNCACA) (20), sequences to which the replication initiator protein DnaA binds, were also present (Fig. 2).

The pBt157 gene (nt 192 to 506) coded for a putative peptide (ORF157) of 104 amino acid residues (Mr, 11,800), and pBt156 (nt 527 to 1981) coded for a putative peptide of 484 amino acids (ORF156; Mr, 54,400). Previous analyses suggested that ORF157 is a DNA-binding protein with a predicted helix-turn-helix (HTH) motif at amino acids 41 to 62 (7). In our studies, alignment of ORF157 with MarR, a repressor of multiple antibiotic resistance genes in E. coli (1), placed the helix-turn-helix motif at residues 43 to 65 (Fig. 2). Berry et al. (7) reported that ORF156 showed weak similarity to FtsZ/tubulin-like proteins from Pyrococcus (BAB17294; 21% identity) and pXO1-45 (21% identity). Our analyses agree with this conclusion. In addition, we identified the signature motif (GGGTVGTG; residues 138 to 143) (Fig. 2) in ORF156 that is characteristic of the tubulin protein superfamily (11).

pBt156 and pBt157 are required for minireplicon replication.

When the translation start codon of either ORF156 or ORF157 was disrupted, B. thuringiensis subsp. israelensis 4Q7 transformants were not recovered following electroporation with the mutant plasmids (pBtΔ156 and pBtΔ157), indicating that both ORF156 and ORF157 are required for minireplicon replication.

Determination of the copy number for pBtSw.

Densitometric analysis of hybridization bands showed that the intensity of the erm gene derived from pBtSw was two to three times that of the single chromosomally derived gyrB gene (data not shown), indicating a copy number of two or three per chromosome equivalent.

Segregation stability.

Studies of the segregation stabilities of pBtKp and pBtSw, which contained the 6-kb KpnI and the 2.2-kb SwaI fragments, respectively, showed that these plasmids were unstable in the absence of positive selection with erythromycin. Virtually 100% of the cells from colonies grown without selection after 20 generations failed to grow in LB medium with erythromycin.

Replication of the pBtoxis minireplicon in other Bacillus species.

Plasmid pBtSw, which contained the pBtoxis minireplicon, was tested for its ability to replicate in B. cereus, B. megaterium, and B. subtilis. Whereas the control plasmids replicated after transformation in these species, pBtSw did not. Specifically, pC194 replicated in B. cereus (∼300 CFU/μg DNA) and pBU4 replicated in both B. subtilis and B. megaterium (∼500 CFU/μg DNA). No colonies were obtained with these species transformed with pBtSw. Furthermore, when wild-type B. thuringiensis subsp. israelensis IPS82, which contains pBtoxis, was transformed with plasmids containing the minireplicon, very few colonies (∼5%) produced crystal toxins, indicating a loss of parental pBtoxis in most transformants. Incompatibility between the B. thuringiensis recombinant and resident plasmids from which the replicons in recombinants were derived has been reported previously (6).

Expression of cry and cyt genes using the minimal replicon.

Recombinant 4Q7 cells transformed with pBtH (Fig. 3A), the plasmid containing the minimal replicon, along with the 10-kb HindIII fragment of pBtoxis that contains the cry11Aa, cyt1Aa, and p20 genes (7), synthesized large inclusions that were clearly visible by light microscopy (Fig. 3B). The presence of Cry11A and Cyt1A was confirmed by SDS-PAGE analysis, which showed that the recombinant strain containing this plasmid synthesized amounts of these toxins similar to those produced by B. thuringiensis subsp. israelensis strain 4Q5 (Fig. 3C).

FIG. 3.

FIG. 3.

Open in a new tab

Synthesis of Cry11A and Cyt1A using the minireplicon sequence derived from pBtoxis. (A) Map of recombinant plasmid pBtH constructed using the minireplicon in pBtSw (Fig. 1) and the ∼10-kb HindIII fragment from pBtoxis that contains the cry11A, cyt1A, and 20-kDa genes. (B) Phase-contrast microscopy showing crystals (arrows) in cells of B. thuringiensis subsp. israelensis strain 4Q7 transformed with pBtH. (C) SDS-PAGE analyses of recombinant strains and wild-type strains of B. thuringiensis subsp. israelensis, strain 4Q7 pBtH (lane 1), strain 4Q5 (lane 2), strain pBtSw (lane 3) (Fig. 1), and strain 4Q7 (lane 4). Lane M, protein molecular mass standards.

DISCUSSION

In the present study, we demonstrated that a 2.2-kb fragment spanning nucleotide positions 124407 to 126636 in pBtoxis (7) contains an origin of replication, referred to here as a minireplicon, that bears an operon coding for two peptides, ORF156 and ORF157, both of which are required for replication. Our sequence analyses, together with those of Berry et al. (7), show canonical features of plasmid replication origins, including a high A-T ratio, direct-repeat sequences (iterons) and DnaA box motifs for replication initiation, and putative replication (Rep) proteins, characteristic of the group A family of theta replicons (9; http://www.essex.ac.uk/bs/staff/osborn/DPR/DPR_ThetaData.htm).

Modes of plasmid replication from a wide variety of prokaryotes fall within two categories of mechanisms, the so-called rolling-circle mechanism and the theta mechanism. Whereas the rolling-circle mechanism is the preferred mode for replicating small plasmids (less than ∼15 kb), large plasmids typically replicate by the theta mechanism (5, 6, 19, 30). At present, five large plasmids with low sequence homology, three (p43, p44, and p60) from B. thuringiensis subsp. kurstaki HD263 and two (pHT73 and pAW63) from B. thuringiensis subsp. kurstaki HD73, have been shown to replicate by the theta mechanism (4, 6, 15, 33). Although pBtoxis shares no significant homology with other large plasmids in B. thuringiensis (7), the structural features of its minireplicon, which include putative iteron sequences and DnaA boxes, suggest that it also replicates using the theta mechanism.

Although we have shown that ORF156 and ORF157, encoded by, respectively, pBt156 and pBt157, are essential for replicating the pBtoxis minireplicon, the precise roles of these proteins remain unknown. The presence of a conserved HTH motif in ORF157 (7), however, suggests a functional role in DNA binding. The HTH motif is present in many prokaryotic and eukaryotic proteins that function in transcription, DNA replication and repair, RNA metabolism, and protein-protein interactions in diverse signaling pathways (3). As plasmid-encoded Rep proteins, which also contain HTH, together with DnaA, accumulate at AT-rich sites at replication origins to initiate plasmid replication (12), we propose a similar role for ORF157. Furthermore, as Rep-DNA-DnaA complexes are also known to play a role in plasmid partitioning (12), ORF157 could play a similar role. In this regard, ORF156, which shows similarity to FtsZ/tubulin-like proteins, could potentially function with ORF157 in plasmid partitioning. The prokaryotic FtsZ protein is a polymer-forming GTPase that shares structural and functional similarities with eukaryotic tubulins (32). FtsZ assembles into a ring structure on the inner surface of the cytoplasmic membrane at the site of cell division. The so-called Z ring is progressively reduced in diameter, a process which leads to invagination of the dividing septum (32). It is possible that ORF156 and ORF157 function together to mediate partitioning of pBtoxis into daughter cells.

The low copy number (two or three copies per chromosome) for the pBtoxis minireplicon was expected, as it is typical for replicons derived from large plasmids (17). The unstable inheritance of the minireplicon when propagated in the absence of antibiotic selection is also not unexpected, because other loci, such as par (12), associated with efficient partitioning of this artificial plasmid are absent. The inability of the pBtoxis minireplicon to replicate in B. cereus, B. megaterium, and B. subtilis suggests that these bacteria lack replicative proteins that recognize cis elements in the minireplicon or proteins that can interact effectively with ORF156 and ORF157. Alternatively, the recombinant plasmid harboring the minireplicon could have been degraded by host cell restriction modification systems (6, 24).

Finally, for commercial and regulatory purposes, one of our primary interests is to develop expression vectors for the synthesis of insecticidal Cry and Cyt proteins using nucleotide sequences native to B. thuringiensis subsp. israelensis. Current regulations for the registration of genetically engineered bacterial insecticides favor recombinants that have as little foreign DNA as possible. The high levels of Cry11A and Cyt1A synthesis that we obtained (Fig. 3) demonstrated that the pBtoxis minireplicon can be used for this purpose and thus has utility in genetically manipulating B. thuringiensis to produce novel combinations of insecticidal proteins.

Acknowledgments

We thank Jeffrey J. Johnson for technical assistance during this study.

This research was supported by a grant to B.A.F. from the U.S. National Institutes of Health (AI 145817).

Footnotes

▿

Published ahead of print on 25 August 2006.

REFERENCES

  • 1.Alekshun, M. N., S. B. Levy, T. R. Mealy, B. A. Seaton, and J. F. Head. 2001. The crystal structure of MarR, a regulator of multiple antibiotic resistance, at 2.3 Å resolution. Nat. Struct. Biol. 8:710-714. [DOI] [PubMed] [Google Scholar]
  • 2.Andrup, L., J. Damgaard, K. Wassermann, L. Boe, S. M. Madsen, and F. G. Hansen. 1994. Complete nucleotide sequence of the Bacillus thuringiensis subsp. israelensis plasmid pTX14-3 and its correlation with biological properties. Plasmid. 31:72-88. [DOI] [PubMed] [Google Scholar]
  • 3.Aravind, L., V. Anantharaman, S. Balaji, M. M. Babu, and L. M. Iyer. 2005. The many faces of the helix-turn-helix domain: transcription regulation and beyond. FEMS Microbiol. Rev. 29:231-262. [DOI] [PubMed] [Google Scholar]
  • 4.Baum, J. A., D. M. Coyle, M. P. Gilbert, C. S. Jany, and C. Gawron-Burke. 1990. Novel cloning vectors for Bacillus thuringiensis. Appl. Environ. Microbiol. 56:3420-3428. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Baum, J. A., and J. M. Gonzalez, Jr. 1992. Mode of replication, size and distribution of naturally occurring plasmids in Bacillus thuringiensis. FEMS Microbiol. Lett. 96:143-148. [DOI] [PubMed] [Google Scholar]
  • 6.Baum, J. A., and P. Gilbert. 1991. Characterization and comparative analysis of replication origins from three large Bacillus thuringiensis plasmids. 173:5280-5289. [DOI] [PMC free article] [PubMed]
  • 7.Berry, C., S. O'Neil, E. Ben-Dov, A. F. Jones, L. Murphy, M. A. Quail, M. T. Holden, D. Harris, A. Zaritsky, and J. Parkhill. 2002. Complete sequence and organization of pBtoxis, the toxin-coding plasmid of Bacillus thuringiensis subsp. israelensis. Appl. Environ. Microbiol. 68:5082-5095. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bourgouin, C., A. Delécluse, F. de la Torre, and J. Szulmajster. 1990. Transfer of the toxin protein genes of Bacillus sphaericus into Bacillus thuringiensis subsp. israelensis and their expression. Appl. Environ. Microbiol. 56:340-344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Bruand, C., E. Le Chartelier, S. D. Ehrlich, and L. Janniere. 1993. A fourth class of theta-replicating plasmids: The pAMβ1 family from Gram-positive bacteria. Proc. Natl. Acad. Sci. USA 90:11668-11672. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Carlson, C. R., T. Johansen, M. M. Lecadet, and A. B. Kolsto. 1996. Genomic organization of the entomopathogenic bacterium Bacillus thuringiensis subsp. berliner 1715. Microbiology 42:1625-1634. [Google Scholar]
  • 11.de Boer, P., R. Crossley, and L. Rothfield. 1992. The essential bacterial cell-division protein FtsZ is a GTPase. Nature 59:254-256. [DOI] [PubMed] [Google Scholar]
  • 12.del Solar, G., R. Giraldo, M. J. Ruiz-Echevarria, M. Espinosa, and R. Diaz-Orejas. 1998. Replication and control of circular bacterial plasmids. Microbiol. Mol. Biol. Rev. 62:434-464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Devine, K. M., S. T. Hogan, D. G. Higgins, and D. J. McConnell. 1989. Replication and segregational stability of Bacillus plasmid pBAA1. J. Bacteriol. 171:1166-1172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Federici, B. A., H. W. Park, D. K. Bideshi, M. C. Wirth, and J. J. Johnson. 2003. Recombinant bacteria for mosquito control. J. Exp. Biol. 206:3877-3885. [DOI] [PubMed] [Google Scholar]
  • 15.Gamel, P. H., and J. C. Piot. 1992. Characterization and properties of a novel plasmid vector for Bacillus thuringiensis displaying compatibility with host plasmids. Gene 120:17-26. [DOI] [PubMed] [Google Scholar]
  • 16.González, J. M., Jr., and B. C. Carlton. 1980. Patterns of plasmid DNA in crystalliferous and acrystalliferous strains of Bacillus thuringiensis. Plasmid 3:92-98. [DOI] [PubMed] [Google Scholar]
  • 17.Gordon, S., J. Rech, D. Lane, and A. Wright. 2004. Kinetics of plasmid segregation in Escherichia coli. Mol. Microbiol. 51:461-469. [DOI] [PubMed] [Google Scholar]
  • 18.Horinouchi, S., and B. Weisblum. 1982. Nucleotide sequence and functional map of pC194, a plasmid that specifies inducible chloramphenicol resistance. J. Bacteriol. 150:815-825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Khan, S. A. 1997. Rolling-circle replication of bacterial plasmids. Microbiol. Mol. Biol. Rev. 61:442-455. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kornberg, A., and T. Baker. 1992. DNA replication, 2nd ed. Freeman, New York, N.Y.
  • 21.La Duc, M. T., M. Satomi, N. Agata, and K. Venkateswaran. 2004. gyrB as a phylogenetic discriminator for members of the Bacillus anthracis-cereus- thuringiensis group. J. Microbiol. Methods 56:383-394. [DOI] [PubMed] [Google Scholar]
  • 22.Lereclus, D., and O. Arantes. 1992. spbA locus ensures the segregational stability of pTH1030, a novel type of gram-positive replicon. Mol. Microbiol. 6:35-46. [DOI] [PubMed] [Google Scholar]
  • 23.Lereclus, D., O. Arantes, J. Chaufaux, and M. Lecadet. 1989. Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol. Lett. 51:211-217. [DOI] [PubMed] [Google Scholar]
  • 24.Murray, N. E. 2002. Immigration control of DNA in bacteria: self versus non-self. Microbiology 148:3-20. [DOI] [PubMed] [Google Scholar]
  • 25.Okinaka, R. T., K. Cloud, O. Hampton, A. R. Hoffmaster, K. K. Hill, P. Keim, T. M. Koehler, G. Lamke, S. Kumano, J. Mahillon, D. Manter, Y. Martinez, D. Ricke, R. Svensson, and P. J. Jackson. 1999. Sequence and organization of pXO1, the large Bacillus anthracis plasmid harboring the anthrax toxin genes. J. Bacteriol. 181:6509-6515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Park, H. W., D. K. Bideshi, J. J. Johnson, and B. A. Federici. 1999. Differential enhancement of Cry2A versus Cry11A yields in Bacillus thuringiensis by use of the cry3A STAB mRNA sequence. FEMS Microbiol. Lett. 181:319-327. [DOI] [PubMed] [Google Scholar]
  • 27.Park, H. W., D. K. Bideshi, M. C. Wirth, J. J. Johnson, W. E. Walton, and B. A. Federici. 2005. Recombinant larvicidal bacteria with markedly improved efficacy against Culex vectors of West Nile Virus. Am. J. Trop. Med. Hyg. 72:732-738. [PubMed] [Google Scholar]
  • 28.Schnepf, E., N. Crickmore, J. Van Rie, D. Lereclus, J. Baum, J. Feitelson, D. R. Zeigler, and D. H. Dean. 1998. Bacillus thuringiensis and its pesticidal crystal proteins. Microbiol. Mol. Biol. Rev. 62:775-806. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Schurter, W., M. Geiser, and D. Mathe. 1989. Efficient transformation of Bacillus thuringiensis and B. cereus via electroporation: Transformation of acrystalliferous strains with a cloned delta-endotoxin gene. Mol. Gen. Genet. 218:177-181. [DOI] [PubMed] [Google Scholar]
  • 30.Titok, M. A., J. Chapuis, Y. V. Selezneva, A. V. Lagodich, V. A. Prokulevich, S. D. Ehrlich, and L. Janniere. 2003. Bacillus subtilis soil isolates: plasmid replicon analysis and construction of a new theta-replicating vector. Plasmid 49:53-62. [DOI] [PubMed] [Google Scholar]
  • 31.Turgeon, N., C. Laflamme, J. Ho, and C. Duchaine. 2006. Elaboration of an electroporation protocol for Bacillus cereus ATCC 14579. J. Microbiol. Methods [Online/doi: 10.1016/j.mimet.2006.05.005.] [DOI] [PubMed]
  • 32.Vaughan, S., B. Wickstead, K. Gull, and S. G. Addinall. 2004. Molecular evolution of FtsZ protein sequences encoded within the genomes of Archaea, Bacteria, and Eukaryota. J. Mol. Evol. 58:19-39. [DOI] [PubMed] [Google Scholar]
  • 33.Wilcks, A., L. Smidt, O. A. Okstad, A. B. Kolsto, J. Mahillon, and L. Andrup. 1999. Replication mechanism and sequence analysis of the replicon of pAW63, a conjugative plasmid from Bacillus thuringiensis. J. Bacteriol. 181:3193-3200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wu, D., and B. A. Federici. 1993. A 20-kilodalton protein preserves cell viability and promotes CytA crystal formation during sporulation in Bacillus thuringiensis. J. Bacteriol. 175:5276-5280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Xue, G. P., J. S. Johnson, and B. P. Dalrymple. 1999. High osmolarity improves the electro-transformation efficiency of the gram-positive bacteria Bacillus subtilis and Bacillus licheniformis. J. Microbiol. Methods 34:183-191. [Google Scholar]
  • 36.Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mp18 and pUC19 vectors. Gene 33:103-119. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES