Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2006 Sep 15;188(22):7830–7839. doi: 10.1128/JB.00979-06

A Novel Gene Involved in Regulating the Flagellar Gene Cascade in Proteus mirabilis

Lindsay G Stevenson 1, Philip N Rather 1,2,*
PMCID: PMC1636314  PMID: 16980463

Abstract

In this study, we identified a transposon insertion in a novel gene, designated disA, that restored swarming motility to a putrescine-deficient speA mutant of Proteus mirabilis. A null allele in disA also increased swarming in a wild-type background. The DisA gene product was homologous to amino acid decarboxylases, and its role in regulating swarming was investigated by examining the expression of genes in the flagellar cascade. In a disA mutant background, we observed a 1.4-fold increase in the expression of flhDC, which encodes FlhD2C2, the master regulator of the flagellar gene cascade. However, the expressions of class 2 (fliA, flgM) and class 3 (flaA) genes were at least 16-fold higher in the disA background during swarmer cell differentiation. Overexpression of DisA on a high-copy-number plasmid did not significantly decrease flhDC mRNA accumulation but resulted in a complete block in mRNA accumulation for both fliA and flaA. DisA overexpression also blocked swarmer cell differentiation. The disA gene was regulated during the swarming cycle, and a single-copy disA::lacZ fusion exhibited a threefold increase in expression in swarmer cells. Given that DisA was similar to amino acid decarboxylases, a panel of decarboxylated amino acids was tested for effects similar to DisA overexpression, and phenethylamine, the product of phenylalanine decarboxylation, was capable of inhibiting both swarming and the expression of class 2 and class 3 genes in the flagellar regulon. A DisA-dependent decarboxylated amino acid may inhibit the formation of active FlhD2C2 heterotetramers or inhibit FlhD2C2 binding to DNA.


Proteus mirabilis is capable of a complex differentiation that results in the formation of an elongated swarmer cell from a short rod. This differentiation occurs upon the transfer of cells from a liquid medium to a solid surface and is marked by elongated, aseptate, and hyperflagellated cells. Reviews on this process provide additional details (12, 15, 21, 22, 23). Swarmer cells align themselves in multicellular rafts and move in a coordinated fashion to a new location (16). The swarmer cell represents a transient state, and after a period of migration, the swarmer cell dedifferentiates back to the vegetative cell in a process termed consolidation. After a new period of growth, the consolidated vegetative cells then differentiate back to swarmer cells, followed by a new period of cell migration. This cyclic process results in the formation of swarming rings on an agar plate, where each ring represents one cycle of differentiation/dedifferentiation.

A large number of genes that function in diverse aspects of physiology and metabolism are required for swarming and have revealed the complexity of this process (see references 3-6, 11, 13, 14, 18, 26, and 27; reviewed in reference 22). Swarmer cell differentiation is dependent on certain environmental conditions that include a solid surface, inhibition of flagellar rotation, and cell-cell signaling (1, 6, 27).

In P. mirabilis, a key regulator of both flagellin expression and swarmer cell differentiation is FlhDC, a heterodimeric activator that activates class 2 genes required for flagellar biogenesis (7, 8, 9, 11, 13). In P. mirabilis, a three-tiered system of flagellar regulation similar to that in Escherichia coli is likely to be present (3, 13, 19). FlhD2C2, a transcriptional activator, acts as the primary regulator and incorporates environmental and cell growth phase signals in order to activate class 2 genes. These class 2 genes include fliA, encoding sigma 28. The FliA sigma factor then activates a third group of genes, class 3, needed for final flagellar assembly, including the flagellar filament protein FlaA or FliC (3, 13). In P. mirabilis, FlaA (FliC) and FlhDC expression is maximal during swarmer cell differentiation and then decreases sharply during consolidation (8, 13, 19).

The role of cell-to-cell signaling in the swarming process is poorly understood. The LuxS-dependent AI-2 signal is produced by P. mirabilis but does not have a role in swarming (24). Recently, a possible role for putrescine as a signaling molecule has been identified (27). Mutations in speA, encoding arginine decarboxylase, or speB, encoding agmatine ureohydrolase, block a major pathway for putrescine production and result in a 2- to 3-h delay in swarmer cell differentiation. The normal timing of swarmer cell differentiation could be restored in speA or speB mutants by a secreted signal, presumably putrescine, from wild-type but not speA mutant cells. In addition, exogenous putrescine at 25 μM could completely restore the normal timing of swarmer cell differentiation in speA mutants (27).

This study reports the characterization of a novel extragenic suppressor mutation generated by mini-Tn5 that increases swarming motility to a putrescine-deficient speA mutant of P. mirabilis. This suppressor results from a null allele in disA, encoding a putative amino acid decarboxylase. Data from this study are consistent with a role for DisA in inhibiting the assembly or activity of the FlhDC master activator in the flagellar regulon of P. mirabilis.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

The bacterial strains and plasmids used in this study are listed in Table 1. P. mirabilis strain PM7002 was obtained from the ATCC. P. mirabilis PM437 (speA::mini-Tn5 lacZ1) has been previously described (27). LS1 is a PM437 derivative containing a disA::mini-Tn5 Cmr insertion. Strain LS10 is a PM7002 derivative containing a disA::mini-Tn5 lacZ1 insertion. Escherichia coli strains XL1-Blue (Stratagene) and SM10 λpir were used as hosts for transformations and plasmid propagation. Plasmids pKNG101 and pBluescript II.SK were used as cloning vectors. Media for both broth and agar plates consisted of LB (10 g tryptone, 5 g yeast extract, and 5 g NaCl per liter). Agar was used at a concentration of 1.5%. Thirty-milliliter volumes of LB broth cultures were used for conditioned medium preparations. Cells were grown to the designated optical density and harvested by pelleting at 4,300 × g for 10 min. Cell-free supernatants were prepared by adjusting the pH to 7.5 and filter sterilizing with a 0.22-μm filter unit (Nalgene). The first 5 ml was discarded to wash off filter components. Individual cultures for assay of β-galactosidase were grown in 3 ml of LB and shaken at 250 rpm at 37°C. Assays of β-galactosidase were carried out with sodium dodecyl sulfate (SDS)-chloroform-permeabilized cells. Swarming assays were carried out either using 82-mm plates with 25 ml of LB agar per plate or in 243- by 243- by 18-mm square plates (Nunc) with 200 ml of agar per plate. Each plate was dried with the top off at 37°C for 30 min before inoculation. Plates were inoculated by the addition of overnight cultures diluted to an optical density at 600 nm (OD600) of 0.3, and the then plates were incubated at 37°C for 12 h.

TABLE 1.

Bacterial strains and plasmids

Strain or plasmid Description and/or relevant genotypea Source or reference
Plasmids
    pBluescript II.SK Apr, high copy number Stratagene
    pBC.SK Cmr, high copy number Stratagene
    pKNG101 R6K-derived suicide vector, Smr 17
    pSK.DisA pSK with disA RBS and coding region This study
    pBC.DisA pBC.SK with disA RBS and coding region This study
E. coli strains
    XL1-Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 Δ(lac-pro) [F′ proAB lacIqZΔM15 Tn10] Stratagene
    SM10 λpir thi thr leu tonA lacY supE recA RP4-2-Tc::Mu Kmr λpir V. deLorenzo
P. mirabilis strains
    PM7002 Wild type ATCC
    PM437 speA::mini-Tn5 lacZ1 27
    PM539 Nonswarming; putrescine producer 26
    LS1 PM437 disA1::mini-Tn5Cm This study
    LS2 PM437 disA2::Smr This study
    LS3 PM7002 disA2::Smr This study
    LS10 PM7002 disA3::mini-Tn5 lacZ1 This study
a

RBS, ribosome binding site.

Transposon mutagenesis.

A conjugal mating was used to introduce mini-Tn5 Cmr into the P. mirabilis chromosome. Overnight cultures of E. coli SM10/pUT::mini-Tn5 Cmr (10) and P. mirabilis PM437 or PM7002 were mixed together in 300-μl aliquots, plated on an LB agar plate, and grown for 8 h at 37°C. Cells were then scraped off the plate, resuspended in LB broth, and plated on LB agar plates containing tetracycline (15 μg/ml) and chloramphenicol (80 μg/ml). Plates were monitored for colonies with increased swarming, which were characterized further. Southern blot analysis of the disA::mini-Tn5 Cmr insertion was carried out using a digoxigenin-labeled probe specific to the chloramphenicol cassette of mini-Tn5Cm. An approximately 5-kb fragment of XbaI containing the mini-Tn5Cm insertion and flanking disA sequences was identified and cloned into pBluescript II.SK digested with XbaI. Ligation mixes were electroporated into E. coli XL1, and transformants were selected for chloramphenicol resistance. Plasmids containing the disrupted copy of disA were sequenced using primers that read outward from each end of mini-Tn5Cm.

Construction of a disA null allele in P. mirabilis.

Construction of a disA mutation in P. mirabilis PM7002 and P. mirabilis PM437 speA::mini-Tn5 lacZ was accomplished by homologous recombination between the P. mirabilis chromosome and a small internal segment of disA present in the suicide vector pKNG101 (17). PCR was used to amplify a 391-bp internal segment of the disA gene by use of the primers 5′-GCTCTAGAGCATTGGCGTGTTAGGCTCATC-3′ and 5′CGGGATCCCGCCTCTTCTGG GCACAGTTTTG-3′. The PCR product was cloned into XbaI/BamHI-digested pKNG101 by using the restriction sites present within the primers. The resulting plasmid, pKG101.disA, was maintained in E. coli SM10 λpir. P. mirabilis PM7002 was mated with E. coli SM10/pKNG101.disA as described above, and exconjugants were selected on tetracycline (15 μg/ml) and streptomycin (35 μg/ml). The insertion of pKNG101 into the disA gene was confirmed by Southern analysis.

Construction of a plasmid overexpressing disA.

A 2,164-bp fragment encompassing the disA open reading frame was PCR amplified using the primers 5′-GCTCTAGAGCGAACGAACTTGGAAAATCTTATCTG-3′ and 5′-CGGAATTCCGTCTCGAGCTTGATTTTATGTGC-3′, which contain XbaI and EcoRI restriction sites. The digested PCR product was ligated into XbaI- and EcoRI-digested pBluescript II SK or pBC.SK (Stratagene).

Analysis of swarmer cell migration and differentiation.

Cells were grown at room temperature overnight without shaking in 2 ml LB with antibiotic as needed and diluted to an optical density (A600) of 0.3. Swarming assays were carried out on LB agar (1.5%) containing the appropriate antibiotics. Migration distance measurements were made for strains spotted in five locations each on a 243- by 243- by 18-mm square plate (Nunc). Swarm diameter was measured and recorded at 30-min intervals. Differentiation was analyzed microscopically from scrapings of the outer edge of spots plated in a manner similar to that used for the migration assay.

Northern blot analysis.

Transcription of flhDC, fliA, flgM, and flaA throughout the swarmer cell differentiation cycle was assessed by Northern blot analysis of total RNA. RNA was extracted using a MasterPure RNA purification kit (Epicenter, Madison WI) following the standard protocol with the addition of a 20-min DNase treatment. Formamide/formaldehyde-denatured RNA was resolved by electrophoresis through a 1.2% agarose formaldehyde gel and transferred onto nitrocellulose membranes by capillary transfer. Blots were probed with digoxigenin-labeled PCR products using the following primers for the indicated genes: for flaA, 5′-TATCTGGGGTGCCGATAAAC-3′ and 5′-ACGGTTTTGAATCGCACCTA-3′; for flhDC, 5′-TCGGACGGGATGTAAAGAGA-3′ and 5′-CAGGATTGGCGGAAAGTTTA-3′; for fliA, 5′-TAGCCTCTGGGAGCGATATG-3′ and 5′-GCACTGCGCCTATTTCTTTC-3′; and for flgM, 5′-GTATTGAACGCACAAATCCACTT-3′ and 5′-CAATTTTGCTGCTGCTCATTGTT-3′.

Construction of an FlhC-His6 fusion protein.

An FlhC protein tagged with His6 at the carboxy terminus was generated by PCR using the primers 5′-CGATCGTCTAGAAAGGTATGCTACCTTTTTCAAC-3′ and 5′-ACATGTCGACTCAATGATGATGATGATGATGCATTGCAAACTGTTCAAGACC-3′. This generated a PCR product containing the C-terminal two-thirds of the FlhC protein tagged with His6 at the C terminus. This product was cloned via SalI and XbaI sites engineered into the primers into the suicide plasmid pKNG101 (17). This plasmid was introduced into P. mirabilis by conjugation with E. coli SM10 containing this plasmid. Transformants that arose due to a single homologous recombination event were verified by Southern blot analysis for correct insertion into the flhC gene. This created a single-copy flhC-his6 in the native location of the chromosome. A strain containing the corresponding FlhC-His6 hybrid protein exhibited a slight decrease in swarming motility. In a wild-type PM7002 background, we were unable to detect FlhC-His6 by Western blot analysis. Therefore, we integrated the plasmid into a strain that contained a regulatory mutation that increased flhDC expression at least 50-fold. This mutation will be described elsewhere. The FlhC-His6 protein was readily observed in this strain by Western blot analysis, and it was used for further analysis.

Western blot analysis of FlhC-His6.

FlhC protein levels were assessed in P. mirabilis SS-P FlhC-His6 strains containing either pBC or pBC.DisA by use of Western blot analysis. Cells were grown overnight with shaking in LB with chloramphenicol (100 μg/ml) and streptomycin (35 μg/ml) at 37°C and then diluted to an OD600 of 1.3. The cell suspensions (250 μl) were spread onto dry LB plates with chloramphenicol (100 μg/ml) to generate synchronously differentiating cell populations. Cells were harvested at 4 h after plating by resuspension in cold LB. For Western blot analysis, bacterial pellets were lysed in Laemmli sample buffer, heated at 95°C for 10 min and subjected to SDS-polyacrylamide gel electrophoresis on 15% Tris-HCl gels. Proteins were electroblotted to nitrocellulose, probed at 1:2,500 with a tetra-His antibody (QIAGEN), and subsequently incubated with a horseradish peroxidase-conjugated anti-mouse antibody (Amersham Biosciences) at 1:10,000. Detection was carried out using ECL Western blotting detection reagents in accordance with standard procedures (Amersham Biosciences).

RESULTS

Identification of extragenic mutations that restore swarming motility to speA mutants.

A swarming-deficient mutant (PM437 speA::mini-Tn5 lacZ1) has been described previously (27). The swarming deficiency was caused by a decrease in putrescine production resulting from the loss of speA, encoding arginine decarboxylase. Mutagenesis of PM437 speA::mini-Tn5 lacZ1 by a second mini-Tn5Cm element was carried out in order to identify extragenic suppressor mutations that restored swarming motility. Two suppressors contained mini-Tn5 lacZ1 insertions in the rcsC gene, encoding a sensor kinase. This gene was previously identified as a negative regulator of swarmer cell differentiation (5). The second gene identified contained an open reading frame of unknown function and will be reported elsewhere. The final insertion was within a large open reading frame encoding a protein of 611 amino acids with extensive similarity to amino acid decarboxylases. The insertion point disrupted this gene at a position that encoded amino acid 101. Of gene products with known function, this protein exhibited the highest similarity to a tyrosine decarboxylase from Carnobacterium divergens (30% identity and 50% similarity), and a phenylalanine decarboxylase from Enterococcus faecium (28% identity and 49% similarity). A highly conserved pyridoxyl-dependent domain extended from amino acids 253 to 413, placing it in the family of class II decarboxylases. Based on the above-described sequence similarity, this mutation was designated disA (decarboxylase inhibitor of swarming), and the strain containing this mutation was designated LS1 speA::mini-Tn5 lacZ1 disA1::mini-Tn5Cm. The disA gene appeared to be monocistronic, and there were no other open reading frames within 355 bp of disA.

LS1 displayed a swarming phenotype that was enhanced relative to that of the PM437 parent but remained less efficient than that of wild-type PM7002 (Fig. 1). Specifically, initiation of swarming began earlier in LS1, and the migration distance for each swarm cycle was larger than for PM437. Additionally, LS1 exited the first consolidation phase approximately 8 h after plating. In contrast, PM437 had not yet exited the first consolidation phase at the 9.5 h time point (Fig. 1). To confirm that the mini-Tn5Cm insertion in disA was responsible for the above-described phenotypes, a disA null allele was recreated in PM437 speA::mini-Tn5 lacZ1 by a Campbell-type insertion of the suicide vector pKNG101 within the center of the disA coding region. This resulted in strain LS2 speA::mini-Tn5 lacZ1 disA2::Smr. The swarming phenotype of the disA2::Smr allele in strain LS2 was identical to that of the disA1::mini-Tn5Cm insertion in strain LS1, which was identified in the initial screen (data not shown).

FIG. 1.

FIG. 1.

The disA mutation enhances swarming. Overnight cultures of PM437 speA::mini-Tn5 lacZ1, LS1 speA::mini-Tn5 lacZ1 disA1::mini-Tn5Cm, wild-type PM7002, and LS10 disA3::mini-Tn5 lacZ1 were grown overnight in LB with shaking at 37°C and adjusted to the same optical density, and 5-μl aliquots were spotted on an LB plate. The values shown represent the averages of the swarming diameters for three individual spots of each strain measured at 30-min intervals, with the standard deviations shown as error bars. The disA mutant and the corresponding parental strain were always assayed on the same plate.

In a separate search for transposon insertions that enhanced the swarming of wild-type PM7002, an independent insertion was isolated in the disA gene, where it disrupted the gene at a position corresponding to amino acid 456. This strain was designated LS10 disA3::mini-Tn5 lacZ1. The enhancement of the swarming phenotype of LS10 compared to that of wild-type PM7002 is shown in Fig. 1. LS10 initiated swarming earlier than wild-type PM7002 and migrated a distance 30 to 35% greater in each swarming cycle (Fig. 1). To further confirm the role of disA in the wild-type PM7002 background, the disA2::Smr mutation was created by the insertion of pKN101 into the coding region, resulting in strain LS3 disA2::Smr. The disA2::Smr mutation enhanced the swarming in a wild-type background in a manner similar to that of the disA3::mini-Tn5Cm allele (data not shown). For all strains containing the disA2 or disA3 alleles, there were no obvious differences in swarmer cell morphology according to microscopic examination (data not shown). In addition to the increased swarming motility, the disA mutation increased swimming motility in 0.3% agar, with a zone size of 31 ± 1 cm for wild-type PM7002 and 43 ± 2 cm for LS10 disA3::mini-Tn5 lacZ1 after 12 h of growth at 28°C.

disA in multiple copies blocks swarming motility.

To demonstrate that the loss of disA was responsible for the above-described swarming phenotype, a region containing only the disA open reading frame and ribosome binding site was generated by PCR and cloned into pBluescript II.SK (pSK.DisA). Swarming motility in wild-type PM7002 and in PM437 speA::mini-Tn5 lacZ with either pSK.DisA or vector alone was monitored. The presence of pSK.DisA abolished swarming motility in both PM7002 wild-type and PM437 speA::mini-Tn5 lacZ1 backgrounds (Fig. 2). The defect in swarming motility was not due to a decrease in cell growth, as the growth rates in liquid LB were similar in strains with either pSK or pSK.DisA (data not shown). A complete inhibition of swarming was also observed when the disA gene was cloned in a lower-copy-number plasmid, pACYC184 (data not shown). The overexpression of DisA also completely inhibited swimming migration in 0.3% soft agar, indicating that it acted as a general inhibitor of motility (data not shown).

FIG. 2.

FIG. 2.

Swarming phenotypes of cells overexpressing DisA. Overnight cultures of PM437/pSK, PM437/pSK.DisA, PM7002/pSK, and PM7002/pSK.DisA were grown to a low optical density in LB containing ampicillin at 150 μg/ml. These cultures were diluted to an OD600 of 0.4 in fresh LB. Three microliters of each culture of PM437/pSK, PM437/pSK.DisA, PM7002/pSK, and PM7002/pSK.DisA were spotted onto a dry LB-plus-ampicillin plate and incubated at 37°C for 12 h.

To examine the basis for the swarming defect, wild-type PM7002/pSK.DisA and PM7002/pSK (vector) were analyzed microscopically for the ability to differentiate into swarmer cells. While the vector-only strain began differentiation at 3 h after plating, the DisA-overexpressing strain did not differentiate for the 10-h period of the experiment.

Putrescine production is not altered in disA mutants or DisA-overexpressing strains.

The disA mutation was isolated in PM437 speA::mini-Tn5 lacZ1 as a second site suppressor that restored swarming motility. Putrescine production via SpeA/SpeB is required for normal swarmer cell differentiation. However, a speA or speB mutant is still capable of low-level swarming, which is likely due to residual putrescine production via the SpeC-dependent pathway (27). Therefore, we examined whether the stimulation of swarming by the loss of disA or the block in swarming by DisA overexpression was mediated by altered levels of putrescine that were potentially made from the SpeC-dependent alternative pathway (27). The P. mirabilis speA::lacZ fusion is repressed by putrescine and can be used to monitor the levels of extracellular putrescine (27). Conditioned medium was collected from P. mirabilis PM437 speA::mini-Tn5 lacZ1, as well as P. mirabilis LS1 speA::mini-Tn5 lacZ1/disA1::mini-Tn5Cm double mutant, at a density near that of mid-log phase as well as the beginning of stationary phase and assayed using the speA::lacZ fusion. Nearly identical levels of speA::lacZ repression were observed with conditioned medium from either PM437 or LS1 (Fig. 3A). This suggested that extracellular putrescine levels were similar in both strains.

FIG. 3.

FIG. 3.

Effect of disA mutant and overexpressing strains on extracellular putrescine levels. (A) The expression of β-galactosidase from PM437 speA::mini-Tn5 lacZ1 in conditioned medium from either PM437, LS1 speA::mini-Tn5 lacZ1 disA1::mini-Tn5Cm, or wild-type PM7002 is shown. (B) Conditioned media were prepared from wild-type PM7002 and PM437 speA::mini-Tn5 lacZ1 with pSK or pSK.DisA and tested for the ability to repress the speA::lacZ fusion. For all experiments, conditioned media were collected from cells at an OD600 of 1.0. The indicator strain, PM437 speA::mini-Tn5 lacZ1, was grown in the conditioned medium to an OD600 of 0.35 and assayed for β-galactosidase using SDS-chloroform-treated cells. The values represent the averages of duplicate samples from two independent experiments.

Next, we tested whether the overexpression of disA altered the levels of extracellular putrescine. Conditioned media from P. mirabilis PM7002 and P. mirabilis PM437, harboring either a vector control or pSK.DisA, were assayed with the speA::lacZ fusion strain as an indicator. Again, the levels of speA::lacZ repression were similar in conditioned media from cells containing either vector pSK or pSK.DisA (Fig. 3B). In addition, strains overexpressing disA were still able to extracellularly complement the swarming deficiency of PM437, suggesting that the levels of putrescine were not significantly altered (data not shown). This experiment also ruled out the possibility that DisA overexpression resulted in the production of an extracellular inhibitor of swarming. The possibility remained that putrescine was overproduced in the DisA mutant strain but unable to be released from the cell. If putrescine were trapped in the cell, the speA::lacZ fusion should be more repressed in the speA disA mutant than in the strain with the speA mutation alone. However, speA::lacZ fusion activity levels in PM437 and LS1 disA::mini-Tn5Cm were similar at all cell densities throughout growth (data not shown).

Loss of disA increases expression of genes in the flagellar regulon.

In enteric bacteria, the FlhD2C2 master regulator activates class 2 genes in response to external stimuli (7). In turn, the class 2 gene fliA, encoding σ28F), directs RNA polymerase to transcribe class 3 genes, including the flagellin structural gene (flaA) in P. mirabilis. To investigate the mechanism for the increased swarming in the disA mutant background, the expressions of representative class 1 (flhDC), class 2 (fliA, flgM), and class 3 (flaA) genes were examined by Northern blot analysis in wild-type PM7002 and in LS10 disA::mini-Tn5 lacZ (Fig. 4). Since the loss of disA acted to increase swarming in both speA mutant and wild-type backgrounds, it appears to act in a general manner to increase swarming. Based on this observation, the effects of disA in a wild-type background were examined.

FIG. 4.

FIG. 4.

Effect of the disA mutation on expression of genes in the flagellar regulon. Overnight cultures of PM7002 and LS10 disA::mini-Tn5 lacZ1 were adjusted to the same optical density, and 200-μl aliquots were spread on LB agar plates to generate synchronously differentiating cultures. Cells were harvested off of the plates at hourly intervals. RNA was prepared and used for Northern blot analysis with PCR-generated probes corresponding to the flhDC, fliA, flgM, and flaA genes (see Materials and Methods).

The loss of disA resulted in a slight increase in the class 1 flhDC mRNA accumulation at times T3 and T4. This slight difference was more accurately quantitated by measuring the expression of β-galactosidase from a single-copy flhDC-lacZ fusion in wild-type and disA::Smr backgrounds. At T3, the expression of β-galactosidase from flhDC-lacZ was measured at 80.2 ± 1.4 units in the wild-type background and at 120 ± 1.4 units in the disA::Smr background. At T4, the expression of β-galactosidase from flhDC-lacZ was measured at 40.3 ± 1.4 units in the wild-type background and at 59.5 ± 1.5 units in the disA::Smr background. Therefore, at T3 and T4, the expression levels of β-galactosidase from flhDC-lacZ were 1.5- and 1.4-fold higher, respectively, in the disA::Smr background.

In contrast, the effects of the disA mutation on two class 2 genes, fliA and flgM, were significantly more pronounced beginning at T2 and continuing into T6 (Fig. 4). For the class 3 flaA gene, encoding flagellin, the disA mutation also resulted in a large increase in mRNA accumulation. To more accurately quantitate this increase, twofold serial dilutions of the disA samples at time points T4 to T6 were compared to the undiluted wild-type sample and examined by Northern blot analysis. This comparison indicated that the disA mutation increased flaA mRNA accumulation 16-fold at T4 and at least 32-fold at T5 and T6.

DisA overexpression blocks expression of class 2 and class 3 genes in the flagellar regulon.

The overexpression of disA on a high-copy-number plasmid was shown to completely inhibit swarmer cell differentiation (Fig. 2). To determine whether this inhibition was mediated via the flagellar regulon, the expression of flhDC, fliA, and flaA was examined by Northern blot analysis with wild-type PM7002 containing the vector control pBluescript.SK and in PM7002/pSK.DisA. DisA overexpression did not significantly decrease flhDC mRNA accumulation at any point during the swarming cycle (Fig. 5). However, for fliA (class 2) and flaA (class 3), the overexpression of disA completely inhibited expression based on mRNA accumulation (Fig. 5).

FIG. 5.

FIG. 5.

Effect of DisA overexpression on the flagellar regulon. Strains PM7002/pSK and PM7002/pSK.DisA were spread on LB agar plates containing ampicillin, and cells were harvested at hourly intervals. RNA was prepared and probed with PCR-generated fragments corresponding to flhDC, fliA, and flaA. For all blots, the same preparation of RNA was used, allowing for a direct comparison of different transcripts during the swarming cycle. The bottom panel shows an ethidium bromide-stained gel containing the same amount of RNA used in each Northern blot.

DisA overexpression does not alter the levels of FlhC protein.

FlhC is the DNA binding subunit of the FlhD2C2 complex (9, 25). To determine if DisA overexpression blocked swarming and expression of class 2 and class 3 genes in the flagellar cascade by decreasing the amount of intracellular FlhC, the accumulation of FlhC-His6 was determined by Western blot analysis using an anti-His antibody (Fig. 6). For these experiments, a single-copy flhC-his6 gene was constructed at the native flhC locus by integration of a suicide plasmid containing the C-terminal two-thirds of the flhC gene, along with the His6 tag at the C terminus. In a wild-type PM7002 background, we were unable to detect FlhC-His6 by Western blot analysis (Fig. 6, lane 4). Therefore, we integrated the plasmid into the chromosome of a strain (SS-P) containing a mini-Tn5 insertion 325 bp upstream of the flhDC transcriptional start site that increased flhDC expression at least 20-fold. A more detailed description of this mutant will be reported elsewhere. In this strain, FlhC-His6 was readily detected by Western blot analysis (Fig. 6). Although flhDC was overexpressed in this strain, the presence of pBC.DisA was still able to completely block expression of fliA and swarming motility (data not shown). In synchronously differentiating cells at T4, the accumulation of FlhC-His6 was not altered in cells overexpressing DisA (pBC.DisA) (Fig. 6, lane 3) relative to the accumulation in cells with the pBC vector control and normal DisA expression (Fig. 6, lane 2). A similar result was observed for cells harvested at T5 (data not shown).

FIG. 6.

FIG. 6.

DisA overexpression does not alter the levels of FlhC protein. Strain SS-P expresses an FlhC-His6 fusion protein from a single copy at the native flhDC locus (see Materials and Methods). Synchronously differentiating cells of SS-P/pBC.SK and SS-P/pBC.DisA were harvested at T4, and total cell protein was separated on 15% SDS-polyacrylamide gel electrophoresis gels. Western blot analysis was carried out as described in the Materials and Methods using a penta-His antibody (QIAGEN). Lanes: 1, affinity-purified FlhC-His6 protein; 2, SS-P FlhC-His6/pBC.SK; 3, SS-P FlhC-His6/pBC.DisA; 4, PM7002 wild-type FlhC-His6.

Inhibition of swarming by DisA overexpression does not depend on the Lon protease.

The Lon protease has been implicated in turnover of the P. mirabilis FlhD and FlhC proteins (8). In the course of isolating mini-Tn5 lacZ1 insertions that increase swarming, we identified an insertion in the middle of the P. mirabilis lon gene. In addition, this lon::mini-Tn5 lacZ1 insertion was in the correct orientation to create a transcriptional lon-lacZ fusion. A detailed characterization of this mutant will be reported elsewhere, but the availability of this mutant allowed us to test if the Lon protease was involved in or required for the DisA-mediated inhibition of swarming. For example, the overexpression of DisA could stimulate Lon expression or activity, leading to enhanced degradation of FlhD/C.

The expression of the lon::lacZ fusion in P. mirabilis was not significantly altered by DisA overexpression at various time points during swarming. At T2, β-galactosidase expression from the lon-lacZ fusion was 559 ± 62 units in cells with the vector pBC and 715 ± 240 units in cells with pBC.DisA. At T4, β-galactosidase expression from the lon-lacZ fusion was 681 ± 67 units in cells with the vector pBC and 742 ± 109 units in cells with pBC.DisA. At T6, β-galactosidase expression from the lon-lacZ fusion was 651 ± 75 units in cells with the vector pBC and 660 ± 41 units in cells with pBC.DisA.

Swarming motility of the P. mirabilis lon mutant was completely blocked when DisA was overexpressed (data not shown). Therefore, the ability of DisA overexpression to inhibit swarming appears to be independent of the Lon protease.

Phenethylamine inhibits swarming and decreases expression of class 2 and class 3 genes.

The similarity of DisA to amino acid decarboxylases suggested two possible mechanisms for the inhibition of swarming and the decreased expression of class 2 and class 3 genes in the flagellar cascade upon DisA overexpression. The first possibility is that the overexpression of DisA depleted one or more amino acids that were required for expression of class 2 and class 3 genes. If this were the case, then supplementation of agar with high concentrations of amino acids may increase the intracellular concentration and increase swarming in a DisA-overexpressing strain. However, when all 20 amino acids were tested at concentrations up to 100 mM, there was no rescue of swarming, even when DisA was present on a medium-copy-number plasmid, pACYC184. The second possibility was that the inhibition of swarming in the DisA-overexpressing strain was due to increased intracellular concentrations of the DisA product, i.e., a decarboxylated amino acid. Commercially available decarboxylated amino acids were incorporated into agar plates at concentrations ranging from 0.5 to 30 mM, and the ability of each compound to mimic DisA overexpression and inhibit swarming was assessed. The decarboxylated amino acids tested were as follows (with the parent amino acids in parentheses for reference): tyramine (tyrosine), phenethylamine (phenylalanine), histamine (histidine), gamma-amino butyric acid (glutamic acid), agmatine (arginine), and cadaverine (lysine). The only decarboxylated amino acids that were able to inhibit swarming were tryamine and phenethylamine. For tyramine, a very high concentration (40 mM) was required for a complete inhibition of swarming, and examination of the levels of class 1 (flhDC), class 2 (fliA), and class 3 (flaA) genes by Northern blot analysis indicated that tyramine had no effect on the expression of these genes (data not shown). Therefore, the effect of tyramine on swarming was likely indirect and not mediated by altering flagellar gene expression. In contrast, 1 mM phenethylamine resulted in a 50% inhibition of swarming, and 4 mM phenethylamine completely inhibited swarming (Fig. 7A).

FIG. 7.

FIG. 7.

Effect of phenethylamine on swarming motility and expression of genes in the flagellar regulon. (A) Phenethylamine was added to 2× LB broth to give concentrations of 1 mM, 2 mM, 4 mM, and 8 mM. Solutions were adjusted to pH 7.0 and sterilized through a 0.22-μm syringe filter. The LB-phenethylamine solution was added in a 1:1 ratio to a sterile 2× agar solution (3%) prior to the plates being poured, resulting in phenethylamine concentrations of 0.5 mM, 1 mM, 2 mM, and 4 mM and a final agar concentration of 1.5%. A culture of P. mirabilis PM7002 was grown to an OD600 of 0.5, and 3 μl was spotted onto dried plates with either LB or LB containing phenethylamine. Plates were incubated for 12 h at 37°C. The swarm front is indicated by an arrowhead. (B) For mRNA analysis of flagellar genes, synchronously differentiating cells of PM7002 were grown on LB or LB containing 4 mM phenethylamine, and cells were harvested at T3. Northern blot analyses of flhDC (class 1), fliA (class 2), and flaA (class 3) genes were done using PCR-generated probes.

Phenethylamine could also act as a potent inhibitor of class 2 and class 3 gene expression while having a minimal effect on the expression of the class 1 flhDC operon (Fig. 7B). Therefore, exogenous phenethylamine mimicked the effects of DisA overexpression.

Expression of disA during the swarming cycle.

We initially attempted to monitor disA expression by Northern blot analysis, but we were unable to detect disA mRNA by this method. Therefore, the expression of disA was examined in strain LS10 containing a single-copy disA::lacZ fusion that was isolated by the insertion of mini-Tn5 lacZ1. Synchronously differentiating cells were harvested off of LB agar plates at hourly intervals and assayed for β-galactosidase activity. The expression of disA::lacZ increased threefold at approximately 3 hours after plating (Fig. 8). At time point T3, swarmer cells were present.

FIG. 8.

FIG. 8.

Expression of disA during swarming. An overnight culture of P. mirabilis LS10 disA::mini-Tn5 lacZ1 was spread onto the surface of agar plates to generate synchronously differentiating cells. At hourly intervals, cells were harvested off of plates, and the expression of the disA::lacZ fusion was monitored by β-galactosidase activity (Miller units [MU]). The reported values represent one experiment. In repeated experiments (n = 3), similar induction values were observed each time.

DISCUSSION

In this study, the disA gene product was identified as an extragenic suppressor that enhanced the swarming motility of a speA mutant. The disA gene was also identified in a search for mutations that increased swarming in a wild-type background. Therefore, DisA acts in a general pathway that negatively regulates swarmer cell differentiation. Strains containing a null allele in disA swarm earlier and more efficiently than the wild type, and this correlated with a 16- to 32-fold increase in flaA (flagellin) mRNA levels during swarmer cell differentiation (Fig. 4). In contrast, cells overexpressing DisA exhibited a complete block in swarming motility, failed to differentiate, and did not express any detectable flaA mRNA (Fig. 5). To determine where in the flagellar regulon DisA acted to inhibit flagellin expression, the effects of a disA mutation and DisA overexpression on class 1 and class 2 genes in the flagellar cascade were examined. For the class 1 flhDC operon, encoding the master activator of class 2 genes, the levels of expression were slightly increased (1.4-fold) in the disA mutant but largely unaffected by DisA overexpression (Fig. 4 and 5). For the class 2 fliA gene (encoding σ28) and the class 3 gene (flaA), a disA mutation increased mRNA accumulation at least 10-fold during swarmer cell differentiation, and DisA overexpression completely blocked both fliA and flaA mRNA accumulation (Fig. 5). Although modest increases in flhDC expression can result in amplified increases in class 2/class 3 gene expression (2), it is still difficult to reconcile a 1.4-fold increase in flhDC expression with the drastic increase in class 2/class 3 gene expression. In addition, in class 2 flhA mutants, where flagellin export is blocked, there are 10-fold-lower levels of flhDC mRNA (13). This indicates the presence of a feedback mechanism to positively influence flhDC mRNA levels. In disA mutant cells, the higher levels of class 2 and class 3 gene expression may contribute to the slight increase in flhDC mRNA by this unidentified feedback mechanism.

A recent study detailing a microarray analysis of pH-regulated genes in E. coli revealed that genes involved in flagellar synthesis and motility were repressed at high pH (20). However, the flhD and flhC genes were not repressed by high pH in this study. The target of this pH-mediated decrease in motility is unknown. By analogy to this study, the activity of DisA as a decarboxylase has the potential to increase the external or internal pH by the production of a basic amine, if the primary substrate for DisA is an amino acid with a basic side chain. However, the pH values for cultures in mid-log phase and stationary phase at identical optical densities were the same for wild-type and disA mutant strains (data not shown). In addition, when cells with pSK.DisA and those containing only pSK vector were grown to the same density, the pH values for the media were the same. This suggests that external pH changes are not responsible for altered swarming. Furthermore, the addition of acetate, a permeant acid, to plates did not restore swarming to disA-overexpressing strains when used at a variety of concentrations.

How does DisA act to inhibit swarming? First, based on the results shown in Fig. 3, it is unlikely that DisA acts by inhibiting the putrescine-dependent pathway for swarmer cell differentiation (Fig. 3) (27). This is further supported by the fact that, in contrast to disA mutants, flagellin expression is not altered in putrescine-defective speB mutants (unpublished results). Therefore, based on the similarity of DisA to amino acid decarboxylases, two possibilities may be considered: the substrate of DisA acts as a positive effector of swarming by increasing the expression of class 2 and class 3 genes in the flagellar cascade, or the product of the DisA reaction, possibly a decarboxylated amino acid, is an inhibitor of class 2/class 3 gene expression and swarming. Taking the first possibility into account, in a disA mutant, the amino acid substrate would accumulate and activate class 2 gene expression. In DisA-overexpressing strains, the substrate would be depleted and reduce expression of class 2/class 3 genes. However, we were unable to demonstrate that amino acids at concentrations up to 100 mM could restore swarming to a strain overexpressing DisA (data not shown). With respect to the second possibility, since DisA exhibited similarity to amino acid decarboxylases, we tested a panel of commercially available decarboxylated amino acids for effects that mimicked DisA overexpression. Only phenethylamine, the product of phenylalanine decarboxylation, could reduce expression of class 2/class 3 genes (fliA and flaA) and inhibit swarming (Fig. 7). The effect of phenethylamine on decreasing the accumulation of mRNA corresponding to fliA and flaA was not as strong as that when DisA was overexpressed. There are two possible explanations for this: (i) the levels of DisA expression are very high when present on a plasmid, leading to artificially high intracellular concentrations of phenethylamine (or another decarboxylated product) and the uptake of exogenous phenethylamine in wild-type cells is not sufficiently high to reach the same intracellular concentration, or (ii) phenethylamine may not be the true product of the DisA reaction, but is similar enough to exert a strong but incomplete inhibition of class 2/class 3 gene expression. However, the ability of phenethylamine to mimic DisA overexpression is intriguing, since DisA is most homologous to tyrosine and phenylalanine decarboxylases.

Since DisA acts downstream of flhDC mRNA accumulation but upstream of fliA transcription, the most likely target(s) of the DisA inhibition is the FlhD and/or FlhC protein. We hypothesize that the decarboxylated product of the DisA reaction (possibly phenethylamine) acts either by inhibiting the interaction or assembly required for FlhD2C2 heterotetramer formation or by inhibiting the DNA binding ability of the FlhD2C2 heterotetramer (Fig. 9). With respect to the first possibility, a recent study has demonstrated that the DnaK chaperone is required for the formation of active FlhD2C2 complexes in Salmonella (28). If a similar requirement for DnaK exists in P. mirabilis, the DisA decarboxylation product may block the formation of functional FlhD2C2 complexes by interfering with DnaK function. It should be noted that all of the possibilities in this model are highly speculative, and, to our knowledge, there are no examples of small molecules that regulate FlhD2C2 stability or interaction with DNA.

FIG. 9.

FIG. 9.

Possible mechanisms for the DisA-mediated inhibition of class 2 and class 3 gene expression in the flagellar regulon. A model for the posttranscriptional regulation of FlhD/FlhC activity is presented. The DisA product is hypothesized to inhibit FlhD2C2 heterotetramer formation, possibly via DnaK. Alternatively, DisA may inhibit the ability of FlhD2C2 to bind DNA.

Although a role for DisA in decreasing the stability of FlhC has been ruled out by the results presented in Fig. 6, it remains a formal possibility that FlhD stability is altered by DisA. The effects of DisA overexpression on swarming appear to be independent of the Lon protease. However, in Salmonella, the ClpXP protease is also involved in FlhDC turnover (29). Based on this information, the DisA decarboxylation product may stimulate the ClpXP-dependent proteolysis of FlhD, and experiments to examine this possibility are in progress.

What is the physiological role of DisA in P. mirabilis? Expression of a chromosomal disA::lacZ fusion is activated at T3, a time point when swarmer cells begin to be present. The activation of DisA at this time point may seem counterproductive, since DisA acts as a negative regulator of flagellin expression and swarmer cell differentiation. However, swarmer cell differentiation is a transient process, and this state is maintained for only 1 to 2 h before cells dedifferentiate back to vegetative cells. At T3, when DisA expression is maximal, the process of differentiation has already begun and the levels of flagellin expression have already increased 20- to 30-fold above the levels in vegetative cells. In addition, the FlhDC-dependent genes that are likely required for swarmer cell differentiation have already been activated. Therefore, the program of gene expression required for differentiation is well under way at T3 when DisA becomes activated. The increased expression of DisA may serve as a mechanism to dampen expression of flagellin and genes required for swarmer cell differentiation, possibly to prepare cells for dedifferentiation. DisA may not be the only mechanism that decreases class 2/class 3 gene expression at this time, and additional components may have a role as cells prepare to dedifferentiate. It is important to note that the complete block in class 2/class 3 gene expression in cells containing pSK.DisA (Fig. 5) is likely due to the extremely high levels of DisA expression that occur when disA is on a high-copy-number plasmid. In summary, DisA may not be the only gene product involved in the down-regulation of class 2/class 3 genes as swarmer cells prepare to dedifferentiate back to vegetative cells, but the effects of the disA mutation support an important role in this process.

Acknowledgments

This work was supported by a Merit Review award from the Department of Veterans Affairs. P.N.R. is the recipient of a Research Career Development Award from the Department of Veterans Affairs.

We are grateful to Katy Clemmer for conducting some of the β-galactosidase assays used in this study.

Footnotes

Published ahead of print on 15 September 2006.

REFERENCES

  • 1.Alavi, M., and R. Belas. 2001. Surface sensing, swarmer cell differentiation and biofilm development. Methods Enzymol. 336:29-40. [DOI] [PubMed] [Google Scholar]
  • 2.Barker, C. S., B. M. Pruss, and P. Matsumura. 2004. Increased motility of Escherichia coli by insertion sequence element integration into the regulatory region of the flhD operon. J. Bacteriol. 186:7529-7537. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Belas, R. 1994. Expression of multiple flagellin-encoding genes of Proteus mirabilis. J. Bacteriol. 176:7169-7181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Belas, R., M. Goldman, and K. Ashliman. 1995. Genetic analysis of Proteus mirabilis mutants defective in swarmer cell elongation. J. Bacteriol. 177:823-828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Belas, R., R. Schneider, and M. Melch. 1998. Characterization of Proteus mirabilis precocious swarming mutants: identification of rsbA, encoding a regulator of swarming behavior. J. Bacteriol. 180:6126-6139. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Belas, R., and R. Suvanasuthi. 2005. The ability of Proteus mirabilis to sense surfaces and regulate virulence gene expression involves FliL, a flagellar basal body protein. J. Bacteriol. 187:6789-6803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Chilcott, G. S., and K. T. Hughes. 2000. Coupling of flagellar gene expression to flagellar assembly in Salmonella enterica serovar Typhimurium and Escherichia coli. Microbiol. Mol. Biol. Rev. 64:694-708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Claret, L., and C. Hughes. 2000. Rapid turnover of FlhD and FlhC, the flagellar regulon transcriptional activator proteins, during Proteus swarming. J. Bacteriol. 182:833-836. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Claret, L., and C. Hughes. 2000. Functions of the subunits of the FlhD2C2 transcriptional master regulator of bacterial flagellum biogenesis and swarming. J. Mol. Biol. 303:467-478. [DOI] [PubMed] [Google Scholar]
  • 10.De Lorenzo, V., M. Herrero, U. Jakubzik, and K. N. Timmis. 1990. Mini-Tn5 transposon derivatives for insertion mutagenesis, promoter probing, and chromosomal insertion of cloned DNA in gram-negative eubacteria. J. Bacteriol. 172:6568-6572. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dufour, A., R. B. Furness, and C. Hughes. 1998. Novel genes that upregulate the Proteus mirabilis flhDC master operon controlling flagellar biogenesis and swarming. Mol. Microbiol. 29:741-751. [DOI] [PubMed] [Google Scholar]
  • 12.Fraser, G. M., and C. Hughes. 1999. Swarming motility. Curr. Opin. Microbiol. 2:630-635. [DOI] [PubMed] [Google Scholar]
  • 13.Furness, R. B., G. M. Fraser, N. A. Hay, and C. Hughes. 1997. Negative feedback from a Proteus class II flagellum export defect to the flhDC master operon controlling cell division and flagellum assembly. J. Bacteriol. 179:5585-5588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gygi, D., M. J. Bailey, C. Allison, and C. Hughes. 1995. Requirement for FlhA in flagella assembly and swarm-cell differentiation by Proteus mirabilis. Mol. Microbiol. 15:761-769. [DOI] [PubMed] [Google Scholar]
  • 15.Harshey, R. M. 2003. Bacterial motility on a surface: many ways to a common goal. Annu. Rev. Microbiol. 57:249-273. [DOI] [PubMed] [Google Scholar]
  • 16.Jones, B. V., R. Young, E. Mahenthiralingam, and D. J. Stickler. 2004. Ultrastructure of Proteus mirabilis swarmer cell rafts and role of swarming in catheter-associated urinary tract infection. Infect. Immun. 72:3941-3950. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Kaniga, K., I. Delor, and G. R. Cornelis. 1991. A wide host range suicide vector for improving reverse genetics in gram-negative bacteria: inactivation of the blaA gene of Yersinia enterocolitica. Gene 109:137-141. [DOI] [PubMed] [Google Scholar]
  • 18.Liaw, S. J., H. C. Lai, S. W. Ho, K. T. Luh, and W. B. Wang. 2001. Characterisation of p-nitrophenylglycerol-resistant Proteus mirabilis super-swarming mutants. J. Med. Microbiol. 50:1039-1048. [DOI] [PubMed] [Google Scholar]
  • 19.Manos, J., and R. Belas. 2004. Transcription of Proteus mirabilis flaAB. Microbiology 150:2857-2863. [DOI] [PubMed] [Google Scholar]
  • 20.Maurer, L. M., E. Yohannes, S. S. Bondurant, M. Radmacher, and J. L. Slonczewski. 2005. pH regulates genes for flagellar motility, catabolism, and oxidative stress in Escherichia coli K-12. J. Bacteriol. 187:304-319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Mobley, H. L., and R. Belas. 1995. Swarming and pathogenicity of Proteus mirabilis in the urinary tract. Trends Microbiol. 3:280-284. [DOI] [PubMed] [Google Scholar]
  • 22.Rather, P. N. 2005. Swarmer cell differentiation in Proteus mirabilis. Environ. Microbiol. 7:1065-1073. [DOI] [PubMed] [Google Scholar]
  • 23.Rauprich, O., M. Matsushita, C. J. Weijer, F. Siegert, S. E. Esipov, and J. A. Shapiro. 1996. Periodic phenomena in Proteus mirabilis swarm colony development. J. Bacteriol. 178:6525-6538. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Schneider, R., C. V. Lockatell, D. Johnson, and R. Belas. 2002. Detection and mutation of a luxS-encoded autoinducer in Proteus mirabilis. Microbiology 148:773-782. [DOI] [PubMed] [Google Scholar]
  • 25.Stafford, G. P., T. Ogi, and C. Hughes. 2005. Binding and transcriptional activation of non-flagellar genes by the Escherichia coli flagellar master regulator FlhD2C2. Microbiology 151:1779-1788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Sturgill, G. M., S. Siddiqui, X. Ding, N. D. Pecora, and P. N. Rather. 2002. Isolation of lacZ fusions to Proteus mirabilis genes regulated by intercellular signaling: potential role for the sugar phosphotransferase (Pts) system in regulation. FEMS Microbiol. Lett. 217:43-50. [DOI] [PubMed] [Google Scholar]
  • 27.Sturgill, G., and P. N. Rather. 2004. Evidence that putrescine acts as an extracellular signal required for swarming in Proteus mirabilis. Mol. Microbiol. 51:437-446. [DOI] [PubMed] [Google Scholar]
  • 28.Takaya, A., M. Matsui, T. Tomoyasu, M. Kaya, and T. Yamamoto. 2006. The DnaK chaperone machinery converts the native FlhD2C2 hetero-tetramer into a functional transcriptional regulator of flagellar regulon expression in Salmonella. Mol. Microbiol. 59:1327-1340. [DOI] [PubMed] [Google Scholar]
  • 29.Tomoyasu, T., A. Takaya, E. Isogai, and T. Yamamoto. 2003. Turnover of FlhD and FlhC, master regulator proteins for Salmonella flagellum biogenesis by the ATP-dependent ClpXP protease. Mol. Microbiol. 48:443-452. [DOI] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES