Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2003 Jul;41(7):3384–3386. doi: 10.1128/JCM.41.7.3384-3386.2003

Low-Stringency Single-Specific-Primer PCR as a Tool for Detection of Mutations in the rpoB Gene of Rifampin-Resistant Mycobacterium tuberculosis

Wania S Carvalho 1,*, Silvana Spindola de Miranda 2, Kátia M Costa 3, José GVC Araújo 3, Claudio J Augusto 4, João B Pesquero 5, Jorge L Pesquero 3, Maria A Gomes 3
PMCID: PMC165332  PMID: 12843099

Abstract

By the low-stringency single-specific-primer PCR technique, a highly sensitive and rapid method for diagnosis of rifampin resistance in Mycobacterium tuberculosis was established. Seven rifampin-resistant and five rifampin-susceptible specimens were analyzed. Rifampin resistance was determined by MIC measurement. A complex electrophoretic pattern consisting of many bands was obtained for both susceptible and rifampin-resistant isolates. The same pattern was obtained for all of the susceptible specimens, but differences between resistant and susceptible isolates were found. DNA sequencing showed that a particular mutation produces a specific electrophoretic pattern.


Tuberculosis has an extraordinary impact on the economies of developing countries since the disease generally strikes individuals in their prime working years. Resistance of Mycobacterium tuberculosis to antituberculosis drugs is a conspicuously large public health problem that has caused considerable distress in the involved community. As important as the treatment of an infectious disease is correct diagnosis of the resistance of the pathogen in the patient to be treated. Incorrect treatment may turn the patient into a source of dissemination of a resistant strain (6). Rifampin resistance is conferred by mutations in the rpoB gene, which encodes the beta subunit of RNA polymerase, an oligomeric enzyme responsible for RNA synthesis (13, 14). Resistance in approximately 95% of rifampin-resistant isolates is due to mutations in a 69-bp region of the rpoB gene, corresponding to codons 511 to 533, making this a good target for molecular genotypic diagnostic methods (11). The mechanism of resistance in the remaining 5% is still undetermined, with the exception of further mutations at codons 381 (8), 481 and 509 (5), and 505 (4) of the rpoB gene. Point mutations within the 69-bp region of the rpoB gene involving codons Ser-531, His-526, Gly-513, and Asp-516 have been shown to lead to high-level resistance in Escherichia coli and M. tuberculosis (2, 9, 10, 12, 13). Current methods for drug susceptibility testing of M. tuberculosis in primary specimens can take up to 8 weeks. The rapid detection of drug-resistant M. tuberculosis in clinical specimens by molecular techniques has been tried (4, 5, 9, 10, 11, 12, 13) and may be a rational and specific method to become popular in the future.

The low-stringency single-specific-primer PCR (LSSP-PCR) is an extremely simple technique that permits detection of single or multiple mutations in gene-sized DNA fragments (7). Two PCR steps are necessary. The first is a specific PCR (sPCR) to obtain the DNA template to be used in the second one, the LSSP-PCR, which uses low-stringency conditions and only one primer, usually one of the two primers used in the sPCR. In this study, we used the LSSP-PCR to detect mutations in the rpoB gene of M. tuberculosis isolates. We studied seven rifampin-resistant and five rifampin-susceptible M. tuberculosis isolates, of which four were from the sputum of patients in Minas Gerais, Brazil, with pulmonary tuberculosis and one was susceptible reference strain H37Rv. MIC determination (3) was performed for all of the M. tuberculosis isolates tested (0.06 to 64 μg/ml) (Table 1). The sPCR was carried out with primers RIF5 (GGCAACCGCCGCCTGCGTACG) and RIF3 (GCGGTACGGCGTTTCGATGAA). These primers were established to encompass the entire codified protein sequence (10) (GenBank accession number L05910). DNA was extracted from isolates with Trizol reagent (Life Technologies) in accordance with the protocol of the manufacturer. The reaction mixture consisted of 10 ng of purified mycobacterial DNA, 0.3 U of Taq DNA polymerase (Promega), 10 pmol of each primer, 200 μM deoxynucleoside triphosphates, 50 mM KCl, 1.5 mM MgCl2, and 0.1% Triton X-100 in 10 mM Tris-HCl buffer (pH 9.0) in a final volume of 10 μl. This reaction mixture was subjected to 30 cycles of amplification consisting of 1 min each of denaturation at 94°C, annealing at 70°C, and elongation at 72°C. Reaction products were run in a 1% agarose gel stained with ethidium bromide, and the specific 432-bp band was excised from the gel and purified with the QIAEX II gel extraction kit (Qiagen, Hilden, Germany). Primers RIF3 and RIF5 were tested in initial experiments for the LSSP step. Primer RIF3 was selected for use because it showed a major differentiation between resistance and susceptibility. The LSSP-PCR was carried out with a volume of 10 μl of 10 mM Tris-HCl (pH 9.0) containing 25 pmol of primer RIF3, 200 μM deoxynucleoside triphosphates, 1.0 U of Taq polymerase (Promega), 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton X-100, and 15 ng of template DNA obtained in the sPCR and purified from agarose gel. Amplification was achieved with 39 cycles as previously described (1). Products were analyzed by polyacrylamide gel electrophoresis and stained with silver salts (Fig. 1). The same electrophoretic pattern was observed for all susceptible isolates, but differences between rifampin-resistant and -susceptible isolates were found. Alternatively, the 432-bp fragment was cloned for sequencing. No mutation was detected in the rpoB fragment from all of the sensitive isolates, whose DNA sequence was identical to that previously published for this fragment (10). DNA sequencing of resistant isolates WSJ225, IAS131, and EFP041 confirmed mutations within the 69-bp region in codon 526 or 531 (Fig. 2 and Table 2). The electrophoretic profiles of isolates IAS131 and EFP041 were very similar, and their DNA sequences were identical. It seems that a particular mutation gives a specific electrophoretic pattern.

TABLE 1.

Rifampin MICs for the M. tuberculosis isolates used in this study

Isolate MIC (μg/ml) Phenotype
EB657 0.250 Susceptible
MO126 0.125 Susceptible
JU466a 0.125 Susceptible
LGP726 0.250 Susceptible
EFP041a >64 Resistant
AVF001 >64 Resistant
ARJ254 >64 Resistant
WSJ225 32 Resistant
IAS131a >64 Resistant
AGO247 32 Resistant
DES219 32 Resistant
a

DNA was purified from cells cultivated for 3 or 4 weeks at 37°C in Lowenstein-Jensen medium. For the other isolates, DNA was extracted from cells isolated from sputum.

FIG. 1.

FIG. 1.

Silver-stained 5% polyacrylamide gel electrophoresis showing gene signatures obtained by LSSP-PCR. Lanes: 1, H37Rv; 2, EB657; 3, MO126; 4, JU466; 5, LGP726; 6, EFP041; 7, AVF001; 8, ARJ254; 9, WSJ225; 10, IAS131; 11, AGO247; 12, DES219; M, 100-bp size standard ladder; C, negative control (without DNA).

FIG. 2.

FIG. 2.

DNA sequences of the rpoB genes from rifampin-sensitive M. tuberculosis strain H37Rv and rifampin-resistant isolates WSJ225 and EFP041. The 69-bp region of the rpoB gene, corresponding to codons 511 to 533, is underlined. For the resistant isolates, only mutated codons are presented.

TABLE 2.

Mutations observed in the 69-bp region of the rpoB gene studied

Isolate(s) Codon Mutation Amino acid change
EFP041, IAS131 526 CAC → TAC His → Tyr
WSJ225 531 TCG → TTG Ser → Leu

Taking into account that the subunits of RNA polymerase are conserved among prokaryotes (2), our results, demonstrating electrophoretic pattern differences between the DNAs of sensitive and rifampin-resistant isolates extracted directly from sputum, make LSSP-PCR a very promising tool for the diagnosis of antituberculosis drug resistance. It seems that the electrophoretic pattern, rather than band intensity, must be considered to define differences between isolates. However, attention must also be paid to band intensity since different fragments similar in electrophoretic migration may occur. The results obtained in our study must be validated with a great number of rifampin-resistant isolates.

Acknowledgments

This work was supported by FAPEMIG and FAPESP.

REFERENCES

  • 1.Gomes, M. A., E. F. Silva, A. M. Macedo, A. R. Vago, and M. N. Melo. 1997. LSSP-PCR for characterization of strains of Entamoeba histolytica isolated in Brazil. Parasitology 114:517-520. [PubMed] [Google Scholar]
  • 2.Jin, D. J., and C. A. Gross. 1988. Mapping and sequencing of mutations in the Escherichia coli rpoB gene that lead to rifampicin resistance. J. Mol. Biol. 202:45-48. [DOI] [PubMed] [Google Scholar]
  • 3.Kent, P. T., and G. P. Kubica. 1985. Public health mycobacteriology. A guide for the level III laboratory. Centers for Diseases Control, Atlanta, Ga.
  • 4.Matsiota-Bernard, P., G. Vrioni, and E. Marinis. 1998. Characterization of rpoB mutations in rifampin-resistant clinical Mycobacterium tuberculosis isolates from Greece. J. Clin. Microbiol. 36:20-23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Nash, K. A., A. Gaytan, and C. B. Inderlied. 1997. Detection of rifampin resistance in Mycobacterium tuberculosis by use of a rapid, simple, and specific RNA/RNA mismatch assay. J. Infect. Dis. 176:533-536. [DOI] [PubMed] [Google Scholar]
  • 6.Ohno, H., H. Koga, S. Kohno, T. Tashiro, and K. Hara. 1996. Relationship between rifampin MICs for and rpoB mutations of Mycobacterium tuberculosis strains isolated in Japan. Antimicrob. Agents Chemother. 40:1053-1056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Pena, S. D. J., G. Barreto, A. R. Vago, L. De Marco, F. C. Reinach, E. Dias Neto, and A. J. G. Simpson. 1994. Sequence-specific “gene signatures” can be obtained by PCR with single specific primers at low stringency. Proc. Natl. Acad. Sci. USA 91:1946-1949. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Santos, F. R., S. D. J. Pena, and J. T. Epplen. 1993. Genetic and population study of a Y-linked tetranucleotide repeat DNA polymorphism with a simple non-isotopic technique. Hum. Genet. 90:655-656. [DOI] [PubMed] [Google Scholar]
  • 9.Taniguchi, H., H. Aramaki, Y. Nikaido, Y. Mizuguchi, M. Nakamura, T. Koga, and S. Yoshida. 1996. Rifampicin resistance and mutation of the rpoB gene in Mycobacterium tuberculosis. FEMS Microbiol. Lett. 144:103-108. [DOI] [PubMed] [Google Scholar]
  • 10.Telenti, A., P. Imboden, F. Marchesi, D. Lowrie, S. Cole, M. J. Colston, L. Matter, K. Schopfer, and T. Bodmer. 1993a. Detection of rifampicin-resistance mutations in Mycobacterium tuberculosis. Lancet 341:647-650. [DOI] [PubMed] [Google Scholar]
  • 11.Telenti, A., P. Imboden, F. Marchesi, T. Schmidheini, and T. Bodmer. 1993b. Direct, automated of rifampin-resistant Mycobacterium tuberculosis by polymerase chain reaction and single-strand conformation polymorphism analysis. Antimicrob. Agents Chemother. 37:2054-2058. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Watterson, S. A., S. M. Wilson, M. D. Yates, and F. A. Drobniewski. 1998. Comparison of three molecular assays for rapid detection of rifampin resistance in Mycobacterium tuberculosis. J. Clin. Microbiol. 36:1969-1973. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Whelen, A. C., T. A. Felmlee, J. M. Hunt, D. L. Williams, G. D. Roberts, L. Stockman, and D. H. Persing. 1995. Direct genotypic detection of Mycobacterium tuberculosis rifampin resistance in clinical specimens by using single-tube heminested PCR. J. Clin. Microbiol. 33:556-561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Williams, D. L., C. Waguespack, K. Eisenach, J. T. Crawford, F. Portaels, M. Salfinger, C. M. Nolan, C. Abe, V. Sticht-Groh, and P. T. Gillis. 1994. Characterization of rifampin resistance in pathogenic mycobacteria. Antimicrob. Agents Chemother. 38:2380-2386. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES