Skip to main content
NCBI home page
The Journal of Physiology logoLink to The Journal of Physiology
. 2004 Oct 21;561(Pt 3):735–748. doi: 10.1113/jphysiol.2004.075861

Transmural expression of transient outward potassium current subunits in normal and failing canine and human hearts

Stephen Zicha 1,2, Ling Xiao 1,2, Sara Stafford 1, Tae Joon Cha 1, Wei Han 1, Andras Varro 3, Stanley Nattel 1,2
PMCID: PMC1665387  PMID: 15498806

Abstract

The transient outward current (Ito), an important contributor to transmural electrophysiological heterogeneity, is significantly remodelled in congestive heart failure (CHF). The molecular bases of transmural Ito gradients and CHF-dependent ionic remodelling are incompletely understood. To elucidate these issues, we studied mRNA and protein expression of Kv4.3 and KChIP2, the principal alpha and beta subunits believed to form Ito, in epicardial and endocardial tissues and in isolated cardiomyocytes from control dogs and dogs with CHF induced by 240 beats min−1 ventricular tachypacing. CHF decreased Ito density in both epicardium and endocardium (by 73 and 55% at +60 mV, respectively), without a significant change in relative current density (endocardium/epicardium 0.11 control, 0.17 CHF). There were transmural gradients in mRNA expression of both Kv4.3 (endocardium/epicardium ratio 0.3 under control conditions) and KChIP2 (endocardium/epicardium ratio 0.2 control), which remained in the presence of CHF (Kv4.3 endocardium/epicardium ratio 0.4; KChIP2 0.4). There were qualitatively similar protein expression gradients in human and canine cardiac tissues and isolated canine cardiomyocytes; however, the KChIP2 gradient was only detectable with a highly selective monoclonal antibody and closely approximated the Ito density gradient. Kv4.3 mRNA expression was reduced by CHF, but KChIP2 mRNA was not significantly changed. CHF decreased Kv4.3 protein expression in canine cardiac tissues and cardiomyocytes, as well as in terminally failing human heart tissue samples, but KChIP2 protein was not down-regulated in any of the corresponding sample sets. We conclude that both Kv4.3 and KChIP2 may contribute to epicardial–endocardial gradients in Ito, and that Ito down-regulation in human and canine CHF appears due primarily to changes in Kv4.3.

The Ca2+-independent voltage-gated transient outward potassium current (Ito) plays an important role in cardiac action potential repolarization and is implicated in the pathogenesis of congestive heart failure (Oudit et al. 2001). Normal ventricles display a transmural Ito gradient, with an Ito density much larger in the epicardium than the endocardium (Litovsky & Antzelevitch, 1988; Furukawa et al. 1990; Antzelevitch et al. 1991; Fedida & Giles, 1991; Wettwer et al. 1994; Näbauer et al. 1996). Local alterations in Ito density are believed to underlie significant aspects of cardiac pathophysiology and arrhythmogenesis in conditions like CHF (Kääb et al. 1996; Oudit et al. 2001; Li et al. 2002), myocardial ischaemia and infarction (Lue & Boyden, 1992; Lukas & Antzelevitch, 1993; Rozanski et al. 1998; Kaprielian et al. 2002), and Brugada syndrome (Yan & Antzelevitch, 1999; DiDiego et al. 2002).

Human and canine ventricular Ito is believed to be carried primarily by channels composed of Kv4.3 α-subunits (Dixon et al. 1996) and KChIP2 β-subunits (An et al. 2000; Decher et al. 2001; Kuo et al. 2001; Patel et al. 2002a). KChIP2 co-expression increases current density, slows inactivation and accelerates recovery from inactivation of Ito resulting from Kv4 subunit expression in heterologous systems (An et al. 2000; Decher et al. 2001; Deschênes & Tomaselli, 2002; Patel et al. 2002a). Targeted deletion of KChIP2 in mice causes loss of Ito and a susceptibility to ventricular arrhythmias (Kuo et al. 2001).

The molecular basis of transmural Ito gradients has been controversial. In rats (Dixon & McKinnon, 1994) and ferrets (Brahmajothi et al. 1999), transmural gradients in Kv4.2 and Kv4.3 appear to be key contributors. In ferrets, dogs and man, there are striking transmural gradients in KChIP2 mRNA, leading to the notion that KChIP2 contributes to transmural heterogeneity in these species (Rosati et al. 2001, 2003; Patel et al. 2002b), but this notion has been contested based on electrophysiological observations and an apparent lack of a transmural gradient in KChIP2 protein expression (Deschênes et al. 2002). Down-regulation of Kv4.3 mRNA has been observed in cardiac tissues from humans with CHF, and has been considered to be a primary mechanism of Ito suppression in this condition (Kääb et al. 1998). However, we are not aware of studies of the potential contribution of KChIP2 to Ito changes in CHF, which could be substantial in view of the importance of KChIP2 in Ito expression.

The present study was designed to assess the expression of KChIP2 and Kv4.3 subunits in epicardial and endocardial tissues of normal dogs and dogs with pacing-induced CHF. We quantified mRNA copy number with competitive reverse transcription (RT)-polymerase chain reaction (PCR) and confirmed some observations with real-time PCR, and analysed protein expression by Western blot. To exclude contamination of results by a contribution from the non-cardiac cell population in cardiac tissue, we performed analyses in isolated cardiomyocytes as well as whole cardiac tissues. Finally, to verify the potential relevance of our findings to man we evaluated Kv4.3 and KChIP2 protein expression in normal and failing human hearts.

Methods

Canine CHF model

CHF was induced in dogs by ventricular tachypacing as previously reported (Cha et al. 2004). Briefly, custom-modified pacemakers (Medtronic) were implanted in the necks of adult mongrel dogs under isoflurane anaesthetic and ketamine/valium and attached to pacing leads inserted in the right ventricular apex under fluoroscopy. After 24 h for recovery, pacing was initiated at 240 beats min−1 and maintained for 2 weeks. After haemodynamic confirmation of the presence of CHF under morphine (2 mg kg−1 s.c.)/α-chloralose (100 mg kg−1 i.v.) anaesthesia (Table 1), the dogs were killed with an overdose of α-chloralose. The hearts were removed and the ventricles isolated. Epicardial and endocardial tissues were obtained by cutting 1 mm thick slices from the epicardial and endocardial surfaces, respectively. Any free-running Purkinje fibres were removed prior to isolation of the endocardial layer. Unpaced dogs served as controls and tissue was obtained in a similar fashion. All animal handling procedures adhered to the guidelines of the Canadian Council on Animal Care and were approved by the Montreal Heart Institute Animal Research Ethics Committee.

Table 1.

Haemodynamic data confirming the presence of CHF

Body weight (kg) SBP (mmHg) DBP (mmHg) Mean BP (mmHg) RA BP (mmHg) LV Sys (mmHg) LVEDP (mmHg)
Control 25.1 ± 2.4 118.8 ± 6.2 73.6 ± 4.8 85.8 ± 5.5 2.2 ± 0.4 113.2 ± 5.7 2.8 ± 1.1
Heart failure 27.1 ± 1.0 99.8 ± 4.0* 61.0 ± 3.0 73.6 ± 3.3 9.8 ± 3.2 93.4 ± 3.4* 24.9 ± 3.3**
Open in a new tab

n = 5 for control and heart failure. Significantly different from CTL;

*

P < 0.05

**

P < 0.005.

SBP, systolic blood pressure; DBP, diastolic blood pressure; Mean BP, mean arterial blood pressure; RA BP, mean right atrial pressure; LV Sys, left ventricular systolic blood pressure; LVEDP, left ventricular end-diastolic pressure.

Canine cardiomyocyte isolation

Hearts were excised through a left lateral thoracotomy under morphine/chloralose anaesthesia as specified above and immersed in oxygenated Tyrode solution at room temperature. The anterior left ventricular free wall (∼30 × 50 mm) was dissected and the artery perfusing it was cannulated. Cell isolation was performed as previously described, by perfusion with a solution containing collagenase (120 U ml−1, Worthington, type II) (Li et al. 2002). When the tissue was well-digested, cells were taken from the subepicardial and subendocardial layers (∼1 mm thick). Cells were dispersed by gentle trituration with a Pasteur pipette, and were kept in a high-K+ storage solution (see Solutions) at 4°C. Some cells were washed and stored in Krebs solution and then spun at 500 g (4°C) to remove any contaminants. Cells were then resuspended in 5 mm Tris-HCl (pH 7.4), 2 mm EDTA, 5 μg/ml leupeptin, 10 μg/ml benzamidine, and 5 μg/ml soybean trypsin inhibitor for membrane protein isolation. Other cells were placed in storage solution and used for patch clamp measurements on the same day, in order to confirm the relative Ito properties of tissues used for biochemical determinations.

Human tissue samples

The undiseased human hearts were obtained from general organ donors whose hearts were explanted to obtain pulmonary and aortic valves for transplant surgery. The human donor heart experiments complied with the Helsinki Declaration of the World Medical Association and were approved by the Albert Szent-Gyorgyi Medical University Ethical Review Board. Diseased human tissue was obtained with informed consent from terminally failing human hearts explanted at the time of cardiac transplantation. Human hearts were stored in cold cardioplegic solution for < 6 h before small epicardial and endocardial left ventricular-free wall samples were prepared in a fashion similar to that for dogs and then fast-frozen in liquid nitrogen.

Solutions

The standard Tyrode solution contained (mm): NaCl 136, KCl 5.4, MgCl2 1, CaCl2 1, NaH2PO4 0.33, Hepes 5 and dextrose 10 (pH 7.35 with NaOH). The high-K+ storage solution contained (mm): KCl 20, KH2PO4 10, dextrose 10, mannitol 40, l-glutamic acid 70, β-OH-butyric acid 10, taurine 20, EGTA 10 and 0.1% BSA (pH 7.3 with KOH). The standard pipette solution contained (mm): potassium aspartate 110, KCl 20, MgCl2 1, MgATP 5, GTP 0.1, Hepes 10, sodium phosphocreatine 5, EGTA 5, with pH adjusted to 7.3 with KOH. For Ito recording, atropine (1 μm) and CdCl2 (200 μm) were added to external solutions to eliminate muscarinic K+ currents and to block Ca2+ currents. Na+ current contamination was avoided by using a holding potential (HP) of −50 mV.

Electrophysiological data acquisition

The whole-cell patch-clamp technique was applied for ionic current recording from canine cardiomyocytes at 36°C. Small cells were selected to optimize spatial voltage control. The compensated series resistance and capacitive time constant (τc) averaged 2.3 ± 0.1 MΩ and 294 ± 10 μs, respectively. Leakage compensation was not used. Cell capacitance averaged: 139.9 ± 13.7 pF in control epicardial cells (n = 7) and 137.2 ± 13.9 pF in CHF epicardial cells (n = 7), 103.2 ± 11.7 pF in control endocardial cells (n = 8) and 124.3 ± 7.9 pF in CHF endocardial cells (n = 8). Currents are expressed in terms of density. Non-linear least-square curve-fitting algorithms were used for curve fitting.

Western blot studies

Membrane protein was extracted from tissue samples with 5 mm Tris-HCl (pH 7.4), 2 mm EDTA, 5 μg/ml leupeptin, 10 μg/ml benzamidine and 5 μg/ml soybean trypsin inhibitor, followed by tissue homogenization. The homogenized mixture was centrifuged for 15 min at 500 g to eliminate cellular components and then the supernantant was centrifuged at 45 000 g for 30 min to isolate membrane fractions. All procedures were performed at 4°C. Membrane proteins were fractionated on either 8% (Kv4.3, caldesmon and Na+−K+ ATPase) or 10% (KChIP2) SDS-polyacrylamide gels and transferred electrophoretically to Immobilon-P polyvinylidene fluoride membranes (Millipore) in 25 mm Tris-base, 192 mm glycine and 5% methanol at 0.09 mA for 18 h (Kv4.3) or 65 V for 35 min (KChIP2). Membranes were blocked in 5% non-fat dry milk (Bio-Rad) in TTBS (Tris-HCl 50 mm, NaCl 500 mm; pH 7.5, 0.05% Tween-20) for 2 h (room temperature) and then incubated with primary antibody (1: 250 dilution) in 5% non-fat dry milk in TTBS for 4 h at room temperature. Kv4.3 antibody was purchased from Alomone Laboratories; a KChIP2 polyclonal antibody was purchased from Santa Cruz Biotechnology, a second polyclonal antibody was a kind gift from Dr Gordon Tomaselli, and a KChIP2 monoclonal antibody was a kind gift from Dr James Trimmer at the University of California, Davis. The monoclonal KChIP2 antibody recognizes an epitope located in the highly conserved core region of the protein that is similar for most KChIP2 isoforms. The caldesmon and Na+−K+ ATPase antibodies used for protein sample validation were purchased from Research Diagnostics Inc. Membranes were washed 3 times in TTBS, reblocked in 5% non-fat dry milk in TTBS (15 min) and then incubated with horseradish peroxidase-conjugated goat antirabbit IgG secondary antibody (1: 5000, for Alomone antibodies) or donkey-antigoat IgG secondary antibody (1: 10,000, for Santa Cruz antibodies) in 5% non-fat dry milk in TTBS (40 min). They were subsequently washed 3 times in TTBS and once in TBS (same as TTBS but without Tween-20). Signals were obtained with Western Lightning Chemiluminescence Reagent Plus (PerkinElmer Life Sciences). Band densities were determined with a laser-scanning densitometer (PDI 420oe) and Quantity One software (PDI). Protein loading was controlled by probing all Western blots with anti-GAPDH antibody (Research Diagnostics Incorporated) and normalizing ion-channel protein band intensity to that of GAPDH. Blots with antibody pre-incubated with the antigenic peptide were performed for Kv4.3 and the commercially available KChIP2 antibody. There was no antigenic peptide sample available for the monoclonal KChIP2 antibody provided to us by Dr Trimmer.

Cell culture

Chinese hamster ovary (CHO) cells were grown in culture at 37°C with 5% CO2 in F12 medium supplemented with 10% FBS, 0.5% glutamine and 1% penicillin/streptomycin. Cells were transfected with 1 μg of either Kv4.3 or KChIP2 cDNA subcloned in a pcDNA3.1 vector using lipofectamine (Invitrogen). Cells were allowed to grow for 24 h and then membrane proteins were isolated using the protocol described above.

RNA purification

Total RNA was isolated from 0.5 to 1.0 g samples using Trizol reagent (Invitrogen) followed by chloroform extraction and isopropanol precipitation. Genomic DNA was eliminated by incubating in DNase I (0.1 U μl−1, 37°C) for 30 min followed by acid phenol–chloroform extraction. RNA was quantified by spectrophotometric absorbency at 260 nm, purity confirmed by A260/A280 ratio and integrity evaluated by ethidium bromide staining on a denaturing agarose gel. RNA samples were stored at −80°C in RNAsecure Resuspension Solution (Ambion).

PCR primers

Gene-specific primers (GSPs) for competitive RT-PCR were designed based on published cDNA sequences for canine Kv4.3 and KChIP2 (Table 2). Chimeric primer pairs for RNA-mimic synthesis were constructed with a rabbit cardiac α-actin sequence flanked by the same GSPs. An 8-nucleotide sequence, GGCCGCGG, corresponding to the 3′ end of the T7 promoter, was conjugated to the 5′ end of each forward chimeric primer.

Table 2.

Gene-specific primers for RT-PCR

Clone Primer pair Bases spanned (bp) Size (bp) Tm (°C)
dKv4.3 F: TAGATGAGCAGATGTTTGAGC 1532–1742 210 54.5
Competitive RT-PCR R: ACTGCCCTGGATGTGGATG
dKv4.3 F: CCTGCTGCTCCCGTCGTA 1634–1695 61 60
Real-time RT-PCR R: AGTGGCTGGCAGGTTGGA
dKChIP2 F: GAGGACTTTGTGGCTGG 358–596 239 52
Competitive RT-PCR R: CCATCCTTGTTTCTGTCC
Open in a new tab

Synthesis of RNA mimic

First-strand cDNA (synthesized by reverse transcription with canine ventricular mRNA samples) was used as a template for subsequent PCR amplification steps with chimeric primer pairs. The resulting cDNA mimic contains a 460-bp α-actin sequence flanked at the 5′ end by the sense GSP sequence and an 8-bp T7 promoter sequence at the 3′ end flanking the antisense GSP sequence. Products were gel-purified with the QIAquick Gel Extraction Kit (Qiagen Inc.). The RNA mimic (internal standard) was created by in vitro transcription (mMESSAGE MACHINE, Ambion). The product was incubated with RNase-free DNase I (30 min, 37°C) to eliminate cDNA contamination, followed by phenol–chloroform extraction and isopropanol precipitation. Mimic size and concentration were determined by migration on a denaturing RNA gel alongside markers of known molecular weight and predetermined RNA concentrations to create a standard curve. Before conducting experiments, the mimic was checked to make sure it amplified at the same rate as the target gene segment. Samples of mimic and target PCR reactions were taken at various PCR cycles to verify that the intensity of both bands increased at the same rate (see Supplementary Fig. 1).

Figure 1. Properties of Ito in control and failing canine ventricles.

Figure 1

Open in a new tab

Representative Ito recordings from control and CHF myocytes in epicardium (A) and endocardium (B). Currents were elicited by a 100 ms test pulse at 0.1 Hz from a holding potential of −50 mV to +60 mV. C, mean current densities for control and CHF epicardial (Epi) and endocardial (Endo) Ito. A transmural gradient is seen in control hearts, and Ito is significantly down-regulated in CHF (n = 7 cells in Epi control and CHF; 8 cells in Endo control and CHF; *P < 0.05, ***P < 0.001 for control versus CHF). D, mean ± s.e.m. inactivation kinetics. τfast and τslow, fast and slow phase inactivation time constants. There were no statistically significant differences in time constants between Epi and Endo for CHF and control.

Competitive RT-PCR

RNA mimic samples were added with serial 10-fold dilutions to reaction mixtures containing 1 μg total RNA. RNA was denatured at 65°C (15 min). RT was conducted in a 20 μl reaction mixture containing reaction buffer (10 mm Tris-HCl, pH 8.3, 50 mm KCl), 2.5 mm MgCl2, 1 mm dNTPs (Roche), 3.2 μg random primers p(dN)6 (Roche), 5 mm DTT, 50 U RNase inhibitor (Promega), and 200 U M-MLV reverse-transcriptase (Gibco-BRL). First-strand cDNAs were synthesized at 42°C (1 h) and remaining enzymes heat-deactivated (99°C, 5 min).

First-strand cDNA from the RT step was used as a template in 25 μl reaction mixtures including 10 mm Tris-HCl (pH 8.3), 50 mm KCl, 1.5 mm MgCl2, 1 mm dNTPs, 0.5 μm GSPs, 0.625 mm DMSO and 2.5 U of Taq Polymerase (Gibco BRL). Reactions were hot-started at 93°C for 3 min of denaturing, followed by 30 amplification cycles (93°C, 30 s (denaturing); 55–58°C, 30 s (annealing); 72°C, 30 s (extension)). A final 72°C extension step was performed for 5 min. RT-negative controls were obtained to exclude genomic contamination for all RT-PCR reactions.

PCR products were visualized under UV light with ethidium bromide staining in 1.5% agarose gels. Images were captured with a Nighthawk camera, and band intensity determined with Quantity One software. A DNA Mass Marker (100 ng) was used to determine the size and quantity of DNA bands, and to create a standard curve in each experiment for absolute quantification. Plots of ln((target)/(mimic)) versus ln(mimic) were fitted by linear regression to determine the absolute concentration of target mRNA as previously described (Zicha et al. 2003).

Real-time PCR

In order to confirm the competitive RT-PCR results obtained for Kv4.3, real-time PCR was applied. Two-step real time PCR was conducted with the Perkin-Elmer Gene Amp 5700 sequence detection system. Primers used for the detection of Kv4.3 and GAPDH are shown in Table 2. Real-time PCR was run in the presence of a double-stranded DNA binding dye (SYBR Green, Applied Biosystems). Since this dye binds to any double-stranded DNA, PCR products were run on a 1.5% agarose gel with ethidium bromide staining to ensure that only one product was detected. A single peak in the dissociation plot also confirmed the specificity of the products. GAPDH was used as an internal standard, and all Kv4.3 results were normalized to GAPDH data obtained from the same samples at the same time. A standard curve with 100, 10, 1 and 0.1 ng of control epicardial total RNA was run in duplicate for each experiment.

Data analysis

All data are expressed as mean ± s.e.m. Each biochemical determination was performed on an individual heart: unless otherwise specified, n values represent the number of hearts studied. Western blot band intensities are expressed quantitatively as arbitrary OD units, which correspond to laser-densitometric K+-channel subunit membrane protein band intensity following background subtraction, divided by GAPDH signal intensity for the same sample. Real-time PCR results are similarly expressed in arbitrary units, corresponding to the intensity of SYBR Green captured by the Gene Amp 5700 as normalized to GAPDH. Statistical comparisons were performed with ANOVA and Student's t test with Bonferroni's correction. A two-tailed P < 0.05 was taken to indicate statistical significance.

Results

Ito properties in canine hearts

Typical Ito was recorded in cells obtained from control and CHF dogs, as illustrated in Fig. 1A (epicardial recordings) and 1B (endocardial). Currents were considerably smaller in endocardium and were reduced by CHF. The characteristic transmural Ito gradient was observed in control hearts, with a mean epicardial current density of 41 ± 5 pA pF−1 (n = 7 cells), compared with 4.4 ± 0.6 pA pF−1 in endocardium (Fig. 1C, n = 8 cells, P < 0.001). CHF reduced Ito by 72% in the epicardium, to 11 ± 2 pA pF−1 (n = 7 cells, P < 0.005); and by 55% in the endocardium, to 2.0 ± 0.9 pA pF−1 (n = 8 cells, P < 0.05). There were no significant differences in the fast and slow phase Ito inactivation time constants as a function of transmural layer or the presence of CHF (Fig. 1D). These results indicate that the tissue and cell samples that we used to evaluate local Ito subunit expression show the expected differences in currents and are therefore valid samples for examination of the molecular correlates of epicardial/endocardial and CHF-related differences.

Expression of Ito subunit mRNA

Figure 2A shows examples of gels obtained from competitive RT-PCR reactions for Kv4.3 mRNA with representative control epicardial and endocardial samples. Figure 2B shows examples obtained with tissues from CHF dogs. In all cases, lane 0 contains 100 ng of DNA Mass Ladder to create the standard curve for each gel. Lanes 1–6 were obtained with serial dilutions of the RNA mimic along with 1 μg total RNA. The upper bands represent the internal standard PCR product, while the lower bands are the target Kv4.3 bands co-amplified with the mimics in the same reaction tube. The molecular masses of target and mimic bands are indicated. As the mimic concentration decreases from left to right, the relative intensity of the target band to that of the mimic gets stronger, demonstrating the competition between mimic and target. The mimic quantities for Kv4.3 were 3.7 ng, 367 pg, 36.7 pg, 3.7 pg, 367 fg and 36.7 fg in lanes 1–6, respectively. Figure 2C compares the average absolute amounts of Kv4.3 mRNA in all samples. A transmural gradient was found for Kv4.3 mRNA, with the endocardial/epicardial concentration ratio averaging 0.3 in control and 0.4 in CHF.

Figure 2. Kv4.3 competitive RT-PCR.

Figure 2

Open in a new tab

Representative gels from Epi and Endo samples are shown for control in A, and for CHF in B. Mimic concentrations decrease from left to right. The point where mimic and target band intensities are equal indicates equal mRNA concentrations, and was determined for each experiment by linear regression of ln(mimic/target concentration) against ln(mimic concentration). C, absolute molar concentration of Kv4.3 mRNA (mean ± s.e.m). *P < 0.05 versus control, †P < 0.05 versus Epi, n = 5 hearts per group.

Because transmural Kv4.3 gradients have not previously been reported in the dog, we used real-time PCR to confirm the Kv4.3 mRNA differences we observed with competitive RT-PCR. The amplification plot for Kv4.3 is shown in Fig. 3A. All calculations for the relative quantity of Kv4.3 mRNA were obtained with values obtained from the logarithmic phase of DNA amplification (indicated by L.P. in the figure). The mean results in Fig. 3B show a significant transmural Kv4.3 mRNA gradient under control conditions and CHF-induced down-regulation, qualitatively similar to the competitive RT-PCR findings.

Figure 3. Canine Kv4.3 Real-time PCR results.

Figure 3

Open in a new tab

A, a representative amplification plot obtained from Kv4.3 real-time PCR with control and CHF, Epi and Endo tissue samples. L.P., log amplification phase threshold for calculation of mRNA expression. B, mean ± s.e.m. data from Kv4.3 real-time PCR. A transmural gradient is observed for Kv4.3 mRNA, as well as down-regulation in CHF. *P < 0.05 versus control, †P < 0.05 versus control Epi, n = 7 hearts per group.

Figure 4A and B shows representative gels from KChIP2 competitive RT-PCRs. The last lane in each gel shows an example of an RT-negative control, to detect any genomic DNA contamination in the total RNA samples. The mimic dilutions used for KChIP2 competitive RT-PCR were 3.1 ng, 310 pg, 31 pg, 3.1 pg and 310 fg. Mean data in Fig. 4C show a transmural gradient in KChIP2 mRNA, with an endocardial/epicardial concentration ratio of 0.2 in control tissue and 0.4 in CHF. However, KChIP2 mRNA was not down-regulated by CHF – if anything; there was a trend towards an increase.

Figure 4. Canine KChIP2 competitive RT-PCR.

Figure 4

Open in a new tab

Examples of Epi and Endo KCHIP2 competitive RT-PCR gels from a control (A) and a CHF (B) heart. C, absolute expression levels of KChIP2 mRNA (mean ± s.e.m). †P < 0.05 control Endo versus control Epi, n = 5 hearts per group.

Canine Kv4.3 Western blot studies

Figure 5A shows a representative Western blot probed with anti-Kv4.3 antibody. A single band is detected at the expected molecular weight (∼75 kDa). The Kv4.3 signal was suppressed by pre-incubation with antigenic peptide (last two lanes), confirming the specificity of the band. Corresponding GAPDH signals are shown in the lower panel of Fig. 5A. Figure 5B shows mean data for Kv4.3 membrane protein, which indicate a significant transmural gradient, with endocardial/epicardial expression ratios of 0.5 in control and 0.4 in CHF hearts. Kv4.3 protein was also significantly decreased in CHF, with a value in epicardium averaging 50% of control and in endocardium 40% of control. To exclude contamination by non-cardiomyocyte elements, Western blots were repeated using membrane protein fractions from isolated canine cardiomyocytes obtained from control dogs (the absence of smooth muscle cell contamination of the isolated cardiomyocyte sample is indicated by the lack of detectable caldesmon, as shown in Supplementary Fig. 2). Figure 5C shows an example of such a Western blot probed for Kv4.3. The last two lanes show that the 75 kDa bands disappeared when antibody pre-incubated with control antigen was used. The transmural gradient in Kv4.3 protein expression in isolated myocytes was similar to that seen in whole tissue (Fig. 5D), with an endocardial/epicardial expression ratio of 0.5. The specificity of the anti-Kv4.3 antibody was verified by immunoblotting proteins isolated from CHO cells transfected with Kv4.3. Lane 1 in Fig. 5E shows that two bands are detected by the Kv4.3 antibody. Pre-incubation with control antigen (lane 2) eliminated the band at ∼75 kDa. The Kv4.3 protein was also probed with the monoclonal KChIP2 antibody used for KChIP2 Western blots, and no signal was detected in the range of 75 kDa (lane 3).

Figure 5. Canine Kv4.3 Western blot results.

Figure 5

Open in a new tab

A, Western blot membrane with whole-tissue membrane protein probed with anti-Kv4.3 antibody (Alomone). The expected molecular mass for Kv4.3 (∼75 kDa) is indicated. Last two lanes show samples for which the primary antibody was pre-incubated with control antigen. Lower panel shows GAPDH bands corresponding to lanes at the top, to which Kv4.3 results were normalized. B, mean ± s.e.m. Kv4.3 protein expression values. *P < 0.05 versus Epi, †P < 0.05 versus control Epi, n = 5 hearts per group. C, experiments of the type shown in A were performed with membrane proteins from isolated cardiomyocytes, to eliminate contamination from non-myocyte cell species. Last two lanes show samples probed with primary Kv4.3 antibody pre-incubated with control antigen (band at ∼75 kDa disappears). D, mean ± s.e.m. Kv4.3 protein expression values in isolated cardiomyocytes (†P < 0.05 versus control Epi, n = 5 hearts per group). E, Western blot of proteins isolated from Kv4.3-transfected CHO cells. Lane 1 shows bands at ∼75 and 43 kDa. Lane 2 shows result when antibody was pre-incubated along with its control antigen: the ∼75 kDa band completely disappeared. Lane 3 shows membrane probed with a monoclonal KChIP2 antibody. A single high-molecular weight band at ∼125 kDa was detected, but KChIP2 antibody did not detect a band with the expected molecular mass for Kv4.3. CA, anti-Kv4.3 antibody pre-incubated with control antigen. Results similar to those in E were obtained in 3 experiments.

Characterization of KChIP2 antibodies

In preliminary studies, we were unable to detect a transmural gradient in KChIP2 protein expression with the use of a polyclonal antibody (Zicha et al. 2003). Because of conflicting results in the recent literature regarding transmural protein gradients in KChIP2 (Deschênes et al. 2002; Rosati et al. 2003), we decided to verify the specificity of various antibodies before performing definitive experiments. Membrane proteins were isolated from CHO cells transfected with KChIP2 and were probed with various polyclonal and monoclonal KChIP2 antibodies (Fig. 6A). When protein was probed with the monoclonal KChIP2 antibody (lane 1, Fig. 6A), a single band at the expected size of ∼30 kDa was detected. When the same protein sample was probed with a commercially available polyclonal KChIP2 antibody, multiple bands were detected (lane 2). With the use of this antibody, we obtained equal endocardial (1.9 ± 0.3 OD units) and epicardial (2.1 ± 0.3 OD units) intensities for the band closest in molecular weight to that expected (n = 5 hearts, matched endocardial and epicardial samples from each). A similar result was obtained when probing the membrane with a polyclonal anti-KChIP2 antibody similar to the one used by Deschênes et al. (2002) (lane 3). When the protein sample was probed with the Kv4.3 antibody, a single non-specific band at ∼140 kDa was detected, confirming that the Kv4.3 antibody does not detect KChIP2. Similar to the results obtained with KChIP2-transfected CHO cells, preliminary studies with the commercially available polyclonal KChIP2 antibody to probe protein isolated from canine epicardium showed a large number of bands (Fig. 6B), whereas the monoclonal antibody detected a distinct band at the expected molecular weight (Fig. 6C). Therefore, further KChIP2 protein expression studies were performed with the monoclonal KChIP2 antibody.

Figure 6. Western blots on KChIP2 proteins in transfected CHO cells and canine cardiac tissues.

Figure 6

Open in a new tab

A, Western blots of membrane protein from KChIP2-transfected CHO cells. Lane 1 shows result of a membrane probed with monoclonal KChIP2 antibody: a single band was detected at ∼30 kDa. A commercially available polyclonal KChIP2 antibody was used in lane 2. Many non-specific bands were detected. Lane 3 shows KChIP2 protein probed with a polyclonal antibody kindly provided by Dr Gordon Tomaselli. Again, many bands were detected. Lane 4 shows KChIP2 protein probed with a Kv4.3 antibody. No band is detected at the expected size for KChIP2, confirming the lack of cross-reactivity of the Kv4.3 antibody with KChIP2. B, preliminary Western blots performed on canine cardiac tissue membrane proteins using the commercially available KChIP2 antibody. C, preliminary Western blots on canine cardiac tissues using monoclonal antibody. A single clear band was detected at ∼30 kDa, along with a band at a much higher molecular mass. This antibody was used for subsequent studies. Results similar to those in A, B and C were obtained for 3, 5 and 5 samples, respectively.

Canine KChIP2 Western blot studies

Figure 7A shows a typical KChIP2 Western blot, with a distinct signal detected at ∼30 kDa. A clear transmural expression gradient was observed for KChIP2 protein, with much stronger bands in epicardial than endocardial tissues (Fig. 7A) when probed with the monoclonal antibody. This finding is confirmed by the mean data in Fig. 7B, with endocardial/epicardial protein ratios of 0.14 and 0.16 in control and CHF samples, respectively. Unlike Kv4.3 protein, KChIP2 expression was not changed in CHF, with mean values in control and CHF being very similar for a given transmural layer (Fig. 7B). The transmural gradient in KChIP2 protein expression was also observed for Western blots performed on membrane proteins from isolated cardiomyocytes (Fig. 7C). Mean results for isolated cardiomyocyte proteins (Fig. 7D) showed an endocardial/epicardial expression ratio of 0.13, of the same order as obtained in whole cardiac tissues.

Figure 7. Canine KChIP2 Western blot results.

Figure 7

Open in a new tab

A, example of KChIP2 Western blot obtained with monoclonal KChIP2 antibody applied to canine ventricular tissue membrane proteins. A single band at ∼32 kDa was detected. B, expression of KChIP2 protein (mean ± s.e.m) in whole tissue samples. †P < 0.05 versus Epi. C, example of KChIP2 Western blot on samples of isolated cardiomyocyte membrane protein using the monoclonal KChIP2 antibody. Single bands were detected at ∼32 kDa. Lower panel shows a representative GAPDH blot performed on the same samples as in the lanes immediately above. D, KChIP2 protein expression in isolated cardiomyocytes (mean ± s.e.m). †P < 0.05, n = 5 hearts per group.

Western blot studies on human cardiac tissues

Membrane protein samples were isolated from five normal human hearts and five patients with NYHA Class III–IV CHF. Figure 8A shows an example of a Kv4.3 Western blot on human heart samples. A clear band at ∼75 kDa was observed in all human samples and disappeared when antibody was pre-incubated along with the blocking peptide (last 2 lanes). The mean data in Fig. 8B show that there was a significant transmural gradient in Kv4.3 protein in the human heart (endocardial/epicardial ratios of 0.6 and 0.4 in control and CHF, respectively). Furthermore, Kv4.3 expression was significantly reduced by CHF. Probing human cardiac membrane proteins with the monoclonal KChIP2 antibody (Fig. 8C) revealed strong bands at the expected molecular mass of ∼30 kDa, as well as weaker bands at a smaller mass (∼27 kDa). Mean data showed a strong transmural gradient (endocardial/epicardial ration 0.3 and 0.2 in control and CHF, respectively), but no significant change with CHF.

Figure 8. Human Ito subunit Western blot results.

Figure 8

Open in a new tab

A, Western blot of membrane protein probed with anti-Kv4.3 antibody (Alomone). Last two lanes: samples blotted with primary antibody pre-incubated with antigenic peptide. B, Kv4.3 protein expression. *P < 0.05 CHF versus control, †P < 0.05 Endo versus Epi, n = 5 hearts per group. C, example of KChIP2 Western blot, band detected at ∼32 kDa. Lower panel shows GAPDH Western blot on same samples as lanes above. D, KChIP2 protein expression. †P < 0.05 Endo versus Epi, n = 5 hearts per group.

Discussion

In this study, we assessed the expression of the K+ channel subunits Kv4.3 and KChIP2 in the epicardium and endocardium of normal and failing hearts. We found that both subunits show a transmural gradient, with endocardial expression being less than epicardial, suggesting a significant role in the transmural gradient of Ito. However, only Kv4.3 was down-regulated by CHF, suggesting that changes in this α-subunit are the primary factor in CHF-induced Ito suppression.

Comparison with previous studies of transmural cardiac Ito subunit expression

Dixon & McKinnon (1994) were the first to show a transmural expression gradient for an Ito channel subunit, when they demonstrated that Kv4.2 mRNA expression across the rat left ventricular wall, but not that of Kv1.4, parallel the Ito density gradient. Subsequently, Brahmajothi et al. (1999) showed that Kv4.2 and 4.3 mRNA and protein are more strongly expressed in ferret epicardium than endocardium, whereas Kv1.4 mRNA is expressed symmetrically and Kv1.4 protein appears more concentrated in the endocardium. Rosati et al. (2001) subsequently showed that KChIP2 mRNA expression follows a steep gradient across the myocardium, paralleling the gradient in current, but that Kv4.3 mRNA expression showed no gradient. Patel et al. (2002b) showed a strong transmural KChIP2 transmural mRNA and protein gradient in the ferret. Deschênes et al. (2002) revisited this issue, providing functional and protein expression data indicating that KChIP2 expression does not vary across the ventricular wall and that the biophysical properties of canine Ito do not reflect the variations one would expect if varying contributions of KChIP2 were involved. Recently, Rosati et al. (2003) used a monoclonal antibody to evaluate the protein expression of KChIP2 across the ventricular wall and confirmed a strong epicardial/endocardial gradient.

Unlike Rosati et al. (2001, 2003), we did observe a clear difference in epicardial versus endocardial Kv4.3 expression. Because of the discrepancy, we used four different approaches to confirm the finding: mRNA measurement by competitive RT-PCR, mRNA measurement by real time RT-PCR, protein measurements on protein extracts from whole cardiac tissues and protein measurements on extracts from isolated canine cardiomyocytes. Furthermore, we observed similar Kv4.3 protein gradients in human cardiac tissue samples. Like Rosati, we observed strong transmural gradients in KChIP2 protein expression. Our findings suggest that the discrepancies between different studies of transmural KChIP2 protein expression (Deschênes et al. 2002; Rosati et al. 2003) may be due to differences in the antibodies used, with the polyclonal antibody having insufficient specificity for KChIP2.

Relation to previous studies of Ito subunit alterations in CHF

Relatively little published information is available about Ito subunit changes in CHF. Kääb et al. (1998) showed that Kv4.3 mRNA is reduced in cardiac tissue samples from CHF patients, and Borlak & Thum (2003) similarly found Kv4.3 mRNA to be reduced in explanted hearts of patients with end-stage CHF. Neither Kv4.3 protein expression nor KChIP2 mRNA or protein was evaluated. We are not aware of other studies that have examined Ito ion channel expression in CHF.

Novel elements and potential significance

Our study is the first of which we are aware that examines expression changes in Kv4.3 protein, as well as KChIP2 mRNA and protein, in CHF. The results suggest that in both our well-defined canine model and in human CHF, changes in Kv4.3 and not KChIP2 expression participate in Ito down-regulation. With respect to the molecular basis for the well-known transmural Ito gradient, the present paper presents a number of novel elements. Our study is the first of which we are aware that shows a transmural gradient in Kv4.3 expression across the canine left ventricle. We were surprised by our results in the dog, and therefore repeated them in a number of complementary ways, obtaining consistent results with all methods. Our observations regarding KChIP2 suggest that previously discrepant results may be due to differences in the antibodies used for Western blotting, with the highly specific monoclonal antibody consistently showing stronger KChIP2 expression in epicardium than endocardium for both canine and human samples.

The functional significance of the various differences in subunit expression that we noted is an interesting question. KChIP2 and Kv4.3 appear to associate with 1: 1 stoichiometry to create functional channels containing four molecules of each subunit (Kim et al. 2004). KChIP2 co-expression greatly increases membrane trafficking of Kv4 subunits and current density resulting from their expression in heterologous systems (An et al. 2000; Decher et al. 2001; Patel et al. 2002a; Shibata et al. 2003). KChIP2 deletion strongly suppresses Ito in genetically engineered mice (Kuo et al. 2001). However, the effect of varying expression levels of Kv4.3 and KChIP2, as noted for endocardial/epicardial and CHF-related differences in the present study, is harder to predict. Because of the strong effect of KChIP2 in determining Kv4.3 membrane trafficking, the transmural gradients in KChIP2 expression alone might be sufficient to create the physiological gradient in Ito. This notion is consistent with the close agreement between the endocardial/epicardial protein gradients for KChIP2 protein and Ito density ratios. Nevertheless, the epicardial/endocardial gradients that we observed in Kv4.3 expression may also play a role. Data suggesting an important contribution of α-subunit expression gradients to regional Ito expression have been presented previously for rat (Dixon & McKinnon, 1994; Wickenden et al. 1999), ferret (Brahmajothi et al. 1999) and mouse (Guo et al. 1999, 2002) hearts. Evidence supporting a role for Kv4.3 expression differences in determining variations in Ito is provided by our CHF data, since in CHF Kv4.3 was down-regulated without a change in KChIP2, and Kv4.3 down-regulation paralleled the CHF-induced decrease in Ito density. In addition to the levels of Kv4.3 and KChIP2 expression, the properties of Ito across the ventricular wall may be affected by differential regulation and by potential interactions with a variety of other membrane proteins (Deschênes & Tomaselli, 2002; Deschênes et al. 2002).

Physiologically, the transmural gradient in Ito plays an important role in establishing repolarization gradients that are crucial for a variety of electrocardiographic phenomena and arrhythmia mechanisms (Antzelevitch et al. 1991; Antzelevitch & Fish, 2001). In addition, changes in Ito are probably important in the pathophysiology of a variety of cardiac disease entities involving ion channel remodelling, ventricular tachyarrhythmias and impaired cardiac contractility (Antzelevitch & Fish, 2001; Oudit et al. 2001). Thus, understanding the molecular basis of Ito expression differences is potentially of great significance.

Potential limitations

We were able to study Kv4.3 and KChIP2 expression in isolated canine cardiomyocytes as well as dog atrial tissues, whereas for humans we were only able to work with whole tissue samples. However, the similarity between human and canine results, and the fact that results in canine tissues were consistent for mRNA across two methods and for protein expression in tissues and cells diminishes concerns about contamination of human cardiac samples by non-cardiac elements.

An additional lower-molecular weight band was seen around 55 kDa when probing blots for Kv4.3 protein. The exact nature of this band is not completely known since it is considerably smaller than the reported molecular weight of Kv4.3 (∼75 kDa). The band decreased in intensity but did not completely disappear upon probing with antibody pre-incubated with the antigenic peptide and may represent a proteolytic fragment of Kv4.3.

We are unsure why we observed gradients in Kv4.3 expression from epicardium to endocardium and Rosati et al. (2001, 2003) did not. They quantified Kv4.3 expression in whole tissue with RNase protection assay, whereas we used competitive RT-PCR and real-time PCR, as well as Western blot on whole tissues and isolated cardiomyocytes. The differences may be related to different methodologies or to subtle differences in tissue sampling sites. Both competitive RT-PCR and real-time PCR indirectly measure mRNA amounts, since cDNA is used for end-point calculations. However, these measurements were made during the logarithmic phase of cDNA amplification and can therefore be considered reflective of the amount of mRNA in a given sample. Discrepancies may also be related to differences in the types of dogs used. Both studies were performed with tissues from mongrel dogs, for which the race and genetic background are unknown and could be highly variable.

Supplementary Material

Supplemental Data
jphysiol_2004.075861_index.html (917B, html)
Supplemental Data
jphysiol_2004.075861v2_index.html (1KB, html)

Acknowledgments

The authors thank James Trimmer for providing us with the monoclonal KChIP2 antibody, Gordon Tomaselli for providing a polyclonal KChIP2 antibody, Evelyn Landry for technical assistance and France Thériault for secretarial help with the manuscript. Funding was provided by the Canadian Institutes of Health Research, the Quebec Heart and Stroke Foundation (SN), and the Mathematics of Information Technology and Complex Systems (MITACS) Network of Centers of Excellence. S.Z. was supported by a graduate studentship from the Fonds de la recherche en santé de Québec (FRSQ).

Supplementary material

The online version of this paper can be accessed at:

DOI: 10.1113/jphysiol.2004.075861/

http://jp.physoc.org/cgi/content/full/jphysiol.2004.075861/DC1 and contains two supplementary figures entitled: Figure 1. Linearity of competitive RT-PCR reactions and Figure 2. Western blot to exclude contamination of protein samples by smooth muscle tissue.

This material can also be found at:

http://www.blackwellpublishing.com/products/journals/suppmat/tjp/tjp608/tjp608sm.htm

References

  1. An WF, Bowlby MR, Betty M, Cao J, Ling HP, Mendozza G, Hinson JW, Mattsson KI, Strassle BW, Trimmer JS, Rhodes KJ. Modulation of A-type potassium channels by a family of calcium sensors. Nature. 2000;403:553–556. doi: 10.1038/35000592. 10.1038/35000592. [DOI] [PubMed] [Google Scholar]
  2. Antzelevitch C, Fish J. Electrical heterogeneity within the ventricular wall. Basic Res Cardiol. 2001;96:517–527. doi: 10.1007/s003950170002. 10.1007/s003950170002. [DOI] [PubMed] [Google Scholar]
  3. Antzelevitch C, Sicouri S, Litovsky SH, Lukas A, Krishnan SC, DiDiego JM, Gintant GA, Liu DW. Heterogeneity within the ventricular wall: electrophysiology and pharmacology of epicardial, endocardial, and M-cells. Circ Res. 1991;69:1427–1449. doi: 10.1161/01.res.69.6.1427. [DOI] [PubMed] [Google Scholar]
  4. Borlak J, Thum T. Hallmarks of ion channel gene expression in end-stage heart failure. FASEB J. 2003;17:1592–1608. doi: 10.1096/fj.02-0889com. [DOI] [PubMed] [Google Scholar]
  5. Brahmajothi MV, Campbell DL, Rasmusson RL, Morales MJ, Trimmer JS, Nerbonne JM, Strauss HC. Distinct transient outward potassium current (Ito) phenotypes and distribution of fast-inactivating potassium channel alpha subunits in ferret left ventricular myocytes. J General Physiol. 1999;113:581–600. doi: 10.1085/jgp.113.4.581. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Cha TJ, Ehrlich JR, Zhang L, Shi YF, Tardif JC, Leung TK, Nattel S. Dissociation between ionic remodeling and ability to sustain atrial fibrillation during recovery from experimental congestive heart failure. Circulation. 2004;109:412–418. doi: 10.1161/01.CIR.0000109501.47603.0C. [DOI] [PubMed] [Google Scholar]
  7. Decher N, Uyguner O, Scherer CR, Karaman B, Yüksel-Apak M, Busch AE, Steinmeyer K, Wollnik B. hKChIP2 is a functional modifier of hKv4.3 potassium channels: cloning and expression of a short hKChIP2 splice variant. Cardiovasc Res. 2001;52:255–264. doi: 10.1016/s0008-6363(01)00374-1. 10.1016/S0008-6363(01)00374-1. [DOI] [PubMed] [Google Scholar]
  8. Deschênes I, DiSilvestre D, Juang GJ, Wu RC, An WF, Tomaselli GF. Regulation of Kv4.3 current by KChIP2 splice variants. A component of native cardiac Ito? Circulation. 2002;106:423–429. doi: 10.1161/01.cir.0000025417.65658.b6. [DOI] [PubMed] [Google Scholar]
  9. Deschênes I, Tomaselli GF. Modulation of Kv4.3 current by accessory subunits. FEBS Lett. 2002;528:183–188. doi: 10.1016/s0014-5793(02)03296-9. 10.1016/S0014-5793(02)03296-9. [DOI] [PubMed] [Google Scholar]
  10. DiDiego JM, Cordeiro JM, Goodrow RJ, Fish JM, Zygmunt AC, Perez GJ, Scornik FS, Antzelevitch C. Ionic and cellular basis for the predominance of the Brugada syndrome phenotype in males. Circulation. 2002;106:2004–2011. doi: 10.1161/01.cir.0000032002.22105.7a. [DOI] [PubMed] [Google Scholar]
  11. Dixon JE, McKinnon D. Quantitative analysis of potassium channel mRNA expression in atrial and ventricular muscle of rats. Circ Res. 1994;75:252–260. doi: 10.1161/01.res.75.2.252. [DOI] [PubMed] [Google Scholar]
  12. Dixon JE, Shi W, Wang HS, McDonald C, Yu H, Wymore RS, Cohen IS, McKinnon D. Role of Kv4.3 K+ channel in ventricular muscle. A molecular correlate for the transient outward current. Circ Res. 1996;79:659–668. doi: 10.1161/01.res.79.4.659. [DOI] [PubMed] [Google Scholar]
  13. Fedida D, Giles WR. Regional variations in action potentials and transient outward current in myocytes isolated from rabbit left ventricle. J Physiol. 1991;442:191–209. doi: 10.1113/jphysiol.1991.sp018789. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Furukawa T, Myerburg RJ, Furukawa N, Bassett, Kimura S. Differences in transient outward currents of feline endocardial and epicardial myocytes. Circ Res. 1990;67:1287–1291. doi: 10.1161/01.res.67.5.1287. [DOI] [PubMed] [Google Scholar]
  15. Guo W, Li H, Aimond F, Johns DC, Rhodes KJ, Trimmer JS, Nerbonne JM. Role of heteromultimers in the generation of myocardial transient outward K+ currents. Circ Res. 2002;90:586–593. doi: 10.1161/01.res.0000012664.05949.e0. [DOI] [PubMed] [Google Scholar]
  16. Guo W, Xu H, London B, Nerbonne JM. Molecular basis of transient outward K+ current diversity in mouse ventricular myocytes. j Physicol. 1999;521:587–599. doi: 10.1111/j.1469-7793.1999.00587.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Kääb S, Dixon J, Duc J, Ashen D, Näbauer M, Beuckelmann DJ, Steinbeck G, McKinnon D, Tomaselli GF. Molecular basis of transient outward potassium current downregulation in human heart failure. A decrease in Kv4.3 mRNA correlates with a reduction in current density. Circulation. 1998;98:1383–1393. doi: 10.1161/01.cir.98.14.1383. [DOI] [PubMed] [Google Scholar]
  18. Kääb S, Nuss HB, Chiamvimonvat N, O'Rourke B, Pak PH, Kass DA, Marban E, Tomaselli GF. Ionic mechanism of action potential prolongation in ventricular myocytes from dogs with pacing-induced heart failure. Circ Res. 1996;78:262–273. doi: 10.1161/01.res.78.2.262. [DOI] [PubMed] [Google Scholar]
  19. Kaprielian R, Sah R, Nguyen T, Wickenden AD, Backx PH. Myocardial infarction in rat eliminates regional heterogeneity of AP profiles, Ito K+ currents, and [Ca2+]i transients. Am J Physiol Heart Circ Physiol. 2002;283:H1157–1168. doi: 10.1152/ajpheart.00518.2001. [DOI] [PubMed] [Google Scholar]
  20. Kim LA, Furst J, Butler MH, Xu S, Grigorieff N, Goldstein SA. Ito channels are octomeric complexes with four subunits of each Kv4.2 and K+ channel-interacting protein 2. J Biol Chem. 2004;279:5549–5554. doi: 10.1074/jbc.M311332200. 10.1074/jbc.M311332200. [DOI] [PubMed] [Google Scholar]
  21. Kuo HC, Cheng CF, Clark RB, Lin JJC, Lin JLC, Hoshijima M, Nguyen-Tran VTB, Gu Y, Ikeda Y, Chu PH, Ross J, Giles WR, Chien KR. A defect in the Kv channel-interacting protein 2 (KChIP2) gene leads to a complete loss of Ito and confers susceptibility to ventricular tachycardia. Cell. 2001;107:801–813. doi: 10.1016/s0092-8674(01)00588-8. [DOI] [PubMed] [Google Scholar]
  22. Li GR, Lau CP, Ducharme A, Tardif JC, Nattel S. Transmural action potential and ionic current remodeling in ventricles of failing canine hearts. Am J Physiol Heart Circ Physiol. 2002;283:H1031–1041. doi: 10.1152/ajpheart.00105.2002. [DOI] [PubMed] [Google Scholar]
  23. Litovsky SH, Antzelevitch C. Transient outward current prominent in canine ventricular epicardium but not endocardium. Circ Res. 1988;62:116–126. doi: 10.1161/01.res.62.1.116. [DOI] [PubMed] [Google Scholar]
  24. Lue WM, Boyden PA. Abnormal electrical properties of myocytes from chronically infarcted canine heart. Alterations in Vmax and the transient outward current. Circulation. 1992;85:1175–1188. doi: 10.1161/01.cir.85.3.1175. [DOI] [PubMed] [Google Scholar]
  25. Lukas A, Antzelevitch C. Differences in the electrophysiological response of canine ventricular epicardium and endocardium to ischemia. Role of the transient outward current. Circulation. 1993;88:2903–2915. doi: 10.1161/01.cir.88.6.2903. [DOI] [PubMed] [Google Scholar]
  26. Näbauer M, Beuckelmann DJ, Überfuhr P, Steinbeck G. Regional differences in current density and rate-dependent properties of the transient outward current in subepicardial and subendocardial myocytes of human left ventricle. Circulation. 1996;93:168–177. doi: 10.1161/01.cir.93.1.168. [DOI] [PubMed] [Google Scholar]
  27. Oudit GY, Kassiri Z, Sah R, Ramirez RJ, Zobel C, Backx PH. The molecular physiology of the cardiac transient outward potassium current (I(to)) in normal and diseased myocardium. J Mol Cell Cardiol. 2001;33:851–872. doi: 10.1006/jmcc.2001.1376. 10.1006/jmcc.2001.1376. [DOI] [PubMed] [Google Scholar]
  28. Patel SP, Campbell DL, Morales MJ, Strauss HC. Heterogeneous expression of KChIP2 isoforms in the ferret heart. J Physiol. 2002b;539:649–656. doi: 10.1113/jphysiol.2001.015156. 10.1113/jphysiol.2001.015156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Patel SP, Campbell DL, Strauss HC. Elucidating KChIP effects on Kv4.3 inactivation and recovery kinetics with a minimal KChIP2 isoform. J Physiol. 2002a;545:5–11. doi: 10.1113/jphysiol.2002.031856. 10.1113/jphysiol.2002.031856. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Rosati B, Grau F, Rodriguez S, Li H, Nerbonne JM, McKinnon D. Concordant expression of KChIP2 mRNA, protein and transient outward current throughout the canine ventricle. J Physiol. 2003;548:815–822. doi: 10.1113/jphysiol.2002.033704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Rosati B, Pan Z, Lypen S, Wang HS, Cohen I, Dixon JE, McKinnon D. Regulation of KChIP2 potassium channel β subunit gene expression underlies the gradient of transient outward current in canine and human ventricle. J Physiol. 2001;533:119–125. doi: 10.1111/j.1469-7793.2001.0119b.x. 10.1111/j.1469-7793.2001.0119b.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Rozanski GJ, Xu Z, Zhang K, Patel KP. Altered K+ current of ventricular myocytes in rats with chronic myocardial infarction. Am J Physiol Heart Circ Physiol. 1998;274:H259–265. doi: 10.1152/ajpheart.1998.274.1.H259. [DOI] [PubMed] [Google Scholar]
  33. Shibata R, Misonou H, Campomanes CR, Anderson AE, Schrader LA, Doliveira LC, Carroll KI, Sweatt JD, Rhodes KJ, Trimmer JS. A fundamental role for KChIPs in determining the molecular properties and trafficking of Kv4.2 potassium channels. J Biol Chem. 2003;278:36445–36454. doi: 10.1074/jbc.M306142200. 10.1074/jbc.M306142200. [DOI] [PubMed] [Google Scholar]
  34. Wettwer E, Amos GJ, Posival H, Ravens U. Transient outward current in human ventricular myocytes of supepicardial and subendocardial origin. Circ Res. 1994;75:473–482. doi: 10.1161/01.res.75.3.473. [DOI] [PubMed] [Google Scholar]
  35. Wickenden AD, Jegla TJ, Kaprielian R, Backx PH. Regional contributions of Kv1.4, Kv4.2, and Kv4.3 to transient outward K+ current in rat ventricle. Am J Physiol Heart Circ Physiol. 1999;276:H1599–1607. doi: 10.1152/ajpheart.1999.276.5.H1599. [DOI] [PubMed] [Google Scholar]
  36. Yan GX, Antzelevitch C. Cellular basis for the Brugada syndrome and other mechanisms of arrhythmogenesis associated with ST-segment elevation. Circulation. 1999;100:1660–1666. doi: 10.1161/01.cir.100.15.1660. [DOI] [PubMed] [Google Scholar]
  37. Zicha S, Moss I, Allen B, Varro A, Papp J, Dumaine R, Antzelevich C, Nattel S. Molecular basis of species-specific expression of repolarizing K+ currents in the heart. Am J Physiol Heart Circ Physiol. 2003;285:H1641–1649. doi: 10.1152/ajpheart.00346.2003. [DOI] [PubMed] [Google Scholar]
  38. Zicha S, Stafford S, Cha TJ, Han W, Nattel S. Molecular basis for transmural potassium current remodeling in heart failure. Circulation. 2003;(Suppl. IV) IV-75 (abstract) [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Data
jphysiol_2004.075861_index.html (917B, html)
jphysiol_2004.075861_1.pdf (99.4KB, pdf)
jphysiol_2004.075861_2.pdf (55.4KB, pdf)
Supplemental Data
jphysiol_2004.075861v2_index.html (1KB, html)
jphysiol_2004.075861v2_1.pdf (99.4KB, pdf)
jphysiol_2004.075861v2_2.pdf (55.4KB, pdf)
jphysiol_2004.075861v2_Supplementary_Figure_legends.doc (20.5KB, doc)

The online version of this paper can be accessed at:

DOI: 10.1113/jphysiol.2004.075861/

http://jp.physoc.org/cgi/content/full/jphysiol.2004.075861/DC1 and contains two supplementary figures entitled: Figure 1. Linearity of competitive RT-PCR reactions and Figure 2. Western blot to exclude contamination of protein samples by smooth muscle tissue.

This material can also be found at:

http://www.blackwellpublishing.com/products/journals/suppmat/tjp/tjp608/tjp608sm.htm

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES