Skip to main content
NCBI home page
Plant Physiology logoLink to Plant Physiology
. 2003 Jun;132(2):1011–1019. doi: 10.1104/pp.019000

An Arabidopsis Inositol 5-Phosphatase Gain-of-Function Alters Abscisic Acid Signaling1

Ryan N Burnette 1, Bhadra M Gunesekera 1, Glenda E Gillaspy 1,*
PMCID: PMC167039  PMID: 12805629

Abstract

Signals can be perceived and amplified at the cell membrane by receptors coupled to the production of a variety of second messengers, including inositol 1,4,5-trisphosphate (IP3). We previously have identified 15 putative inositol 5-phosphatases (5PTases) from Arabidopsis and shown that At5PTase1 can hydrolyze IP3. To determine whether At5PTase1 can terminate IP3-mediated signaling, we analyzed transgenic plants ectopically expressing At5PTase1. Stomata from leaves of At5PTase1 transgenic plants were abscisic acid (ABA) and light insensitive, and ABA induction of genes was delayed. Quantification of IP3 in plants exposed to ABA indicated that ABA induced two IP3 increases in wild-type plants. Both of these IP3 increases were reduced in At5PTase1 transgenic plants, indicating that IP3 may be necessary for stomatal closure and temporal control of ABA-induced gene expression. To determine if ABA could induce expression of At5PTase1, we examined RNA and protein levels of At5PTase1 in wild-type plants exposed to ABA. Our results indicate that At5PTase1 is up-regulated in response to ABA. This is consistent with At5PTase1 acting as a signal terminator of ABA signaling.

The ability to respond to a variety of biotic and abiotic signals is crucial to plants. Signals outside the cell can be perceived and amplified at the cell membrane by receptors linked to a variety of signaling pathways, including the inositol 1,4,5-trisphosphate (IP3) pathway (Stevenson et al., 2000; Taylor and Thorn, 2001). In this pathway, signals activate phospholipase C (PLC), which catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to form diacylglycerol and IP3. IP3 then binds to intracellular receptors, triggering the release of Ca2+ from intracellular stores into the cytosol (Berridge, 1993).

In plants, there is evidence that signals such as light (Shacklock et al., 1992), gravity (Perera et al., 1999, 2001), and abscisic acid (ABA; Wu et al., 1997; Sanchez and Chua, 2001) are relayed via IP3 signaling. Most of the information on IP3 signaling has arisen from studies utilizing ABA. The most notable affect of ABA on plants is its ability to induce stomatal closure (Allen et al., 2001). When open, stomatal pores allow the influx of CO2 and water vapor to move outward, driving the transpirational process. ABA is thought to trigger stomatal closure by inducing cytosolic Ca2+ increases, which, in turn inhibit plasma membrane H+-ATPases and inward-rectifying K+ channels. Subsequent activation of outward-rectifying K+ channels allows for ion efflux from the guard cell and a decrease in guard cell turgor, resulting in stomatal closure (Blatt et al., 1990; Lemtiri-Chlieh and MacRobbie, 1994; Schroeder et al., 2001a).

One key component in the mechanism of stomatal closure is an initial increase in cytosolic Ca2+ concentration that occurs within minutes of ABA exposure (McAinsh et al., 2000; Allen et al., 2001; Webb et al., 2001). This rapid increase in Ca2+ is preceded by an increase in IP3 (Lee et al., 1996) and is dependent on increased PLC activity (Staxen et al., 1999). Accordingly, microinjection of caged IP3 into guard cells has been shown to be sufficient for stomatal closure (Gilroy et al., 1990). Until recently, genetic evidence for IP3 involvement in ABA responses has been lacking. Xiong et al. (2001) demonstrated that a mutation in an inositol polyphosphate 1-phosphatase, fiery1, led to altered ABA-induced gene expression and physiological responses. We examined whether IP3 was necessary for stomatal closure by limiting the amount of second messenger IP3 within the plant cell. To do, this we utilized an Arabidopsis gene, At5PTase1, which we previously characterized as encoding an inositol 5-phosphatase (5PTase) that hydrolyzes IP3 and I(1,3,4,5)P4 (IP4) substrates (Berdy et al., 2001). At5PTase1 is one of 15 At5PTases in Arabidopsis that has the potential to terminate IP3 signaling by hydrolyzing IP3 and related second messengers (Berdy et al., 2001). Work by Sanchez and Chua (2001) indicated that the expression of the At5PTase2 gene under the control of a gluccocorticoid response element altered ABA signaling in germinating seedlings. Our results suggest that a gain-of-function of At5PTase1 inhibits the ability of ABA to induce stomatal closure, indicating that IP3 is required for this physiological event. Further, our results show that levels of endogenous At5PTase1 are increased by ABA application. This evidence suggests that ABA regulates the production of this ABA signal-terminating enzyme.

RESULTS

Characterization of At5PTase1 Ectopic Expression

We previously generated several independent lines of transgenic plants that ectopically express At5PTase1 under control of the cauliflower mosaic virus 35S promoter and verified that these plants contained an increased capacity to hydrolyze IP3 (Berdy et al., 2001). Independent transgenic lines were further investigated with respect to their At5PTase1 protein expression levels and their growth and development. To examine At5PTase1 protein levels, we used an At5PTase1-specific synthetic peptide as an antigen to produce polyclonal antibodies in a rabbit (Sigma Genosys, The Woodlands, TX). The resulting At5PTase1 antisera were shown to cross-react with recombinant At5PTase1 protein expressed in fruitfly (Drosophila melanogaster) S2 cells (data not shown). The At5PTase1 antisera were used in a protein-blot analysis and shown to cross-react with a protein from Arabidopsis leaf tissue of the expected size, 64.9 kD (Fig. 1). This same protein was elevated in several independent At5PTase1 transgenic lines, verifying ectopic expression of the At5PTase1 transgene (Fig. 1). To determine whether ectopic expression of At5PTase1 altered growth or development, we compared all stages of development of transgenic At5PTase1 lines and WT plants. We found that each of the three At5PTase1 transgenic lines grew normally at each phase of development and contained no phenotypic variation except for a slightly decreased time to bolting. No wilting or other stress-related symptoms occurred preferentially on At5PTase1 transgenic plants during growth under standard conditions.

Figure 1.

Figure 1.

Open in a new tab

Protein-blot analysis of transgenic lines expressing the At5PTase1 transgene. Equal amounts of crude protein extract from leaves of wild type (WT) or three independent lines of At5PTase1transgenic plants (1–3) were separated by SDS-PAGE, blotted onto nitrocellulose, and probed with a rabbit antibody specific for At5PTase1 protein as described in “Materials and Methods.” Arrows indicate molecular mass standards.

At5PTase1 Ectopic Expression Alters Stomatal Physiology

Microinjection of IP3 into guard cells has been shown to induce stomatal closure, indicating that IP3 is sufficient for stomatal closure (Gilroy et al., 1990). To determine whether IP3 is necessary for this physiological event, several investigators have decreased IP3 production by inhibiting PLC activity (for review, see Assmann and Wang, 2001; Schroeder et al., 2001b). At5PTase1 transgenic plants offer a specific way to test the necessity of IP3 for stomatal closure in that only inositol phosphate messengers are hydrolyzed by the product of the encoded transgene (Berdy et al., 2001). To test whether At5PTase1 transgenic plants have alterations in stomatal signaling, we measured stomatal closure in both WT and three independent lines of At5PTase1 transgenic plants treated with ABA (Fig. 2). WT stomata closed as expected after exposure to ABA (Fig. 2A). Stomata of At5PTase1 transgenic leaves were less open before ABA exposure and did not close further after ABA exposure (Fig. 2A).

Figure 2.

Figure 2.

Open in a new tab

At5PTase1 transgenic stomata are altered in their responses to ABA and light but not fusicoccin. Leaves from WT and three independent lines of At5PTase1 transgenic plants (1–3) were removed from the plant and incubated in the indicated solutions (see “Materials and Methods”). Epidermal fragments generated by blender treatment were imaged to determine the average stomatal apertures as described in “Materials and Methods.” A, Leaves were incubated in a perfusion solution for 2 h (white bars) and then exposed to 100 μm ABA for 2 h (black bars). B, Leaves were incubated in a perfusion solution for 2 h (white bars) and then exposed to 15 μm fusicoccin for 2 h (black bars). C, Leaves were incubated in 10 mm MES, 50 mm KCl, and 100 μm ABA (pH 7.0) for 2 h in the dark (black bars) and then exposed to light for 2 h (gray bars). Separate leaves were incubated in perfusion solution under constant light for 2 h (white bars). Error bars = se from three independent experiments.

To test whether downstream components in the stomatal response pathway were intact in guard cells of At5PTase1 transgenic leaves, we incubated WT and transgenic leaves with fusicoccin, which activates H+-ATPases and stimulates stomatal opening. Stomata from both WT and At5PTase1 transgenic leaves opened in response to fusicoccin (Fig. 2B), demonstrating that H+-ATPase and inward-rectifying K+ channel activities are not hindered by ectopic At5PTase1 expression. These data suggest that the At5PTase1 transgene product does not interfere with downstream components in the ABA signaling pathway, such as ion channels.

Light is another signal that induces stomatal opening. Another test of ABA sensitivity is whether dark-stimulated stomata that are closed can open in response to light in the presence of ABA. To determine if stomata of At5PTase1 transgenic leaves responded to ABA under these conditions, we incubated WT and At5PTase1 transgenic leaves in a perfusion solution in the dark, then transferred the leaves to light in the presence or absence of ABA (Fig. 2C). As a control, WT stomata were incubated in a perfusion solution and exposed to light. The WT stomata responded to light by opening in the absence of ABA and remaining closed in the light when ABA was present (Fig. 2C). However, the response to light was diminished in stomata of At5PTase1 transgenic leaves that opened only slightly in light in the absence of ABA (Fig. 2C). We conclude that At5PTase1 ectopic expression interferes with both ABA and light signal transduction in stomata.

At5PTase1 Ectopic Expression Alters IP3 Levels

The finding that At5PTase1 ectopic expression alters ABA responses in stomata suggests that changes in second messenger IP3 levels are required for stomatal closure. To examine whether At5PTase1 transgenic plants are deficient in IP3, we focused on a single homozygous At5PTase1 transgenic line (5P-e3) for a thorough analysis. This line contained a single At5PTase1 transgene insertion as measured by DNA gel-blot analyses (data not shown) and increased At5PTase1 mRNA, protein, and enzyme activity levels (Fig. 1; Berdy et al., 2001). To determine if the ABA insensitivity of At5PTase1 transgenic plants was due to altered IP3 levels, we quantified IP3 levels in WT and At5PTase1 transgenic leaves. WT leaf tissue contained 865 ± 158 pmol IP3 g fresh weight-1, whereas in At5PTase1 transgenic plants. basal levels were reduced to 344 ± 7 pmol IP3 g fresh weight-1. This approximately 2.5-fold reduction in basal IP3 levels in the At5PTase1 transgenic leaves is in agreement with the fact that At5PTase1 mRNA and enzyme levels (Berdy et al., 2001), as well as protein levels (Fig. 1), are increased in the At5PTase1 transgenic plants.

Production and action of second messengers occurs quickly during signal transduction. Therefore, we examined changes in IP3 levels within a time scale of seconds after exposure to ABA. To examine rapid changes in IP3, we used whole seedlings, in which tissue could be frozen quickly after exposure to ABA (Sanchez and Chua, 2001). WT and At5PTase1 transgenic seedlings were exposed to ABA or a control solution (data not shown) and quickly frozen (“Materials and Methods”). Within the 1st min of exposure to ABA, IP3 levels transiently increased 2.5-fold above basal IP3 levels in WT seedlings. The basal level of IP3 in At5PTase1 transgenic seedlings was lower than in WT seedlings (Fig. 3A). At5PTase1 transgenic plants exhibited a slight increase in IP3 within 1 min of ABA addition. However, this ABA-stimulated increase in IP3 was lower than basal IP3 levels in WT seedlings.

Figure 3.

Figure 3.

Open in a new tab

Ectopic expression of At5PTase1 suppresses ABA-stimulated IP3 accumulation. Five-day-old WT (white diamonds) and At5PTase1 transgenic seedlings (black squares) were treated with 100 μm ABA and harvested at the indicated times. IP3 was quantified from frozen ground tissue as described in “Materials and Methods.” A, Five-minute time course. B, One hundred-twenty-minute time course. Error bars = mean se from three independent experiments.

ABA addition also stimulated a second increase in IP3 in WT seedlings by 30 min of exposure to ABA (Fig. 3B). IP3 had not returned to the basal levels 2 h after ABA exposure, indicating that this second IP3 increase is sustained longer than the initial peak. At5PTase1 transgenic seedlings were also deficient in the second IP3 increase (Fig. 3B). Although a slight increase in IP3 was apparent 1 h after ABA addition, the ABA-stimulated IP3 level was lower than the WT basal level. We conclude that ABA stimulates two separate increases in IP3 levels that vary in duration in WT seedlings. Ectopic expression of At5PTase1 results in suppression of both IP3 increases, indicating that At5PTase1 acts to suppress ABA-stimulated IP3 accumulation in seedlings.

Ectopic Expression of At5PTase1 Alters Expression of ABA-Regulated Genes

In addition to influencing stomatal aperture, ABA signaling regulates the expression of several genes in a nuclear signaling pathway (Giraudat, 1995). Kin 1 gene expression is up-regulated by ABA, a process requiring Ca2+ (Gilmour et al., 1992). To determine whether there are differences in the expression pattern of a subset of ABA-induced genes in At5PTase1 transgenic plants, we examined the expression of the Kin 1, Kin 2, and COR15a genes in WT and At5PTase1 transgenic plants exposed to ABA by semiquantitative reverse transcriptase (RT)-PCR (Fig. 4). Given the semiquantitative nature of these experiments, we interpreted changes in amplification products as follows: If no band was observed, we concluded that the gene was not expressed; if submaximal levels were observed, we concluded that expression was detectable; if maximal levels (for any particular gene) were observed, we concluded that expression was detectable and higher than in submaximal cases.

Figure 4.

Figure 4.

Open in a new tab

Expression of ABA inducible genes is altered in At5PTase1 transgenic plants. WT (5 d) or At5PTase1 transgenic (Trans) seedlings were treated with ABA and harvested at the indicated times. Total RNA was isolated, and RT-PCR reactions were performed with Kin 1-, COR15a-, Kin 2-, or actin-specific primers as described in “Materials and Methods.” Control (C) indicates seedlings treated with 0.1% (v/v) ethanol for 15 s.

Levels of Kin 1, Kin 2, and COR15a mRNA were either not detectable (Kin 1) or submaximal (COR15a and Kin 2) in both WT and At5PTase1 transgenic seedlings before ABA application. mRNA levels of the Kin 1, Kin 2, and COR15a genes in WT seedlings were up-regulated within 15 min in response to ABA (Fig. 4, WT). These three genes were up-regulated in At5PTase1 transgenic seedlings in response to ABA, but accumulation of mRNA was delayed (Fig. 4, Trans). Specifically, Kin 1 and COR15a accumulation was not maximal in At5PTase1 transgenic seedlings until 1 h after ABA application, and Kin 2 did not reach maximal levels until 30 min after ABA exposure. These experiments were repeated three times. These results indicate that overexpression of At5PTase1 alters the ABA induction of these genes.

At5PTase1 Ectopic Expression Does Not Affect Germination in the Presence of ABA

The data in Figures 2 3 4 suggest that ABA signaling in both the stomatal response and nuclear signaling pathways requires a discreet increase in IP3. Another major physiological action of ABA is inhibition of seed germination. We examined whether ectopic expression of At5PTase1 affected seed germination in the presence of ABA. Seeds from WT and At5PTase1 transgenic plants were germinated at various concentrations of ABA (see “Materials and Methods”). When the concentration of ABA was 5 μm or higher, germination of both WT and At5PTase1 transgenic seed was inhibited (data not shown). Seed from At5PTase1 transgenic plants germinated with the same kinetics as WT seed at 0, 0.1, and 0.25 μm ABA (data not shown). At 2.5 μm ABA, a slight delay in germination was observed with both WT and At5PTase1 transgenic seed (Fig. 5). We detected a slight increase in ABA sensitivity in the At5PTase1 transgenic seed. Thus, there was no evidence for ABA insensitivity in the At5PTase1 transgenic seed at all concentrations of ABA tested. We conclude that in contrast to the effects noted in At5PTase1 stomata, ectopic expression of At5PTase1 does not impart ABA insensitivity during seed germination.

Figure 5.

Figure 5.

Open in a new tab

Germination of At5PTase1 transgenic seed in the presence of ABA. WT seed (black squares) and At5PTase1 transgenic seed (white circles) were germinated with no ABA present. WT seed (black triangles) and At5PTase1 transgenic seed (black circles) were germinated in the presence of 2.5 μm ABA. No differences in germination were observed at 0.1 or 0.25 μm ABA (data not shown), and no germination was observed at concentrations of ABA above 5 μm (data not shown). Error bars = mean ± sd values from three independent experiments during a 6-d period.

Regulation of At5PTase1 Expression by ABA

Whereas a gain-of-function of At5PTase1 is useful to test the contributions of IP3 in signaling, it does not address how the endogenous enzyme is regulated to terminate ABA signaling. The short duration of the first ABA-stimulated IP3 increase indicates that an inositol phosphatase may act quickly to return stimulated IP3 levels to basal levels. To test whether At5PTase1 expression is correlated with IP3 hydrolysis after ABA stimulation, we measured both At5PTase1 mRNA and protein levels during ABA stimulation. We used RT-PCR to observe At5PTase1 mRNA levels. At5PTase1 mRNA expression was not detectable in seedlings before ABA treatment, but was detectable within the first few minutes in response to ABA (Fig. 6A). In multiple experiments, we documented that this initial increase in At5PTase1 mRNA was followed by a subsequent decrease at 15 to 30 min after ABA treatment. At5PTase1 mRNA levels increased again between 1 and 3 h, and diminished to undetectable levels between 6 and 24 h (Fig. 6A). This oscillation in At5PTase1 mRNA levels is reminiscent of second messenger IP3 (Perera et al., 2001) and Ca2+ (Grosse et al., 1993; Bootman et al., 2001) changes that occur during signaling events. The initial increase and decline in At5PTase1 mRNA levels (Fig. 6) correlate with the initial decline and increase in IP3 levels that occur in response to ABA (Fig. 3).

Figure 6.

Figure 6.

Open in a new tab

ABA treatment alters At5PTase1 expression in seedlings. Five- to 7-d-old WT seedlings were treated with 100 μm ABA and harvested at the indicated times. A, Total RNA was harvested and used in RT-PCR experiments with At5PTase1- and actin-specific primers as described in the “Materials and Methods.” -, No template; +, control cDNA template. B and C, Protein extracts were generated, followed by SDS-PAGE and protein gel-blot analysis as described in “Materials and Methods.” Arrows indicate molecular mass standards.

The anti-At5PTase1 antisera were used to observe At5PTase1 protein levels in seedlings exposed to ABA. Seedlings treated with a 0.1% (v/v) ethanol control solution lacking ABA showed no accumulation of At5PTase1 protein over a 24-h time course (Fig. 6C). Seedlings treated with ABA showed an increase in At5PTase1 protein within 30 min of ABA exposure (Fig. 6B). At5PTase1 protein reached maximal levels by 4 h after ABA exposure, and after 24 h At5PTase1 protein was nearly below detectable levels. We conclude that ABA regulates both mRNA and protein levels of At5PTase1 in a specific, transient manner.

DISCUSSION

We have shown previously that the gene product encoded by At5PTase1 hydrolyzes IP3 second messenger (Berdy et al., 2001). Here, we present evidence that ectopic expression of At5PTase1 in Arabidopsis leads to an increase in steady-state levels of At5PTase1 protein and a corresponding decrease in basal IP3 levels in both leaf and seedling tissue. We found that the stomatal response to ABA and induction of ABA-regulated genes in seedlings was altered in At5PTase1 transgenic plants (Figs. 2 and 4, respectively). This finding is significant because the biochemical events that take place within the cell leading to stomatal closure and ABA induction of gene transcription are not fully characterized. Our results strongly implicate IP3 as a second messenger in these events.

IP3 and Stomatal Closure

Previous studies have shown that ABA stimulation of PLC activity is an important step in the stomatal closure pathway (Lee et al., 1996; MacRobbie, 1998; McAinsh et al., 2000). Inhibition of PLC activity reduces both ABA-induced changes in intracellular Ca2+ concentration and stomatal closure (Staxen et al., 1999). Microinjection of IP3 can stimulate stomatal closure (Gilroy et al., 1990). IP3-induced Ca2+ increases in guard cells have also been correlated with stomatal closure (Gilroy et al., 1990). Recent work has shown that an increase in intracellular Ca2+ is observed in guard cells within the first 3 min after ABA addition in Arabidopsis (Webb et al., 2001). If this initial increase in intracellular Ca2+ is dependent on IP3, then it is logical to expect an increase in IP3 to occur at an earlier time.

In conjunction with previous work from other groups using PLC inhibitors (Staxen et al., 1999) and microinjection of IP3 into guard cells (Gilroy et al., 1990), our data utilizing At5PTase1 transgenic leaves strongly suggest that IP3 is required for normal stomatal responses to ABA and light. Stomata from At5PTase1 transgenic leaves do not respond to ABA and appear to maintain a partially closed aperture even under conditions that should promote opening (Fig. 2A). We believe this partially closed phenotype results from alterations in both ABA and light signal transduction pathways because these stomata are also less light responsive (Fig. 2C). Because the At5PTase1 transgenic plants are grown in the light, it might be expected that the impact of altering light signal transduction in the stomata would be greater leading to an overall reduction in the resulting stomatal aperture. This reduction in light responsiveness limited our ability to determine whether stomata from At5PTase1 transgenic plants would open in the light in the presence of added ABA (Fig. 2C). Additional verification that the physiological alterations in stomata of At5PTase1 transgenic leaves result from IP3 signaling instead of structural differences was obtained by testing the response of transgenic stomata to fusicoccin. This fungal toxin stimulated opening of the stomata of At5PTase1 transgenic leaves, indicating that the inward-rectifying K+ channels were normal.

ABA Stimulates Two Distinct Increases in IP3

To examine the effects of At5PTase1 ectopic expression on IP3 levels during ABA signaling, we measured IP3 levels in At5PTase1 transgenic and WT seedlings exposed to ABA. WT seedlings displayed two increases in IP3 after ABA exposure. The first increase in IP3 was transient and occurred within the 1st min after ABA exposure. This is appropriate timing for stimulating documented increases in stomatal intracellular Ca2+ levels (Webb et al., 2001). The second IP3 increase occurred much later (30 min) and the role of this increase in signaling is unclear. Previous work on Vicia faba stomata documented an early IP3 peak occurring 1 min after ABA treatment (Lee et al., 1996). These authors did not investigate whether IP3 changes occurred at later time points after ABA stimulation. Published data from Arabidopsis seedlings documented an IP3 peak occurring 60 min after ABA stimulation (Sanchez and Chua, 2001). These authors did not investigate whether changes in IP3 also occurred within the 1st min. The changes in IP3 levels reported here correspond well with the pattern of IP3 increases seen in maize (Zea mays) and oat (Avena sativa) pulvini stimulated by alterations in gravity (Perera et al., 1999; Perera et al., 2001). In the maize pulvinus, gravity stimulates oscillations of IP3 within seconds and a gradual IP3 increase peaking at 6 h poststimulation. It has been speculated that the initial IP3 oscillations may reflect rapid signaling changes and the gradual increase may reflect long-term stimulation required for growth alterations (Perera et al., 1999).

IP3 Signaling Is Altered in At5PTase1 Transgenic Plants

IP3 signaling alterations in At5PTase1 transgenic plants were documented by comparing the IP3 levels in these plants with those of WT. Surprisingly, WT IP3 levels were higher in mature rosette leaves than in 5-d-old filter-grown seedlings. The At5PTase1 transgenic plants showed a reduction in basal IP3 levels in both leaves and seedlings and ABA-stimulated IP3 levels in seedlings. A small increase in IP3 occurred in the At5PTase1 transgenic seedlings in response to ABA, but this IP3 increase was lower than the basal WT IP3 level (Fig. 3). The stomatal closure and gene expression data indicate that At5PTase1 transgenic plants have an alteration in cellular signaling events that are stimulated by IP3. This conclusion is supported by recent evidence that ectopic expression of the At5PTase2 gene inhibits ABA signaling in germinating seeds and IP3 production in seedlings (Sanchez and Chua, 2001). However, it is important to note the difference between the ability of At5PTase1 and At5PTase2 to impart ABA insensitivity in germinating seeds. Our data indicate that At5PTase1 ectopic expression significantly alters the stomatal response and nuclear signaling pathways associated with ABA (Figs. 2, 3, 4) but does not affect seed germination (Fig. 5). There are several possible explanations for these differences. First, it is possible that At5PTase1 and At5PTase2 function in overlapping (nuclear signaling) and different (stomatal response versus seed germination) pathways. The open reading frames of At5PTase1 and At5PTase2 are 34.4% identical and 54% homologous at the amino acid level, and the conserved catalytic domains are 53% identical. They have similar substrate specificities; both can hydrolyze IP3 and IP4 (Berdy et al., 2001; Sanchez and Chua, 2001). No information on the subcellular locations of these two enzymes has been reported, so they could also function to terminate signaling within different cellular compartments. Another possible explanation for the observed differences could be the difference in the inducible system used to ectopically express At5PTase2 versus constitutive expression of At5PTase1. Dexamethasone induction of At5PTase2 may have allowed for higher levels of At5PTase2 expression that could repress IP3 levels to a greater or different extent. In our system, we consistently found a 2.5- to 3-fold increase in At5PTase1 mRNA and protein levels and a similar decrease in basal IP3 levels. No details on similar measurements were presented for the At5PTase2 transgenic seedlings.

It is known that both At5PTase1 and At5PTase2 can hydrolyze IP4 (Berdy et al., 2001; Sanchez and Chua, 2001). Therefore, it is possible that hydrolysis of IP4 by ectopic expression of these enzymes could also impact ABA signal transduction. In animal cells, it has been shown that IP4 binding to 5PTase serves as a mechanism to potentiate IP3-mediated intracellular Ca2+ release (Hermosura et al., 2000). Therefore, reductions in IP4 in At5PTase transgenic plants are likely to reduce the ability of IP3 to induce Ca2+ release. Thus, an increase in either IP3 or IP4 hydrolysis may have the same net effect on signaling. IP4 can be further phosphorylated, eventually resulting in IP6. Recently, IP6 has been implicated in the control of stomatal closure. It has been shown that ABA stimulates the production of IP6. When IP6 is introduced into stomata, it inhibits the inward-rectifying K+ channel (Lemtiri-Chlieh et al., 2000). We did not measure IP6 levels but suggest that ongoing work to delineate plant phytases, IP6-degrading enzymes, may provide excellent tools to alter putative IP6 second messenger levels.

At5PTase1 Is Regulated by ABA

At5PTase1 mRNA and protein levels were rapidly altered in response to ABA. The timing of the initial increase in At5PTase1 mRNA expression correlated well with the initial decline in IP3 levels after ABA stimulation. Although the At5PTase1 protein expression pattern that results in response to ABA does not exactly mirror the At5PTase1 mRNA expression pattern, both indicate that At5PTase1 accumulation is regulated by ABA addition. It is important to note that in three independent experiments, we documented the oscillatory behavior of both. It is interesting to speculate that changes in At5PTase1 expression may be required for appropriate signal termination. Such oscillations in terminator enzymes might serve to regulate IP3 hydrolysis in response to signaling, resulting in the two discrete increases in IP3 found in this work and by others (Perera et al., 1999, 2001). However, it must be noted that 5PTase function in the plant cell is a combined result of protein expression and enzymatic activity.

In the era of genomics, it is important to consider other gene products that may function in a similar manner to At5PTase1. We have described previously 14 related At5PTases that contain a conserved putative 5PTase catalytic domain (Berdy et al., 2001). The substrate specificity of 13 of these proteins has not yet been characterized. Our results indicate that the expression of several of these other At5PTases is regulated by ABA (R.N. Burnette and G.E. Gillaspy, unpublished data). Understanding the role of each of these genes in ABA signal transduction will require the analysis of substrate specificity of each gene product. The finding that signal terminators are rapidly up-regulated in response to signaling in a manner consistent with the hydrolysis of IP3 suggests that the plant cell regulates these enzymes to ensure that signaling events are properly terminated.

MATERIALS AND METHODS

Plant Growth and Treatment

Arabidopsis ecotype Columbia plants were used for all experiments. Growth conditions of soil-grown WT and At5PTase1 transgenic plants have been described previously (Berdy et al., 2001). For biochemical analyses, either mature rosette leaves or 5-d-old filter-grown seedlings were used. For IP3 measurement, seeds from WT and At5PTase1 transgenic plants were germinated in petri dishes on sterile filter paper, grown for 5 d under constant light, and were floated on a control solution (0.1% [v/v] ethanol) or a 100 μm ABA solution and frozen in liquid nitrogen at the indicated times. For the RT-PCR and protein-blot analyses, seedlings were grown on sterile filter paper under constant light and sprayed with a control solution (0.1% [v/v] ethanol) or a 100 μm ABA solution and frozen in liquid nitrogen at the indicated times. For the germination studies, WT and At5PTase1 transgenic seeds were plated on 0.5× Murashige and Skoog agar plates containing no ABA or 0.1, 0.25, 2.5, 5, 10, 50, or 100 μm ABA. Before plating, WT and transgenic seed of similar ages had been stored at room temperature in the dark for at least 30 d before germination. Each agar plate was divided into two halves, and approximately 100 seeds of WT and At5PTase1 transgenic seeds were plated on each half. Plates with seed were stored in the dark at 4°C. Plates with seed were transferred to 25°C under continuous white light for 14 d. Germination assays were carried out three times. A seed was regarded as germinated when the radicle protruded through the seed coat.

Production of Anti-At5PTase1 Antibody

A hydropathy plot of At5PTase1 was generated using SDSC Biology Workbench (http://workbench.sdsc.edu/). A predicted surface domain peptide sequence specific to At5PTase1 (SDSKREERFSYTERV) was selected for production of a synthetic peptide (Sigma Genosys). The synthetic peptide was injected into a female rabbit, and the antisera were purified by ammonium sulfate precipitation and subtraction over polymerized acrylamide to remove cross-reactive antibodies generated against acrylamide. The antibody was shown to cross-react with recombinant At5PTase1 protein expressed in fruitfly (Drosophila melanogaster) S2 cells (Invitrogen, Carlsbad, CA) and a protein from Arabidopsis plant extracts of the expected size of 64.9 kD.

Protein Gel-Blot Analyses

Crude protein extracts were generated from treated seedlings by grinding 100 mg of tissue in liquid nitrogen. After addition of 50 mm Tris (pH 8.5), 150 mm KCl, 0.5 mm EDTA, and plant protease inhibitor cocktail (Sigma, St. Louis), samples were dounce homogenized and centrifuged at 14,000 rpm at 4°C for 10 min. Proteins in the supernatant were quantified with the Bio-Rad Protein Assay kit (Bio-Rad, Hercules, California), and equal amounts of protein were separated by electrophoresis on 10% (w/v) SDS polyacrylamide gels. Protein was transferred to nitrocellulose membrane using a semidry transfer apparatus (Bio-Rad) for 30 min at 15 V. Equal loading and transfer of proteins were verified by staining the blot in Ponceau S solution (Sigma) for 5 min. The membrane was destained with water and blocked with 5% (w/v) Trans-blot (Bio-Rad) for 30 min and incubated overnight with anti-At5PTase1 antisera in 5% (w/v) Trans-blot, 1× tris buffered saline containing Tween 20 (50 mm Tris [pH 7.5], 0.9% [w/v] NaCl, and 0.01 [v/v] Tween 20) at 4°C. The membrane was washed with 1× tris buffered saline containing Tween 20 and incubated with goat-anti-rabbit secondary antibody HRP conjugate (Bio-Rad). After washing, the membrane was activated with the ECL Plus detection kit (Amersham-Pharmacia Biotech, Piscataway, NJ) according to the manufacturer's protocol. The membrane was exposed to film and developed. Protein-blot experiments were repeated three times.

Stomatal Aperture Determination

Rosette leaves were removed from the plant and floated on the surface of a perfusion solution (10 mm MES and 50 mm KCl [pH 7.0]) for 2 h under constant light. Epidermal fragments were generated by blender treatment (Allen et al., 1999). Separate leaves were transferred from a perfusion solution to a 100 μm ABA solution (0.1% [v/v] ethanol) or a 15 μm fusicoccin solution (0.1% [v/v] ethanol) and incubated under constant light and temperature for 2 h. For inhibition of stomatal opening, rosette leaves were removed from the plant and incubated on the surface of an ABA solution under constant darkness for 2 h. Separate leaves were transferred in the same solution to constant light for 2 h. Other leaves were used as controls and floated on the surface of perfusion solution under constant light and temperature (25°C) for 2 h. Approximately 100 stomata were observed from each sample. All stomata were imaged at 400× magnification with an Axiophot compound microscope (Zeiss, Thornwood, NY) equipped with differential interference contrast optics and photographed with a cooled CCD (Spot) digital camera. Stomatal apertures were measured using a digital ruler in Adobe Photoshop (Adobe Systems, San Jose, CA) and converted to micrometers by comparison with a scaled slide.

IP3 Measurement

Filters containing 5-d-old seedlings were floated on a 100 μm ABA solution or a control 0.1% (v/v) ethanol solution and frozen in liquid nitrogen at the indicated time points. This procedure was developed to ensure that the ABA solution was absorbed by the seedlings quickly and uniformly. This method also facilitated the freezing of the filter-grown seedlings at time intervals of less than 1 min after exposure to ABA. The frozen tissue was scraped from the filter and was ground to a fine powder in liquid nitrogen. After transfer to a preweighed tube containing 500 μL of cold 20% (v/v) perchloric acid, the mixture was incubated on ice for 20 min. The precipitated protein was removed by centrifugation at 4°C for 15 min at 2,000g. The assay was performed on the neutralized supernatant fraction using an IP3 mass measurement kit (Amersham-Pharmacia Biotech) according to the manufacturer's protocol. Controls for nonspecific binding were included as per the manufacturer's protocol. The IP3 content of each sample was calculated using interpolation from a standard curve. For ABA experiments, IP3 content was expressed as picomoles of IP3 per gram of ground frozen tissue. The mean values from replicates of three independent experiments were determined. WT seedlings treated with 0.1% (v/v) ethanol did not show significant changes in IP3 content during the time course tested (data not shown).

RT-PCR

Total RNA was extracted from 100 mg of frozen tissue using the Qiagen Plant RNeasy Kit (Qiagen, Valencia, CA) according to the manufacturer's specifications. One microgram of RNA was analyzed by two-step RT-PCR utilizing a Qiagen Omniscript RT kit and the manufacturer's instructions. Conditions for At5PTase1, actin (Berdy et al., 2001), Kin1 (Knight et al., 1996), and COR15a (Knight et al., 1999) amplification have been described and generate a 450-, 428-, 342-, and 651-bp product, respectively. For Kin2-specific amplification, Kin2for primer (ATGTCAGAGACCAACAAGAA) and Kin2rev primer (CAACAACAAGTACGATGAGTACGA) were utilized at 30 cycles and annealing temperature of 60°C, resulting in a 312-bp product. Amplification with cDNA and genomic DNA template was used as a control for all PCR primers to verify the sizes of bona fide reaction products from RNA and contaminating genomic DNA. Molecular mass markers were used to determine product sizes. Each RT-PCR experiment was independently repeated three times to verify that the observed changes in expression were reproducible. Digital quantification of gel bands was performed with an Alpha Innotech scanner (Alpha Innotech, San Leandro, CA); this allowed for comparison of results from individual experiments.

Acknowledgments

The authors thank John McDowell and John Hess for critical review of this manuscript.

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.102.019000.

1

This work was supported by the Jeffress Memorial Trust (award to G.E.G.), by the U.S. Department of Agriculture (grant no. 2001–35318–10124 to G.E.G.), and by the Hatch project (no. VA–135583).

References

  1. Allen GJ, Chu SP, Harrington CL, Schumacher K, Hoffmann T, Tang YY, Grill E, Schroeder JI (2001) A defined range of guard cell calcium oscillation parameters encodes stomatal movements. Nature 411: 1053-1057 [DOI] [PubMed] [Google Scholar]
  2. Allen GJ, Kuchitsu K, Chu SP, Murata Y, Schroeder JI (1999) Arabidopsis abi1-1 and abi2-1 phosphatase mutations reduce abscisic acid-induced cytoplasmic calcium rises in guard cells. Plant Cell 11: 1785-1798 [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Assmann SM, Wang XQ (2001) From milliseconds to millions of years: guard cells and environmental responses. Curr Opin Plant Biol 4: 421-428 [DOI] [PubMed] [Google Scholar]
  4. Berdy S, Kudla J, Gruissem W, Gillaspy G (2001) Molecular characterization of At5PTase1, an inositol phosphatase capable of terminating IP3 signaling. Plant Physiol 126: 801-810 [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Berridge MJ (1993) Inositol trisphosphate and calcium signaling. Nature 361: 315-325 [DOI] [PubMed] [Google Scholar]
  6. Blatt MR, Thiel G, Trentham DR (1990) Reversible inactivation of K+ channels of Vicia stomatal guard cells following the photolysis of caged inositol 1,4,5-trisphosphate. Nature 346: 766-769 [DOI] [PubMed] [Google Scholar]
  7. Bootman MD, Collins TJ, Peppiatt CM, Prothero LS, MacKenzie L, De Smet P, Travers M, Tovey SC, Seo JT, Berridge MJ et al. (2001) Calcium signalling: an overview. Semin Cell Dev Biol 12: 3-10 [DOI] [PubMed] [Google Scholar]
  8. Gilmour SJ, Artus NN, Thomashow MF (1992) cDNA sequence analysis and expression of two cold-regulated genes of Arabidopsis thaliana. Plant Mol Biol 18: 13-21 [DOI] [PubMed] [Google Scholar]
  9. Gilroy S, Read ND, Trewavas AJ (1990) Elevation of cytoplasmic calcium by caged calcium or caged inositol triphosphate initiates stomatal closure. Nature 346: 769-771 [DOI] [PubMed] [Google Scholar]
  10. Giraudat J (1995) Abscisic acid signaling. Curr Opin Cell Biol 7: 232-238 [DOI] [PubMed] [Google Scholar]
  11. Grosse B, Bourdeau A, Lieberherr M (1993) Oscillations in inositol 1,4,5-trisphosphate and diacyglycerol induced by vitamin D3 metabolites in confluent mouse osteoblasts. J Bone Miner Res 8: 1059-1069 [DOI] [PubMed] [Google Scholar]
  12. Hermosura MC, Takeuchi H, Fleig A, Riley AM, Potter BV, Hirata M, Penner R (2000) InsP4 facilitates store-operated calcium influx by inhibition of InsP3 5-phosphatase. Nature 408: 735-740 [DOI] [PubMed] [Google Scholar]
  13. Knight H, Trewavas AJ, Knight MR (1996) Cold calcium signaling in Arabidopsis involves two cellular pools and a change in calcium signature after acclimation. Plant Cell 8: 489-503 [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Knight H, Veale EL, Warren GJ, Knight MR (1999) The sfr6 mutation in Arabidopsis suppresses low-temperature induction of genes dependent on the CRT/DRE sequence motif. Plant Cell 11: 875-886 [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Lee YL, Coi YB, Suh S, Lee JD, Assmann SM, Joe CO, Kelleher JF, Crain RC (1996) Abscisic acid-induced phosphoinositide turnover in guard cell protoplasts of Vicia faba. Plant Physiol 110: 987-996 [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Lemtiri-Chlieh F, MacRobbie EA (1994) Role of calcium in the modulation of Vicia guard cell potassium channels by abscisic acid: a patch-clamp study. J Membr Biol 137: 99-107 [DOI] [PubMed] [Google Scholar]
  17. Lemtiri-Chlieh F, MacRobbie EA, Brearley CA (2000) Inositol hexakisphosphate is a physiological signal regulating the K+-inward rectifying conductance in guard cells. Proc Natl Acad Sci USA 97: 8687-8692 [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. MacRobbie EA (1998) Signal transduction and ion channels in guard cells. Philos Trans R Soc Lond B Biol Sci 353: 1475-1488 [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. McAinsh MR, Gray JE, Hetherington AM, Leckie CP, Ng C (2000) Ca2+ signalling in stomatal guard cells. Biochem Soc Trans 28: 476-481 [PubMed] [Google Scholar]
  20. Perera IY, Heilmann I, Boss WF (1999) Transient and sustained increases in inositol 1,4,5-trisphosphate precede the differential growth response in gravistimulated maize pulvini. Proc Natl Acad Sci USA 96: 5838-5843 [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Perera IY, Heilmann I, Chang SC, Boss WF, Kaufman PB (2001) A role for inositol 1,4,5-trisphosphate in gravitropic signaling and the retention of cold-perceived gravistimulation of oat shoot pulvini. Plant Physiol 125: 1499-1507 [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Sanchez JP, Chua NH (2001) Arabidopsis plc1 is required for secondary responses to abscisic acid signals. Plant Cell 13: 1143-1154 [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Schroeder JI, Allen GJ, Hugouvieux V, Kwak JM, Waner D (2001a) Guard cell signal transduction. Annu Rev Plant Physiol Plant Mol Biol 52: 627-658 [DOI] [PubMed] [Google Scholar]
  24. Schroeder JI, Kwak JM, Allen GJ (2001b) Guard cell abscisic acid signalling and engineering drought hardiness in plants. Nature 410: 327-330 [DOI] [PubMed] [Google Scholar]
  25. Shacklock PS, Read ND, Trewavas AJ (1992) Cytosolic free calcium mediated red light-induced photomorphogenesis. Nature 358: 753-755 [Google Scholar]
  26. Staxen II, Pical C, Montgomery LT, Gray JE, Hetherington AM, McAinsh MR (1999) Abscisic acid induces oscillations in guard-cell cytosolic free calcium that involve phosphoinositide-specific phospholipase C. Proc Natl Acad Sci USA 96: 1779-1784 [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Stevenson JM, Perera IY, Heilmann I, Persson S, Boss WF (2000) Inositol signaling and plant growth. Trends Plant Sci 5: 357. [DOI] [PubMed] [Google Scholar]
  28. Taylor CW, Thorn P (2001) Calcium signalling: IP3 rises again... and again. Curr Biol 11: R352-355 [DOI] [PubMed] [Google Scholar]
  29. Webb AA, Larman MG, Montgomery LT, Taylor JE, Hetherington AM (2001) The role of calcium in ABA-induced gene expression and stomatal movements. Plant J 26: 351-362 [DOI] [PubMed] [Google Scholar]
  30. Wu Y, Kuzma J, Marechal E, Graeff R, Lee HC, Foster R, Chua NH (1997) Abscisic acid signaling through cyclic ADP-ribose in plants. Science 278: 2126-2130 [DOI] [PubMed] [Google Scholar]
  31. Xiong L, Lee B, Ishitani M, Lee H, Zhang C, Zhu JK (2001) FIERY1 encoding an inositol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress signaling in Arabidopsis. Genes Dev 15: 1971-1984. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Plant Physiology are provided here courtesy of Oxford University Press

RESOURCES