Abstract
Volume 61, no. 4, p. 1445, column 2, line 38: The sequence "5(prm1) AGCTACGTTACCAGCCAAGCC 3(prm1)" should read "5(prm1) AGCTACGTTACCAGCCC 3(prm1)."
Full Text
The Full Text of this article is available as a PDF (113.1 KB).
. 1995 Jul;61(7):2811. doi: 10.1128/aem.61.7.2811-2811c.1995
Detection of ammonium-oxidizing bacteria of the beta-subclass of the class Proteobacteria in aquatic samples with the PCR.
M A Voytek
1, B B Ward
1
M A Voytek
1Marine Sciences Program, University of California, Santa Cruz 95064, USA.
Find articles by M A Voytek
B B Ward
1Marine Sciences Program, University of California, Santa Cruz 95064, USA.
Find articles by B B Ward
1Marine Sciences Program, University of California, Santa Cruz 95064, USA.
PMCID: PMC167558 PMID: 7618898
This corrects the article "Detection of ammonium-oxidizing bacteria of the beta-subclass of the class Proteobacteria in aquatic samples with the PCR." on page 1444.