Skip to main content
PMC home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 1996 Jul;62(7):2673–2675. doi: 10.1128/aem.62.7.2673-2675.1996

Identification of Vibrio proteolyticus with a differential medium and a specific probe.

M Muniesa-Pérez 1, J Jofre 1, A R Blanch 1
PMCID: PMC168050  PMID: 8779607

Abstract

A differential medium (VP8) and a specific probe, based on the variable region V3 of the 16S rRNA gene, for the detection of Vibrio proteolyticus are defined. The medium contains 8% NaCl, which allows selective growth of moderately halophilic Vibrio strains. D-Sorbitol, as the main carbon source, differentiates the species that can ferment it by the pH indicators cresol red and bromothymol blue. V. proteolyticus and 8 of 418 strains studied grew on the medium and used the D-sorbitol, forming bright yellow colonies. An oligonucleotide, based on the variable region V3 of the 16S rRNA gene (5'CGCTAACGTCAAATAATGCATCTA3'), was used as the specific probe (V3VPR). Only three strains of Vibrio sp. and one strain identified as V. natriegens cross-hybridized with the probe. However, unlike V. proteolyticus, none of the strains grew on VP8. The combined use of VP8 medium and the probe allowed an unequivocal identification of V. proteolyticus.

Full Text

The Full Text of this article is available as a PDF (203.3 KB).

Selected References

These references are in PubMed. This may not be the complete list of references from this article.

  1. Alsina M., Blanch A. R. A set of keys for biochemical identification of environmental Vibrio species. J Appl Bacteriol. 1994 Jan;76(1):79–85. doi: 10.1111/j.1365-2672.1994.tb04419.x. [DOI] [PubMed] [Google Scholar]
  2. Alsina M., Martínez-Picado J., Jofre J., Blanch A. R. A medium for presumptive identification of Vibrio anguillarum. Appl Environ Microbiol. 1994 May;60(5):1681–1683. doi: 10.1128/aem.60.5.1681-1683.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Brosius J., Palmer M. L., Kennedy P. J., Noller H. F. Complete nucleotide sequence of a 16S ribosomal RNA gene from Escherichia coli. Proc Natl Acad Sci U S A. 1978 Oct;75(10):4801–4805. doi: 10.1073/pnas.75.10.4801. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bryant T. N., Lee J. V., West P. A., Colwell R. R. Numerical classification of species of Vibrio and related genera. J Appl Bacteriol. 1986 Nov;61(5):437–467. doi: 10.1111/j.1365-2672.1986.tb04308.x. [DOI] [PubMed] [Google Scholar]
  5. David V. A., Deutch A. H., Sloma A., Pawlyk D., Ally A., Durham D. R. Cloning, sequencing and expression of the gene encoding the extracellular neutral protease, vibriolysin, of Vibrio proteolyticus. Gene. 1992 Mar 1;112(1):107–112. doi: 10.1016/0378-1119(92)90310-l. [DOI] [PubMed] [Google Scholar]
  6. Devereux J., Haeberli P., Smithies O. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 1984 Jan 11;12(1 Pt 1):387–395. doi: 10.1093/nar/12.1part1.387. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Kourany M. Medium for isolation and differentiation of Vibrio parahaemolyticus and Vibrio alginolyticus. Appl Environ Microbiol. 1983 Jan;45(1):310–312. doi: 10.1128/aem.45.1.310-312.1983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Martínez-Picado J., Blanch A. R., Jofre J. Rapid detection and identification of Vibrio anguillarum by using a specific oligonucleotide probe complementary to 16S rRNA. Appl Environ Microbiol. 1994 Feb;60(2):732–737. doi: 10.1128/aem.60.2.732-737.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Needleman S. B., Wunsch C. D. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol. 1970 Mar;48(3):443–453. doi: 10.1016/0022-2836(70)90057-4. [DOI] [PubMed] [Google Scholar]
  10. Shimada T., Sakazaki R., Fujimura S., Niwano K., Mishina M., Takizawa K. A new selective, differential agar medium for isolation of Vibrio cholerae O1: PMT (polymyxin-mannose-tellurite) agar. Jpn J Med Sci Biol. 1990 Apr;43(2):37–41. doi: 10.7883/yoken1952.43.37. [DOI] [PubMed] [Google Scholar]
  11. Van Heeke G., Denslow S., Watkins J. R., Wilson K. J., Wagner F. W. Cloning and nucleotide sequence of the Vibrio proteolyticus aminopeptidase gene. Biochim Biophys Acta. 1992 Jul 15;1131(3):337–340. doi: 10.1016/0167-4781(92)90037-z. [DOI] [PubMed] [Google Scholar]
  12. Wright A. C., Miceli G. A., Landry W. L., Christy J. B., Watkins W. D., Morris J. G., Jr Rapid identification of Vibrio vulnificus on nonselective media with an alkaline phosphatase-labeled oligonucleotide probe. Appl Environ Microbiol. 1993 Feb;59(2):541–546. doi: 10.1128/aem.59.2.541-546.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Yoh M., Miyagi K., Matsumoto Y., Hayashi K., Takarada Y., Yamamoto K., Honda T. Development of an enzyme-labeled oligonucleotide probe for the cholera toxin gene. J Clin Microbiol. 1993 May;31(5):1312–1314. doi: 10.1128/jcm.31.5.1312-1314.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES