A New Evolutionary Variant of the Streptogramin A Resistance Protein, Vga(A)_LC, from Staphylococcus haemolyticus with Shifted Substrate Specificity towards Lincosamides

Abstract

We found a new variant of the streptogramin A resistance gene, vga(A)_LC, in clinical isolates of Staphylococcus haemolyticus resistant to lincomycin and clindamycin but susceptible to erythromycin and in which no relevant lincosamide resistance gene was detected. The gene vga(A)_LC, differing from the gene vga(A) at the protein level by seven amino acid substitutions, was present exclusively in S. haemolyticus strains resistant to both lincosamides and streptogramin A (LS_A phenotype). Antibiotic resistance profiles of the ATP-binding cassette (ABC) proteins Vga(A)_LC and Vga(A) in the antibiotic-susceptible host S. aureus RN4220 were compared. It was shown that Vga(A)_LC conferred resistance to both lincosamides and streptogramin A, while Vga(A) conferred significant resistance to streptogramin A only. Detailed analysis of the seven amino acid substitutions, distinguishing the two related ABC proteins with different substrate specificities, identified the substrate-recognizing site: four clustered substitutions (L212S, G219V, A220T, and G226S) in the spacer between the two ATP-binding cassettes altered the substrate specificity and constituted the lincosamide-streptogramin A resistance phenotype. A transport experiment with radiolabeled lincomycin demonstrated that the mechanism of lincosamide resistance in S. haemolyticus was identical to that of the reported macrolide-streptogramin B resistance conferred by Msr(A).

Bacterial resistance to antimicrobial agents generally involves target site modification, drug inactivation, impermeability, or an efflux mechanism. Resistance to lincosamide antibiotics (lincomycin [LIN] and clindamycin [CLI]) is generally associated with resistance to macrolides and streptogramin B. Erythromycin ribosome methylase (erm) genes encode proteins which methylate adenine residue A2058 in the peptidyltransferase region of 23S rRNA domain V, preventing the binding of the antibiotic to the ribosome target site (40). Antibiotic target site modification may also occur by mutations in domain V or II of 23S rRNA (27, 38, 40).

Specific resistance only to lincosamides is due to enzymatic inactivation of the antibiotic. Genes lnu(A) and lnu(A′) (formerly lin), encoding lincosamide O-nucleotidyltransferase, have been described for Staphylococcus haemolyticus and Staphylococcus aureus, respectively (9, 10). Another five variants of lincomycin nucleotidyltransferases inactivating lincosamides by adenylation have been reported for gram-positive (1, 8) and gram-negative (18, 39) microorganisms. With the exception of the gene lnu(F), conferring cross-resistance to lincomycin and clindamycin in Escherichia coli, the lnu genes confer resistance only to lincomycin, although their protein products modify and inactivate both lincomycin and clindamycin (1, 21).

Proteins belonging to either the major facilitator or the ATP-binding cassette (ABC) family can mediate the active efflux of lincosamides. A member of the major facilitator family, Lmr(A), confers resistance to lincomycin in the lincomycin producer Streptomyces lincolnensis (43). The lmr(A) gene is part of the chromosomal lincomycin production gene cluster, as is the other lincosamide resistance gene, lmr(C), which belongs to the ABC transporter family (26). Other members of this family have been reported for clinical isolates. The lsa(A) gene is responsible for the characteristic intrinsic resistance to lincosamides and streptogramin A (LS_A resistance phenotype) in Enterococcus faecalis (15, 35). A related determinant, lsa(B), has been observed on a plasmid in Staphylococcus sciuri. The protein Lsa(B) is 41% identical and 69% similar to Lsa(A) and confers resistance to clindamycin; the potential resistance to streptogramin A was not tested (19). The vga genes have been characterized as determinants of streptogramin A resistance. Nevertheless, a study by Chesneau et al. (13) has recently confirmed the ability of vga(A) and vga(A)_V (83.2% nucleotide identity) to confer low-level lincomycin resistance in S. aureus and Staphylococcus epidermidis, and it has been suggested that the LS_A phenotype occasionally found in staphylococcal isolates may be due to these elements. Another vga gene, vga(B), has 59% nucleotide identity with vga(A) and confers only low-level resistance to streptogramin A but substantially increases the level of resistance to pristinamycin, a mixture of streptogramin A and streptogramin B (4, 13). A new determinant, vmlR, conferring inducible virginamycin M (streptogramin A) and lincomycin resistance has been found in Bacillus subtilis (24). The predicted amino acid sequence of VmlR has 32%, 33%, and 29% amino acid identity to Vga(B), Vga(A), and Lmr(C), respectively. All of the mentioned ABC proteins, i.e., Lmr(C) Lsa, Lsa(B), Vga(A), Vga(A)v, Vga(B), and Vml(R), together with Msr(A), Msr(C), and Orf5, have been classified as class 2 ABC transporters (14). Proteins of this subfamily have duplicated ATP-binding domains and lack any obvious membrane-spanning domain, raising questions about their ability to function as drug exporters (14, 20, 30).

In a previous study, we screened methicillin-resistant coagulase-negative staphylococci from the Czech Republic for the presence of macrolide and/or lincosamide resistance and subsequently for some of the respective resistance genes, erm(A), erm(C), msr(A), and lnu(A) (23). We noted that 10 genetically related Staphylococcus haemolyticus isolates, resistant to lincomycin and clindamycin (LC) but susceptible to erythromycin, failed to hybridize to any of the above-mentioned resistance gene probes. In this study, we tested the possible mechanisms of lincosamide resistance in these strains. Consequently, we isolated and characterized a new variant of the streptogramin A resistance gene, vga(A)_LC, encoding an ABC transporter with shifted substrate specificity in favor of lincosamides. In addition, a region determining the substrate specificity of Vga(A) and Vga(A)_LC has been localized in the interdomain sections of the proteins.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

All Staphylococcus haemolyticus strains used in the study were methicillin-resistant clinical isolates collected in 1996 in the Czech Republic as described previously (23). Escherichia coli strains JM109 (42) and GM2929 (25) were used as hosts for genetic manipulations and for purification of unmethylated plasmids, respectively. Staphylococcus aureus RN4220 (Network on Antimicrobial Resistance in S. aureus; Focus Bio-Inova), susceptible to lincosamides and streptogramins, was used as a recipient strain in electroporation experiments. The DNA of S. aureus strain BM3093 carrying plasmid pIP680 (3) was used as a template for amplification of vga(A). Staphylococci were usually grown in Mueller-Hinton broth (Difco Laboratories, Detroit, MI) and on NYE agar plates (6). E. coli strains were propagated in Luria broth or agar and in SOC medium (20 g of Bacto tryptone, 5 g of yeast extract, 10 ml of 1 M NaCl, 0.25 ml of 1 M KCl, 10 ml of 1 M MgSO₄, 10 ml of 1 M MgCl₂, 10 ml of 2 M glucose, pH 7.0).

Antibiotic susceptibility testing.

Lincomycin and clindamycin were purchased from Sigma-Aldrich (St. Louis, Mo.). Separate compounds of streptogramins pristinamycin IIA (PIIA) and pristinamycin IA (PIA) and their combination (PRI) were kindly provided by Aventis Pharma (Vitry-sur-Seine, France). MICs of antibiotics were determined by the agar dilution method (37) after 24 h of incubation at 37°C. A 10-μl inoculum of a 0.5 McFarland suspension was spotted on Mueller-Hinton agar with a twofold dilution series of the antibiotics at the following concentrations: LIN, 0.125 to 256 μg/ml; P, PIA, and PIIA, 0.125 to 64 μg/ml; and CLI, 0.125 to 16 μg/ml. For recombinant strains, the MICs were determined three times in parallel after 48 h of incubation.

Lincosamide inactivation.

Lincomycin inactivation by resting cells was determined in a liquid medium as described previously, with modifications (21, 28). Cells were resuspended in 0.01 M phosphate buffer (pH 7.0) to an absorbance of 2 at 600 nm. Aliquots (50, 25, 10, 5, and 1 ml) of the cell suspension were centrifuged and resuspended in 1 ml of 0.01 M phosphate buffer containing 80 μg/ml lincomycin. After a 24-h incubation at 37°C, 20 μl of the mixture was spotted onto a paper disc, and inactivation was determined by the Gots test (16) with Kocuria rhizophila CCM552 as the indicator organism.

DNA manipulations.

Total DNA was isolated from staphylococcal strains as described previously (23). E. coli plasmids, DNA fragments, and PCR products were purified using the Wizard Plus Midipreps DNA purification system and Wizard SV gel and PCR Clean-Up system (Promega, Madison, WI). The PCR primers (Sigma-Genosys, Steinhein, Germany) used in the study are listed in Table 1. Cycle conditions varied according to the empirical melting temperature of the primers and expected length of the product. Amplifications with the degenerate primers, used to search for the determinant of resistance to both lincomycin and clindamycin but susceptibility to erythromycin (LC resistance), were done in triplicate at different annealing temperatures (48, 52, and 58°C) in a T-gradient cycler (Biometra, Göttingen, Germany). All PCR products were sequenced directly, after separation by agarose gel electrophoresis and extraction from the gel. Control sequencing of cloned vga(A), vga(A)_LC, and their hybrids was carried out with the primers listed in Table 1. Labeling of probes and hybridization experiments were performed as described previously (23).

TABLE 1.

Oligonucleotides used as primers in PCR and hybridization experiments and for DNA sequencing

Primer	Nucleotide sequence (5′ to 3′)a	Target DNA or protein motifb	Purpose
23SIIF	CGTGCCTTTTGTAGAATG	Domain II of 23S rRNA	23S rRNA gene sequencing
23SIIR	GCATTCTCACTTCTAAGC
23SVF	TACCTGTGAAGATGCAG	Domain V of 23S rRNA
23SVR	TAGGGACCGAACTGTC
ABC1F	AT(G/T)GATAC(A/T)(A/G)ATTGGAA	DT(N/D)WK	Degenerate primers for
ABC2aF	ATTGG(A/T)CG(A/T)AATGG(A/T)(A/C)G(A/T)GGGAAA	IGRNGRGK	ABC transporter search
ABC2bF	ATTGG(A/T)CG(A/T)AATGG(A/T)CG(A/T)GG	IGRNGRG
ABC3F	GT(A/T)GATTT(T/C)IIITATTT(T/C)CC	VDF(N/V)YFP
ABC4F	ATTGATGAACC(T/A)AC(T/A)AATCA	IDEPTNH
ABC1aR	TGATT(A/T)GT(A/T)GGTTCATCAAT	HNTPEDI
ABC1bR	TGATT(A/T)GT(A/T)GGTTCATC	HNTPED
ABC5F	TA(C/T)TT(A/G)A(A/G)GAAAAAAAAA	YL(R/K)KKK
ABC2R	TTTTTTTTTC(T/C)T(T/C)AA(G/A)TA	KKK(R/K)LY
ABC3R	TTTTCCIIIICC(A/G)TTTTTTCC	KGSGNKG
ABC4aR	GGTTCATCCCAAATATA	PEDWIY
ABC4bR	A(A/G)TT(T/A)A(G/A)(T/A)GGTTCATCCCA	NLPEDW
ABC4cR	A(A/G)TT(T/A)A(G/A)(T/A)GGTTCATC	NLPED
vgaAF	GGTACAGGAAAGACAACG	vga(A)/vga(A)LC	Synthesis of hybridization probes
vgaAR	TCGCTCTCCACCACTTAA
ABCII4F	GGATAGCTGATTATCAACTA	ABCII
ABCII4R	AATCATTGAAGACGCACTAT
ABCIII1aF	AACGATTTCTCCACCTTTA	ABCIII
ABCIII1aR	CTAATTCTGATGATCTTCC
VG1-F	GATTAGGATCCTTTTATTGTCTTC	vga(A)	Cloning of vga genes
vgaLBamF	GATTGGGATCCTTTTATTGTCTTA	vga(A)LC
VG1-R	ATCAAGAATTCAATAAAAAGACAAC	vga(A)/ vga(A)LC
vgaAINVR	TATAATATGTGAAGTAACGTTG	vga(A)/vga(A)LC	Control sequencing
vgaAINVF	CAACAAGGAATATTAAAGAAG
vgaADF	ATGAAAATAWTGTTAGAGG
vgaADR	GAAACTCTTKTTCTAATTC
vgaAKF	GAAAAATATGAAAAAGAAAAGAAAC

^aBoldface indicates the restriction sites used to clone the amplified DNA fragments.

^bProtein motifs, amino acid sequences used for the design of degenerate ABC primers.

Isolation and sequencing of a DNA fragment carrying the vga(A)_LC gene.

The total DNA from S. haemolyticus strain CCM7296 was digested with various restriction enzymes or their combinations and hybridized with a vga(A)-specific probe. A combination of enzymes ClaI and NcoI provided a 5-kb hybridizing fragment. To isolate this vga(A)_LC-containing fragment, digested DNA of the required size range was recovered from the agarose gel, ligated into ClaI/NcoI-digested pBluescript II SK(+) (Stratagene, La. Jolla, CA) containing a modified polylinker with an introduced NcoI site, and transformed into E. coli JM109. The transformants were screened for presence of the vga(A)_LC gene by colony hybridization (performed according to the DIG Application Manual for Filter Hybridization, Roche Molecular Biochemicals, 2000). The full-length vga(A)_LC sequence was determined from the positive clone by using primers listed in Table 1.

Preparation of constructs for Vga(A) and Vga(A)_LC expression.

Amplification and cloning of the genes vga(A) and vga(A)_LC were performed as described previously (13). For amplification of a full-length sequence of vga(A)_LC, forward primer vgaLBamF (Table 1) was used instead of the primer VG1-F. Amplicons were inserted into pBluescript II KS, giving plasmids pJVA and pJVA_LC, respectively. The plasmids were used for construction of protein hybrids by reciprocal exchanges of BamHI/BsaBI fragments encoding the N-terminal parts and/or XbaI fragments encoding the C-terminal parts of Vga(A) and Vga(A)_LC proteins (Table 2). The correctness of all constructs was verified by DNA sequencing of replaced regions. The BamHI/EcoRI fragments encoding full-length proteins were subcloned into the shuttle vector pRB374 (11) and electroporated in to Staphylococcus aureus RN4220 as described previously (34).

TABLE 2.

Susceptibility of S. aureus RN4220 harboring pRB374 constructs with vga(A) or vga(A)_LC sequences or their derivatives

Determination of intracellular accumulation of LIN.

For transport experiments, ³H-radiolabeled lincomycin was prepared enzymatically using LmbJ protein encoding N-demethyllincomycin methyltransferase (unpublished data from our laboratory). Intracellular accumulation of the antibiotic was determined as described previously (22). An overnight culture of S. haemolyticus was cultivated in fresh medium H with 0.25 μg/ml of LIN until log phase (absorbance 0.7 to 0.8 at 600 nm). The culture was immediately diluted in preheated medium H to give an absorbance of 0.5 at 600 nm. Two 27-ml aliquots were incubated in parallel at 37°C, each with [³H]LIN (2.55 μCi). At 10-min intervals, 3-ml volumes of the cell suspension were filtered through a 0.4-μm nitrocellulose membrane filter and washed with 5 ml of HEPES A buffer (containing 50 μg/ml of LIN), and intracellular accumulation of LIN was determined in a liquid scintillation counter. Turbidity of the cells was measured at each sampling time. After 30 min of incubation, 0.1 mM carbonyl cyanide m-chlorophenylhydrazone (CCCP) was added to one of the parallel mixtures.

Nucleotide sequence accession number.

The nucleotide sequence of the vga(A)_LC gene has been submitted to GenBank under accession no. DQ823382.

RESULTS

Characteristics of lincosamide-resistant S. haemolyticus strains.

We recently characterized 10 closely related clones of Staphylococcus haemolyticus resistant to both lincomycin and clindamycin but susceptible to erythromycin (LC resistance phenotype) in which no relevant resistance gene was detected (23). The level of the resistance (the MICs of lincomycin and clindamycin were 32 μg/ml and 8 μg/ml, respectively [Table 3]) indicated the presence of an inactivation or transport mechanism rather than an alteration of the target site, which is usually associated with a high level of resistance (MICs of >512 μg/ml) (40). Alternatively, the clonal spread of the resistance could indicate resistance by single point mutations in the ribosomal binding site.

TABLE 3.

Characteristics of the 15 pristinamycin IIA-resistant S. haemolyticus isolates

Strain	Phenotypea,b	MIC (μg/ml)					Resistance gene(s)a,c
		LIN	CLI	PIIA	PIA	PRI
BM3093		2	0,25	>64	32	4	vga(A), vga(B), vat(A)
CCM7296	LC	32	8	32	8	1	vga(A)LC
140UL	LC	32	8	32	8	1	vga(A)LC
61UL	LC	32	8	32	8	1	vga(A)LC
222OL	LC	32	8	32	8	1	vga(A)LC
29OL	LC	32	8	32	8	1	vga(A)LC
45PL	LC	32	8	32	8	1	vga(A)LC
77KR	LC	32	8	32	8	1	vga(A)LC
1051KR	LC	32	8	32	8	1	vga(A)LC
1102KR	LC	32	8	32	8	1	vga(A)LC
188KR	LC	32	8	32	8	1	vga(A)LC
64BB	ELC	>256	>256	32	>64	8	vga(A)LC, erm(C), msr(A)
71BB	ELC	>256	>256	32	>64	8	vga(A)LC, erm(C), msr(A)
78BB	ELC	>256	4	32	>64	8	vga(A)LC, msr(A), lnu(A)
40OL	ELC	>256	4	32	8	1	vga(A)LC, msr(A), lnu(A)
65OL	ELC	>256		32	8	1	vga(A)LC, erm(C), msr(A)

^aData were acquired as described previously (23).

^bPhenotypes were determined by the triple-disc induction test. LC, constitutively resistant to lincomycin and clindamycin; ELC, constitutively resistant to lincomycin, clindamycin, and erythromycin.

^cResistance genes were detected by hybridization with gene-specific probes, and the vga(A)_LC gene was confirmed by sequencing for all isolates.

Disproving ribosomal mutation and inactivation resistance.

Mutations in domain II or V of 23S rRNA resulting in resistance to macrolide-lincosamide-streptogramin B antibiotics have been reported for a variety of bacterial species (12, 27, 36, 38). To test this eventuality among related S. haemolyticus isolates, domains II and V of the gene for 23S rRNA were amplified by PCR from total genomic DNA of LC-resistant S. haemolyticus CCM7296 and LC-susceptible S. haemolyticus 202BB, respectively. Sequencing of the PCR products did not reveal any differences between these strains, which therefore indicated another mechanism of resistance.

Inactivation was tested on three LC-resistant S. haemolyticus isolates (CCM7296, 61UL, and 1051KR). The lincomycin-resistant strain S. haemolyticus 123PL, in which lincomycin is inactivated due to lnu(A), and S. aureus ATCC 25923 served in the experiment as positive and negative controls, respectively. No inactivation of lincomycin was detected in the three isolates analyzed or in the negative control strain, in contrast to complete antibiotic inactivation in the positive control.

Search for and identification of a new variant of the vga(A) resistance gene.

A set of degenerate PCR primers was designed according to the sequence alignment of resistance proteins Lsa(A), Lsa(B), Lmr(C), Msr(A), Vga(A), and Vga(A)_V of the ABC transporter class 2 family, which were selected for their lincosamide substrate specificity and/or for their origin in staphylococci. The primers were so designed in order to positively discriminate the proteins Lsa(A) and Lsa(B) for their lincosamide substrate specificity (see ABC primers in Table 1). Twenty-four combinations of sense and antisense primers were tested on genomic DNA of LC-resistant S. haemolyticus CCM7296. Amplifications resulted in nine different products, with six of them being identified by sequencing. Two overlapping fragments, A (709 bp) and B1 (652 bp), amplified from the primers ABC2aF-ABC1bR and ABC2bF-ABC1bR, respectively, corresponded to the sequence of the resistance gene vga(A), as well as the 154-bp fragment B2, which was synthesized as a side product of B1. Sequence C (primer pair ABC4F-ABC4bR) was 100% homologous to the sequence encoding the hypothetical ABC transporter SH2642 from S. haemolyticus JCSC1435. Based on Blastx analysis, two sequences, D1 and D2, amplified from the primer pair ABC2aF-ABC1aR, have 92% amino acid identity with a hypothetical protein similar to glycosyltransferase SH0332 and 93% amino acid identity with the GTP-binding elongation factor homolog SH1843 from S. haemolyticus JCSC1435, respectively.

A correlation with the LC phenotype was confirmed by dot blot hybridization only for vga(A)-related sequences: the vga(A)-specific hybridization probe hybridized with the total DNAs of all 10 LC-resistant isolates and simultaneously failed to hybridize with the DNAs of 15 LC-susceptible S. haemolyticus isolates. Conversely, hybridization with probes specific for sequences C and D1 did not show any correlation with the LC phenotype.

Sequencing of part of the 5-kb ClaI/NcoI insert isolated from lincosamide-resistant S. haemolyticus CCM7296 (see Materials and Methods) revealed a 1,569-bp-long open reading frame differing from the published sequence of vga(A) (5) by 10 nucleotide substitutions, and 7 of these resulted in changes at the amino acid level (Table 2). Five of them (L212S, G219V, A220T, G226S, and S247R) are concentrated in a central region between two ATP-binding domains, and two (M4L and N9H) are situated at the extreme N terminus of the protein. The variant of the gene vga(A), suspected to confer resistance to both lincosamides in S. haemolyticus, was named vga(A)_LC.

Upstream (575-bp) and downstream (548-bp) regions surrounding the gene vga(A)_LC were homologous to the plasmid sequences of pIP1629 (98% identity, AF045240) and pIP680 (99% identity, AF117259), respectively, indicating the plasmid location of the gene.

Resistance to streptogramins in strains with vga(A)_LC.

The genes vga have been characterized as determinants of streptogramin A resistance. Consequently, susceptibilities to pristinamycin IIA (streptogramin A), pristinamycin IA (streptogramin B), and pristinamycin (mixture of streptogramins A and B) were tested in all 58 clinical isolates of S. haemolyticus described in a previous study. In addition to 10 strains with the LC phenotype and harboring vga(A)_LC, another 5 isolates were found to be resistant to PIIA. These five strains were also resistant to both lincosamides, but the LC phenotype was masked by the presence of additional resistance genes (Table 3). The gene vga(A)_LC was confirmed by PCR and by sequencing in all 15 isolates simultaneously resistant to lincosamides and streptogramin A. As summarized in Table 3, if the gene vga(A)_LC was present alone, MICs of LIN and CLI were 32 μg/ml and 8 μg/ml, respectively, whereas the additional presence of the resistance gene lnu(A) or erm(C) increased the MIC of lincomycin and possibly that of clindamycin. Resistance to PRI (MIC = 8 μg/ml), detected in three strains, was caused by the presence of the resistance gene vga(A)_LC conferring resistance to PIIA, together with the gene erm(C) or msr(A) conferring resistance to PIA (MIC = 64 μg/ml).

Heterologous expression and analysis of the resistance gene vga(A)_LC.

To decide whether the gene vga(A)_LC is able to confer resistance to lincosamides more efficiently than vga(A), both genes were introduced into antibiotic-susceptible S. aureus RN4220 (Table 2). The MICs of lincosamides for S. aureus RN4220 harboring vga(A) increased from 1 to 2 μg/ml for LIN and from 0.125 to 0.25 μg/ml for CLI (twofold). However, the gene vga(A)_LC increased the MIC of LIN from 1 to 8 μg/ml (8-fold) and that of CLI from 0.125 to 2 μg/ml (16-fold). In contrast, resistance to PIIA was higher in the transformants harboring vga(A) (16-fold increase of MIC, from 2 to 32 μg/ml) than it was in S. aureus RN4220 with the gene vga(A)_LC (4-fold increase of MIC, from 2 to 8 μg/ml). To distinguish precisely which of the seven amino acid substitutions was responsible for the alteration of the phenotype, a set of protein hybrids of Vga(A) and Vga(A)_LC was constructed. Three appropriate DNA fragments (encoding the N-terminal part with two amino acid substitutions [M4L and N9H], the central part with four amino acid substitutions [L212S, G219V, A220T, and G226S], and the C-terminal part with one substitution [S247R]) were combined (Table 2), and the plasmid constructs were transformed into S. aureus RN4220. Whereas derivatives with four central amino acid residues (L212, G219, A220, and G226) corresponding to Vga(A) conferred significant resistance only to pristinamycin IIA, all derivatives with the central part corresponding to Vga(A)_LC (amino acid residues S212, V219, T220, and S226) conferred moderate resistance to both lincosamides and pristinamycin IIA (Table 2). Interestingly, the Vga(A)_LC-derived hybrids Vga(A)_LCba and Vga(A)_LCbaxa, with N-terminal amino acid residues corresponding to Vga(A) (M4 and N9), conferred resistance to lincosamides and streptogramin A even more effectively than wild-type Vga(A)_LC when expressed in a heterologous host.

The biochemical properties of Vga(A)_LC in its original host were studied. The uptake of [³H]LIN in S. haemolyticus harboring vga(A)_LC was compared with that in LC-susceptible S. haemolyticus 74OV (Fig. 1). The results showed that (i) the lincosamide-susceptible strain accumulated about a twofold-higher level of the drug than did the resistant strain and (ii) in the resistant strain, the addition of 1 mM CCCP increased the accumulation to the level in the susceptible strain.

FIG. 1.

Accumulation of [³H]LIN in lincosamide-susceptible S. haemolyticus 74OV without vga(A)LC (A) and in lincosamide-resistant S. haemolyticus CCM552 with vga(A)_LC (B). Symbols: •, accumulated LIN without addition of CCCP; ○, accumulated LIN with addition of CCCP. The arrows indicate addition of CCCP after 30 min of incubation.

DISCUSSION

Cross-resistance to both of the analyzed lincosamides, lincomycin and clindamycin, in macrolide-susceptible staphylococcal strains is rare. However, 10 clinical isolates of Staphylococcus haemolyticus in the Czech Republic that are resistant to lincomycin and clindamycin but susceptible to erythromycin have been recently reported (23). This phenotype cannot be simply explained by the presence of any of the resistance mechanisms previously described for staphylococci or even by some combination of them. Moreover, resistance to both lincosamides was combined with a resistance to pristinamycin IIA, defining the LS_A phenotype. This phenotype corresponds to that conferred by the lsa gene in Enterococcus faecalis. A similar phenotype is also found occasionally in staphylococci harboring either the vga(A), vga(A)_V, or vga(B) gene alone, but the strains are usually clindamycin susceptible (2, 7, 17).

Since we had disproved that the resistance involved a mutation in the target site or inactivation of lincosamides, this pointed to the presence of some efflux mechanism in these S. haemolyticus isolates. Subsequently, we identified a new variant of the Vga(A) protein, in spite of the degenerate primers being designed to prefer the Lsa protein group for their apparent lincosamide substrate specificity. The new variant, Vga(A)_LC, differing from the Vga(A) in seven amino acid substitutions, was present exclusively in lincomycin-resistant (MIC = ≥32 μg/ml), clindamycin-resistant (MIC = ≥4 μg/ml), and pristinamycin IIA-resistant (MIC = 32 μg/ml) S. haemolyticus isolates. This strong correlation of the LS_A phenotype with the presence of the gene vga(A)_LC suggested that the gene conferred resistance to both lincosamides.

Accordingly, we proved that the gene vga(A)_LC from S. haemolyticus CCM7296 increased the level of resistance to both lincosamides when introduced into antibiotic-susceptible S. aureus RN4220. Nevertheless, the resistance did not reach the levels found in the original host. Despite this, we propose that vga(A)_LC is responsible for the significant resistance to both lincosamides and streptogramin A in LC-resistant S. haemolyticus strains. It has been previously described that the level of resistance conferred by this type of ABC transporter depends on the host organism. Chesneau et al. (13) have reported a fourfold increase of MICs of LIN and a twofold increase of MICs of CLI in S. aureus RN4220 but an eightfold increase for both lincosamides in S. epidermidis BM3302 after vga(A) transformation. On the other hand, MICs of PIIA due to vga(A) were identical (MIC = 32 μg/ml) for both S. aureus RN4220 and S. epidermidis BM3302. Host-dependent expressions of resistance have also been reported in other studies on class 2 ABC transporters (13, 29, 33), and the level of resistance could depend on different expression in the heterologous host or on inadequate interaction with a putative partner encoded by the host chromosome (13). As mentioned above, class 2 ABC proteins contain two ATP-binding domains but lack an identifiable transmembrane domain. The two ABC domains are separated by an interdomain section, which tends to be rich in glutamine and other hydrophilic amino acids, with a characteristic periodic spacing of hydrophobic residues (41). The so called “Q linker” was found in Msr(A), Msr(C), and Vga(B), but it is not typical for Vga(A) proteins, where the proportion of glutamine in the inter-ATP-binding domain region is similar to that found in the rest of the protein (5). Experiments investigating the function of the ABC domains indicated an essential structural or functional role of the interdomain region (13, 31). In the present study, we demonstrated the importance of this spacer for antibiotic recognition: four amino acid residues concentrated into a mere 15-amino-acid region are crucial for determining the phenotype, i.e., for determining substrate specificity (Table 2). Moreover, the hybrid proteins Vga(A)_LCba and Vga(A)_LCbaxa were even more effective than the wild-type Vga(A)_LC. One of the explanations for this is that these two residues situated at the N terminus of the first ABC domain allow for a better adaptation of Vga(A)_LC to the heterologous S. aureus environment, probably by improving the interaction with a putative transmembrane partner.

Chesneau et al. (13) have found that the Vga(A) protein was colocalized with the β subunit of the F₁F₀ ATPase in the membrane fractions of staphylococcal cells. In the same work, resistance patterns and localization of truncated versions of Vga(A) and its chimeras with Msr(A) protein were studied. None of the studied plasmid constructs promoted the resistance; nevertheless, chimeras of Vga(A) and Msr(A) were found in the membrane fraction. This indicates that ABC domains could mediate an interaction with the membrane, or a membrane-located partner, independent of the integrity of the interdomain region that is most probably essential for antibiotic recognition.

In an analogous way to the experiments on Msr(A) (22, 32), we observed a decreased accumulation of [³H]lincomycin in the lincosamide-resistant S. haemolyticus CCM7296 compared to the susceptible strain (Fig. 1). Likewise, the proton conductor CCCP had the same effect as in the case of Msr(A). However, it is still not clear if the “efflux” observed with Msr(A) and Vga(A) is due to the active transport of the drug. Alternatively, it could be just a consequence of the decreased accumulation of the ribosome-associated drug in the cells, caused by a reduced accessibility of the ribosomal target to macrolide-lincosamide-streptogramin B antibiotics (20, 30). Nevertheless, we expect that the mechanism of lincosamide resistance in S. haemolyticus, no matter what that should turn out to be, is identical to that conferred by Msr(A) for erythromycin (22, 32). The consistency of the resistance mechanisms supports the conclusion that LC resistance is conferred solely by Vga(A)_LC in S. haemolyticus.