Skip to main content
Infection and Immunity logoLink to Infection and Immunity
. 2006 Nov;74(11):6154–6162. doi: 10.1128/IAI.00359-06

Identification of a Novel Virulence Determinant with Serum Opacification Activity in Streptococcus suis

Christoph G Baums 1,*, Ute Kaim 2, Marcus Fulde 1, Girish Ramachandran 1, Ralph Goethe 1, Peter Valentin-Weigand 1
PMCID: PMC1695488  PMID: 17057090

Abstract

Streptococcus suis serotype 2 is a porcine and human pathogen with adhesive and invasive properties. In other streptococci, large surface-associated proteins (>100 kDa) of the MSCRAMM family (microbial surface components recognizing adhesive matrix molecules) are key players in interactions with host tissue. In this study, we identified a novel opacity factor of S. suis (OFS) with structural homology to members of the MSCRAMM family. The N-terminal region of OFS is homologous to the respective regions of fibronectin-binding protein A (FnBA) of Streptococcus dysgalactiae and the serum opacity factor (SOF) of Streptococcus pyogenes. Similar to these two proteins, the N-terminal domain of OFS opacified horse serum. Serum opacification activity was detectable in sodium dodecyl sulfate extracts of wild-type S. suis but not in extracts of isogenic ofs knockout mutants. Heterologous expression of OFS in Lactococcus lactis demonstrated that a high level of expression of OFS is sufficient to provide surface-associated serum opacification activity. Furthermore, serum opacification could be inhibited by an antiserum against recombinant OFS. The C-terminal repetitive sequence elements of OFS differed significantly from the respective repeat regions of FnBA and SOF as well as from the consensus sequence of the fibronectin-binding repeats of MSCRAMMs. Accordingly, fibronectin binding was not detectable in recombinant OFS. To investigate the putative function of OFS in the pathogenesis of invasive S. suis diseases, piglets were experimentally infected with an isogenic mutant strain in which the ofs gene had been knocked out by an in-frame deletion. The mutant was severely attenuated in virulence but not in colonization, demonstrating that OFS represents a novel virulence determinant of S. suis.


Streptococcus suis serotype 2 is an important invasive porcine pathogen worldwide. It also causes meningitis and other diseases in humans. Processing of pork is considered to be a major risk factor of this zoonosis (3). In pigs, septicemia, meningitis, polyarthritis, polyserositis, and pneumonia are common clinical manifestations. These diseases have been reproduced experimentally by infections with S. suis serotype 2. In addition to epidemiological data, experimental infections demonstrated that wild-type serotype 2 strains, which express a 136-kDa muramidase-released protein (MRP) and an 80-kDa extracellular factor (EF), are highly virulent, in contrast to MRP− EF− serotype 2 strains from Europe (32, 35).

Smith et al. (27) previously showed that the capsule of S. suis protects against phagocytosis. Other factors such as suilysin and the fibronectin- and fibrinogen-binding protein of S. suis (FBPS) may contribute to the pathogenesis of S. suis (1, 9, 19), but so far, the capsule is the only major virulence factor to be identified (27).

In other streptococci such as Streptococcus pyogenes and Streptococcus dysgalactiae, a number of large surface-associated proteins, including SfbI, serum opacity factor (SOF), and fibronectin-binding protein A (FnBA), belong to a group of adhesins called MSCRAMMs (microbial surface components recognizing adhesive matrix molecules). Repetitive sequence elements that are located at the C termini of MSCRAMMs function as a fibronectin-binding domain (13, 17). Structural features like these repeats and the LPXTG anchor motif distinguish the large MSCRAMMs from the fibronectin-binding proteins FBP54 of S. pyogenes and FBPS of S. suis (6, 9). In addition to the homology of the fibronectin-binding repeats, SOF of S. pyogenes and FnBA of S. dysgalactiae show homology in their large N-terminal domains, which are responsible for opacification of mammalian serum (5, 15, 16). Recently, Courtney et al. (7) demonstrated that this N-terminal domain of SOF triggers the disruption of high-density lipoprotein (HDL) particles and that the concomitant formation of lipid droplets accounts for the opacification of serum. SOF knockout mutants were attenuated in virulence in a mouse model (5). As HDL executes anti-inflammatory functions, the N-terminal domain of SOF has been postulated to contribute to the pathogenesis of S. pyogenes in addition to the fibronectin binding of the C-terminal repeats (7). Here, we describe the identification and characterization of a novel virulence factor of S. suis called OFS (opacity factor of S. suis) with structural and functional properties similar to those of SOF and FnBA.

MATERIALS AND METHODS

Bacterial strains and growth conditions.

In this study, only serotype 2 S. suis strain 10 and its isogenic mutants were used. Strain 10 has been shown to be highly virulent in experimental infections of piglets (31). Through insertional mutagenesis of genes involved in the biosynthesis of the capsule, Smith et al. constructed the capsule-deficient isogenic mutant 10cpsΔEF (27), which was, as was strain 10, kindly provided by H. Smith (DLO-Lelystad, The Netherlands). All S. suis strains including the different ofs mutants investigated in this study are mrp+ epf+ sly+. S. pyogenes strains M1, M2, and M49, kindly provided by B. Kreikemeyer (Hospital of the Rostock University, Germany), were included as controls for serum opacification activity. Streptococci were grown on Columbia agar plates with 6% sheep blood or in Bacto Todd Hewitt broth (THB) supplemented with an additional 1% neopeptone (Becton Dickinson Diagnostics, Heidelberg, Germany). Lactococcus lactis subsp. cremoris MG1363, kindly provided by D. Reinscheid (Fachhochschule Bonn-Rhein-Sieg, Germany), was grown at 30°C in M17 medium (Oxoid) supplemented with 0.5% glucose. Escherichia coli strains were cultured in Luria-Bertani (LB) medium. In appropriate cases, antibiotics were added at the following concentrations: ampicillin, 100 μg/ml for E. coli; chloramphenicol (Cm), 3.5 μg/ml for S. suis and 8 μg/ml for E. coli; erythromycin, 2 μg/ml for S. suis, 5 μg/ml for L. lactis, and 100 μg/ml for E. coli; kanamycin, 25 μg/ml for E. coli; spectinomycin, 100 μg/ml for S. suis and 60 μg/ml for E. coli. If required, 5-bromo-4-chloro-3-indolyl-β-d-galactoside (X-gal) and isopropyl-β-d-thiogalactopyranoside (IPTG) were added at 100 μg/ml and 1 mM, respectively, for E. coli.

DNA techniques.

Routine DNA manipulations were performed as described previously by Sambrook et al. (25). DNA fragments were amplified with Pfu polymerase (Promega, Mannheim, Germany).

Cloning of ofs.

The entire ofs gene and its putative promoter region of S. suis strain 10 were TA cloned into pCR2.1-TOPO (Invitrogen, Karlsruhe, Germany) to construct plasmid pTOPO.173.3b.K1. For the generation of the 3,312-bp insert, 173proBamHI and 173terPstI (Table 1) were used as oligonucleotide primers, and the Pfu amplification product was subsequently incubated with 2.5 U Taq polymerase (Invitrogen) for 12 min at 72°C to produce a poly(A) tail. For expression of the recombinant His-tagged OFS (rOFS) and the His-tagged truncated derivatives of OFS (rOFSΔrep and rOFSrep), the 2,608-bp, 1,946-bp, and 496-bp amplification products generated with the primer pairs 173postssBamHI plus 173praeanchorPstI, 173postssBamHI plus pfbsuOFrPstI, and 173prerepBamHI plus 173postrepPstI were cut with BamHI and PstI (New England Biolabs, Frankfurt, Germany) and cloned into pQE31 (QIAGEN, Hilden, Germany) to generate pQE173, pQE173Δrep, and pQE173rep, respectively (Table 1). Purified plasmid DNAs were verified by restriction analysis and sequencing.

TABLE 1.

Oligonucleotide primer sequences used in this study

Primer Sequence Positiona
173proBamHI GCGCGGATCCATTGACATCCATACTTC −316-−297
173terPstI CCCAGTTCAGCCTCTGCAGC 2968-2988
173postssBamHI CCGCGGATCCTGAGGCATTAACGAATG 77-96
173praeanchorPstI AAAACTGCAGATACTTTCTCCACATTGTC 2652-2672
173prerepBamHI CCAGAGGATCCTAAAGAGACTGGAAAA 2013-2030
173postrepPstI CCAATCTCTGCAGTTGACTCTGGTTC 2475-2490
pfbsuOFrPstI GTCTCTGCAGGTAACTCTGGTTG 2006-2023
173pBglII GACTCAGATCTTCCAATGCAACCA 1991-2006
173preproBamHI TTGGGATCCAATATAATGTTATCGATC −876-−850
173postssBglII GTTAGATCTGAAGCGTTTTCATTCG 91-107
173praeanchorBglII ACGAGATCTTGACAATGTGGAGAAAGTA 2651-2669
173postterSphI CATGCATGCTTCAACTATTTCCTAAC 3587-3604
ofsATG ATAGGGATCCCTAAAGTTGTCCAAGCTAATGAAA −20-5
ofsATGoptRBS CAGAGGATCCAGGAGAAAGCTAATGAAAATAAGGA −6-12
ofsendSphI GCAGCGCATGCGAATGGCTCGTTTTAT 2946-2964
cps2Fforward TGCCAAATATTGGTTCAGCA 203-222
cps2Freverse CACAAATCGTCCAACAACCA 662-681
a

Numbers indicate the location of the oligonucleotide primer with regard to the initiation ATG codon. The gene ofs ends at position 2816.

For heterologous expression of OFS in L. lactis, ofs amplification products were cloned into the shuttle vector pOri23 (22). The 3,000-bp and 2,994-bp amplification products generated with the primer pairs ofsATG plus ofsendSphI and ofsATGoptRBS plus ofsendSphI (Table 1), respectively, were digested with BamHI and SphI. These inserts were cloned into pOri23 after BamHI and SphI digestion to construct pOriOFS and pOriOFSoptRBS, respectively. The only difference between these two vectors was that pOriOFS carries the original putative ribosomal binding side of ofs, whereas an optimized ribosomal binding site of ofs was generated in the cloning procedure for pOriOFSoptRBS. In both plasmids, ofs is under the control of the constitutive L. lactis P23 promoter (30).

Sequence alignment.

ClustalW version 1.82 was used to perform sequence alignments.

Targeted mutagenesis of ofs.

Plasmid pICΔ173::erm was used to construct mutant strains 10Δofs::ermK1 and 10cpsΔEFΔofs::ermK5 of strain 10 and strain 10cpsΔEF, respectively. This plasmid was derived from pIC-spec (27). It carries the erythromycin resistance gene of pUCerm instead of the spectinomycin resistance cassette, the 762-bp BamHI-HindIII fragment of pTOPO.173.3b.K1 upstream of the erm gene, and the 997-bp amplification product of strain 10 generated with 173pBglII and 173terPstI (Table 1) as an insert downstream of erm. The electrotransformation of S. suis was carried out as described previously by Smith et al. (28). Putative mutants were confirmed with PCR and Southern blot analysis. In addition to the construction of the mutants with the inserted erm gene, allelic exchange was established for S. suis to construct an ofs in-frame deletion mutant of strain 10. The allelic exchange was performed with the thermosensitive shuttle vector pSET5sΔofs. To construct this vector, a 983-bp 5′ ofs amplification product generated with the primer pair 173preproBamHI plus 173postssBglII and a 953-bp 3′ ofs amplification product amplified with the primer pair 173praeanchorBglII plus 173postterSphI (Table 1) were ligated after BglII digestion, cut with BamHI and SphI, and cloned into pSET5s, which was kindly provided by D. Takamatsu (29). Restriction analysis and sequencing were carried out to verify pSET5sΔofs. The temperature-sensitive replication of this vector enabled the allelic exchange of ofs as described previously (8), with the following modifications. A single colony containing the recombinant plasmid integrated into the chromosome was picked and inoculated into 1 ml of THB with Cm for incubation overnight at 37°C with 5% CO2. The culture was diluted with Cm-free THB and grown at 28°C for five subsequent passages. Dilutions were plated onto Columbia sheep blood plates and incubated overnight at 37°C. Cm-sensitive colonies were screened by PCR to identify possible mutants. The two mutant strains 10Δofs2/12 and 10Δofs3/5 were confirmed by Southern blot analysis. Typing of mutant and parental strains with pulsed-field gel electrophoresis and multiplex PCR was carried out as described previously (2, 26).

Northern blot analysis.

The 672-bp SspI fragment of pTOPO.173.3b.K1 was used as a probe for the detection of ofs mRNA. Hybridization with a gdh fragment, which was amplified and cloned as described previously (26), served as a control. Furthermore, the 478-bp amplification product of oligonucleotide primers cps2Fforward and cps2Freverse (Table 1) of strain 10 was cloned and subsequently used for hybridization. Isolation of RNA, blotting, and hybridization were performed as described previously (10, 11).

Expression, detection, and purification of recombinant OFS proteins.

E. coli M15 with pQE31, pQE173, pQE173rep, or pQE173Δrep was grown in LB broth plus ampicillin and kanamycin at 37°C to an optical density at 600 nm (OD600) of 0.5, 1 mM IPTG was then added, and the bacteria were incubated for additional 2.5 h. For sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and Western blot analysis, preinduced and induced samples were collected and adjusted to equal bacterial concentrations in sample buffer. Proteins were separated in 4% stacking and 8% separating gels and transferred onto a nitrocellulose membrane (Protran; Schleicher & Schuell Inc., Dassel, Germany) by using standard procedures (25). Blocking of membranes was performed as described previously (9). The membranes were incubated with preimmune sera or with polyclonal antisera against rOFS or rOFSrep in a 1:2,000 dilution. After washing, detection was performed with 1:30,000-diluted horseradish peroxidase-conjugated monkey anti-rabbit immunoglobulin G (Amersham, Freiburg, Germany) and developed using the ECL Plus Western blotting detection system (Amersham) as recommended by the manufacturer. Purification of rOFS, rOFSΔrep, and rOFSrep by Ni2+-nitrilotriacetic acid affinity chromatography under denaturing conditions was carried out as recommended by the manufacturer (QIAGEN). Polyclonal antisera against purified rOFS, rOFSΔrep, and rOFSrep raised in rabbits were obtained from Seqlab (Göttingen, Germany).

Detection of OFS and MRP in SDS extracts.

The same procedure as that used for recombinant OFS constructs was used to detect OFS in 15 μl of the SDS extracts, except that a 1:1,000 dilution of an antiserum against rOFSΔrep was used. Detection of MRP was performed as described previously (26).

Detection of serum opacification activity.

The 1% SDS extraction technique for streptococci was used as described previously (24), with the following modifications: the broth culture volume was increased to 10 ml for S. pyogenes and L. lactis and to 40 ml for S. suis (inoculation with 0.5 and 1 ml of a culture grown overnight, respectively). After 4 h of growth, 160 μl of a protease inhibitor cocktail (P8465; Sigma, Taufkirchen, Germany) was added to the S. suis cultures (final concentrations of 92 μM AEBSF [4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride], 400 μM EDTA, 8 μM bestatin, 1.2 μM pepstatin A, and 1.2 μM E-64). Incubation at 37°C was continued for an additional 2 h. S. pyogenes and L. lactis cultures were used for SDS extraction after 5 h of growth. The bacterial pellet was resuspended in 200 μl of prewarmed (42°C) 1% SDS and rotated end-over-end for 1 h at 37°C. The microwell plate assay (14) was used with horse serum (Invitrogen) as a substrate. Twenty-five microliters of the SDS extract was added to 100 μl serum. To demonstrate inhibition of serum opacification by recombinant antisera, 2 μl of polyclonal antiserum against rOFSΔrep was added to the respective wells. The sealed microwell plates were incubated with moderate shaking for 40 h at 37°C. After the addition of 100 μl 0.9% NaCl, the OD450 was measured.

To detect serum opacity activity in E. coli lysates, noninduced and induced cultures of M15 strains with the different pQE constructs described above were compared in two different assays. In the drop test, 20 μl of lysates (sonicated phosphate-buffered saline suspensions) was placed onto 1.8% agar plates with 50% serum from horse, human, or pig (PromoCell, Heidelberg, Germany) and incubated at 37°C for 24 h. Second, SDS-PAGE was performed as described above, and gels were overlaid with 0.5% agarose containing 50% horse serum. After an incubation period of 3 days at 37°C in a sealed bag, opacification was visualized with a gel documentation system (Imago; MWG, Ebersberg, Germany).

Animal experiments.

German Landrace piglets from a herd known to be free of sly+ mrp+ epf+ cps2+ strains were infected experimentally and cared for in accordance with the principles outlined in the European Convention for the Protection of Vertebrate Animals Used for Experimental and Other Scientific Purposes (European Treaty series no. 123 [http://conventions.coe.int/treaty/EN/Menuprincipal.htm]; permit no. 33-42502-05/1003). The piglets were either 4 to 5 (n = 18) or 7 to 8 (n = 8) weeks old and are referred to as weaning piglets and growers, respectively. After transport to the experimental facility, weaning piglets and growers were randomly divided into two groups each. Three days after arrival, the animals were anaesthetized with 2 mg azaperon (Stresnil; Janssen, Neuss, Germany)/kg intramuscularly and 10 mg ketamine-hydrochloride (Ursotamin; Serumwerk, Bernburg, Germany)/kg intramuscularly, sampled to determine the preinfectious status (nasal and tonsil swabs), and predisposed for infection, as described previously (21), through intranasal treatment with 3 ml of 1% acetic acid using an actuator (Valois Deutschland GmbH, Düsseldorf, Germany). Three hours later, animals were anaesthetized again and infected intranasally with 2 × 109 CFU of either S. suis strain 10 or its isogenic mutant, strain 10Δofs2/12 (both suspended in phosphate-buffered saline, application with the actuator). The health status of the animals was investigated every 12 h, including measurement of body temperature and behavior. In the case of high fever (≥41°C for weaning piglets and ≥40.5°C for growers), apathy, and anorexia, animals were euthanized. Seven days after infection, all surviving piglets were anaesthetized to collect tonsil and nasal swabs. All surviving animals were sacrificed 20 days postinfection (dpi).

After euthanasia, every animal went through the same procedure of necropsy and collection of the following samples for histological (H), cytological (C), and bacteriological (B) investigations: cerebrospinal fluid (B); puncture of one tarsal joint (B and C); peritoneal, pleural, and pericardial swab (B); pleura and peritoneum (H); cranial lobe of the lung (B and H); liver (B and H); spleen (B and H); tonsil (B and H); and brain (H). The histological screenings were carried out with blinded experiments. For comparison, a scoring system was set up. The highest score of 5 was given to severe diffuse fibrinous-suppurative meningitis. Severe diffuse fibrinous-suppurative inflammations of the serosae and joints received a score of 4, whereas mild focal fibrinous-suppurative meningitis and serositis were assigned scores 3 and 2, respectively. Increased intravascular neutrophilic granulocytes suggestive of early inflammatory changes received a score of 1. To allow comparisons of groups with different findings and numbers of animals, the sum of the highest scores of each animal for any of the investigated organs was divided by the number of animals (ω = Σscoremax/nanimals). Isolation of the challenge strains was confirmed in a multiplex PCR for the detection of mrp, epf, sly, arcA, gdh, cps1, cps2, cps7, and cps9 (26) and in an ofs-specific PCR (with 173proBamHI and 173terPstI as oligonucleotide primers). In the case of putative 10Δofs2/12 isolates, the introduced BglII site was demonstrated through the digestion of amplification products.

Nucleotide sequence accession number.

The sequence of the S. suis strain 10 ofs gene reported in this work was deposited in GenBank under accession no. AY819647.

RESULTS

Identification, cloning, and sequence analysis of ofs.

The sequence of the S. suis P 1/7 genome (http://www.sanger.ac.uk) was searched for open reading frames encoding putative MSCRAMMs. Sequences of SfbI and SOF of S. pyogenes were used in the BLAST search and led to the identification of an open reading frame (ofs) of 938 amino acids that was homologous to sof. The entire ofs gene of strain 10 was cloned and sequenced as described in Materials and Methods.

The respective open reading frame, called OFS, showed the typical structural features of an MSCRAMM, namely, a putative N-terminal signal sequence, a large N-terminal domain including a proline-rich region, repetitive sequence elements, and a C-terminal LPXTG anchor motif (Fig. 1A). The hidden Markov model trained on gram-positive bacteria (SignalP 3.0; http://www.expasy.org) predicted a signal sequence at the N terminus with a probability of 0.982 and a signal sequence cleavage site between positions 24 and 25 (site probability of 0.741). Results of neural networks of SignalP 3.0 suggested cleavage between positions 22 and 23.

FIG. 1.

FIG. 1.

Sequence analysis of OFS. (A) Schematic representation of putative OFS domains. (B) Alignment of partial sequences of OFS (GenBank accession no. AAX56334), SOF of M type 22 (accession no. AAA85219), and FnBA (accession no. CAA80121) to show the representative high homology of these proteins at their N termini. (C) Alignment of C-terminal repetitive sequences (R1, R2, and R3Δ) of OFS. (D) Alignment of the first repeat of OFS (R1), the MSCRAMM consensus sequence (18), and the partial SfbI sequence (GenBank accession no. CAA48133).

The OFS sequence N terminal to the repeats was found to be homologous to the respective regions of FnBA of S. dysgalactiae and SOF of S. pyogenes (Fig. 1B) (ClustalW scores for alignments were 40 for OFS at positions 87 to 673 [OFS87-673] with FnBA174-789, 34 for OFS87-673 with SOF181-802, and, for comparison, 47 for FnBA174-789 with SOF181-802). The repeats consisted of two complete repetitive sequences (R1 and R2) and an additional truncated repeat (R3Δ) (Fig. 1C). This region did not show significant homology to the fibronectin-binding region of MSCRAMMs (ClustalW scores for alignments were 13 for OFS674-845 with FnBA790-994, 9 for OFS674-845 with SOF803-935, 9 for OFS674-845 with SfbI422-573, and, for comparison, 43 for FnBA790-994 with SOF803-935 and 38 for SOF803-935 with SfbI422-573). However, the alignment of OFS671-706 with SfbI411-446 demonstrated that the first 8 amino acids of R1 (and R2) of OFS were homologous to the amino acids N terminal to the first repeat of the fibronectin-binding region FNBR of SfbI (Fig. 1D). In conclusion, the alignment of the putative OFS protein with MSCRAMMs suggested a serum opacification activity as in SOF and FnBA but not necessarily a fibronectin-binding activity of the repetitive sequence elements of OFS.

Serum opacification activity of rOFS.

Three different His-tagged rOFS mutants were expressed in E. coli for functional studies. The complete OFS sequence, lacking the signal sequence and the C-terminal membrane anchor, was included in rOFS, whereas rOFSΔrep lacked the repetitive sequences, and rOFSrep consisted solely of these repeats. The proteins rOFS, rOFSΔrep, and rOFSrep had calculated molecular masses of 98.4, 74.9, and 19.1 kDa and isoelectric points at 5.1, 6.3, and 4.5, respectively. rOFS and rOFSrep migrated in SDS-PAGE gels slower than the respective molecular weight standards (Fig. 2). The different constructs were investigated for opacification of mammalian serum. Lysates from E. coli that expressed rOFS or rOFSΔrep showed IPTG-inducible serum opacification in SDS overlays (Fig. 2E) and also in the drop test with horse, human, and pig serum agar plates (results not shown). Neither lysates from the control (vector alone) nor lysates from E. coli that expressed rOFSrep opacified horse, human, or pig serum in these assays. The opacifying bands identified in the SDS-PAGE overlays corresponded to bands recognized in Western blots by polyclonal antisera raised against rOFS (Fig. 2C) or rOFSΔrep (results not shown) and, in the case of rOFS, also by antisera raised against rOFSrep (Fig. 2D). The comparison with the Western blot analysis also revealed that after IPTG induction, numerous degradation products of rOFS and rOFSΔrep were formed, which also opacified serum (Fig. 2). In conclusion, rOFS opacified equine, human, and porcine serum, and at least the repeats of OFS were not essential for this opacification activity.

FIG. 2.

FIG. 2.

Serum opacification activity of recombinant OFS. Shown are domains and amino acids of OFS included in the recombinant constructs (A) encoded by pQE173 (rOFS), pQE173Δrep (rOFSΔrep), and pQE173rep (rOFSrep); their differentiation in Western blots with polyclonal anti-rOFS (C) and anti-rOFSrep (D) sera; and detection of serum opacification activity in an SDS-PAGE overlay assay (E). A Western blot developed with preimmune serum is shown for comparison (B). Positions of molecular weight standards (in thousands) are indicated in the left margin. Lanes (lysates of E. coli M15 [B to D]): 1, pQE31 (with IPTG); 2, pQE173 (without IPTG); 3, pQE173 (with IPTG); 4, pQE173rep (without IPTG); 5, pQE173rep (with IPTG); 6, pQE173Δrep (without IPTG); 7, pQE173Δrep (with IPTG).

Mutagenesis and Northern blot analysis of ofs.

To study putative functions and expression of OFS in S. suis, different isogenic ofs knockout mutants of strain 10 were constructed. The mutagenesis was controlled by PCR and Southern blot analysis. Pulsed-field gel electrophoresis analysis showed no indication of genomic rearrangements in the ofs mutants. The growth rates of the wild type and all mutant strains in THB medium were found to be identical (results not shown). The cps2F mRNA transcript was confirmed in strain 10, in the insertion mutant 10Δofs::ermK1, and in the two in-frame deletion mutants 10Δofs2/12 and 10Δofs3/5 but was, as expected, undetectable in the capsular mutant 10cpsΔEF and in the double mutant 10cpsΔEFΔofs::ermK5 (Fig. 3). Northern blot analysis of S. suis strain 10 and 10cpsΔEF also revealed ofs-specific mRNA in these strains, in contrast to the ofs mutants 10Δofs2/12 and 10Δofs3/5 (Fig. 3). This was in accordance with a large deletion of ofs sequence including the sequence used for hybridization in these strains. In strain 10Δofs::ermK1 and in the double mutant 10cpsΔEFΔofs::ermK5, the ofs probe also did not hybridize with RNA fragments corresponding to ofs mRNAs of strain 10 and 10cpsΔEF (Fig. 3). However, small RNA fragments of these insertion mutants hybridized with the ofs probe, which might be associated with the presence of the 3′-terminal 151 bp of the ofs probe downstream of the erm gene in these two mutants. In conclusion, mRNA analysis demonstrated transcription of ofs in strain 10 (and 10cpsΔEF) and confirmed the knockout of ofs in the isogenic mutants.

FIG. 3.

FIG. 3.

Expression of ofs RNA. Northern blot analysis of S. suis strain 10 (lane 1), capsular mutant 10cpsΔEF (lane 2), and ofs mutants 10Δofs::ermK1 (lane 3), 10cpsΔEFΔofs::ermK5 (lane 4), 10Δofs3/5 (lane 5), and 10Δofs2/12 (lane 6) with ofs (A), gdh (B), and cps2F (C) as hybridization probes is shown. The 2.9-kb and 1.6-kb positions are based on 23S and 16S rRNA bands, respectively, in the ethidium bromide-stained gel.

Analysis of OFS-mediated surface-associated serum opacification activity.

As outlined above, sequence analysis and functional studies with rOFS suggested the expression of a serum opacity factor on the surface of S. suis. In agreement with this, serum opacification was detectable after incubation of horse serum with SDS extracts of strain 10 and its isogenic capsular mutant, 10cpsΔEF, but not with extracts of any of the investigated isogenic ofs mutants (Fig. 4). Western blot analysis of the SDS extracts of all the tested S. suis strains with anti-MRP antibodies revealed equal amounts of this surface-associated protein (results not shown), indicating equal extraction efficiencies of surface-associated proteins. Specificity was shown, as the addition of antiserum against rOFSΔrep inhibited the serum opacification of S. suis extracts completely (Fig. 4). We then addressed the question of whether expression of OFS on the surface of a gram-positive bacterium is sufficient to provide surface-associated serum opacification activity. For this, plasmid-encoded OFS was expressed in L. lactis. L. lactis pOriOFS, which expressed ofs under the control of a constitutive promoter but carried the original ribosomal binding site of ofs, expressed small amounts of OFS on the surface, as shown by Western blots of SDS extracts (Fig. 4B). However, these extracts did not opacify serum (Fig. 4). Overexpression of OFS in L. lactis was achieved through the introduction of an optimal ribosomal binding site (pOriOFSoptRBS). This resulted in serum opacification activities of L. lactis extracts comparable to those of SOF+ S. pyogenes extracts (Fig. 4). Antibodies against rOFSΔrep inhibited this OFS-mediated serum opacification. In conclusion, a high level of expression of OFS is sufficient to provide surface-associated serum opacification activity comparable to the SOF-mediated serum opacification activity of S. pyogenes.

FIG. 4.

FIG. 4.

(A) OFS-mediated serum opacification activity in ofs+ S. suis strains (10 and 10cpsΔEF) and in L. lactis (pOriOFSoptRBS) expressing plasmid-encoded OFS. The 1% SDS extracts of the indicated strains were tested for serum opacification activity with the microwell plate assay as described in Materials and Methods. SOF− (M1) and SOF+ (M2 and M49) S. pyogenes strains were included as negative and positive controls, respectively, for serum opacification. The optical density of serum incubated with 1% SDS alone was subtracted from each value (corrected absorbance). Mean values and standard deviations of five independent experiments, each performed in triplicate, are shown. Extracts were either not treated (open bars) or treated with anti-rOFSΔrep antiserum (hatched bars). (B) Plasmid-mediated expression of OFS in L. lactis was detectable in Western blots of SDS extracts with antibodies against rOFSΔrep. Lane 1, L. lactis pOri23; lane 2, L. lactis pOriOFS; lane 3, L. lactis pOriOFSoptRBS.

Experimental infections of piglets.

In preliminary experiments, an infection model was established, which included the predisposition of piglets through the administration of 1% acetic acid prior to intranasal challenge. Diseased animals developed serositis, meningitis, and arthritis. The 80% lethal dose for weaners was approximately 2 × 109 CFU of S. suis strain 10. Mortality was found to be comparably lower in growers (7 to 8 weeks old). Therefore, piglets of two different age classes (nine weaners and four growers each) were infected with 2 × 109 CFU of S. suis strain 10 or of the ofs mutant 10Δofs2/12. None of the nine weaners infected with 10Δofs2/12 developed any clinical signs of infection except transient elevation of body temperature up to 40.3°C (Table 2). In contrast, eight of nine weaners infected with S. suis strain 10 showed severe clinical symptoms (high fever with values above 41°C, apathy, and anorexia) and were euthanized for ethical reasons (Table 2). In accordance, many wild-type-infected weaning piglets showed high histological scores (ω = 2.6), whereas no such findings were recorded in the group of weaning piglets infected with the mutant (ω = 0.1) (Table 3). In particular, five cases of serositis (mainly pleuritis) associated with the S. suis challenge strain were demonstrated (Tables 3 and 4). In two of these animals, the challenge strain was also detected in the cerebrospinal fluid. One additional sacrificed piglet was positive in the lung and in the spleen. In two of eight moribund weaners, no etiological diagnosis was found. Regarding the older piglets (7 to 8 weeks of age), one of four and two of four developed clinical signs of disease after infection with the ofs knockout mutant and the wild type, respectively (Table 2). Only one grower showed severe symptoms, namely, neurological deficits in association with a fibrinopurulent meningitis caused by wild-type S. suis. In the other group, one grower with moderate clinical signs was sacrificed. This was the only 1 of all 13 animals infected with the 10Δofs2/12 mutant for which detection of this genotype was associated with pathohistological findings (Tables 3 and 4). In the other 12 animals, pleural, peritoneal, and pericardial swabs as well as spleen, liver, tarsal joint fluid, and liquor were all negative in bacteriological examinations. However, an investigation of tonsil swabs and tonsils 7 and 20 dpi, respectively, revealed high rates of carriage of the mutant strain 10Δofs2/12; e.g., this strain was isolated from the tonsils in six of nine weaning piglets 20 dpi (Table 4). Additionally, strain 10Δofs2/12 was detected in the lungs of three of nine weaners. However, these bacteriological findings were not associated with the detection of pathological changes in this region of the lung (cranial lobe). In conclusion, experimental infection of piglets demonstrated substantial attenuation of virulence but not colonization deficiency of the respiratory tract in an isogenic S. suis serotype 2 ofs mutant in comparison with its wild-type parental strain.

TABLE 2.

Virulence of wild-type and isogenic ofs mutant strains of S. suis serotype 2 in pigletsa

Age of infected pigs (wk) Total no. of infected pigs S. suis strain No. of pigs/total no. of pigs
Morbidity Mortality Severe clinical symptomsb Maximum body temp (°C)
<40 40-40.5 >40.5
4-5 9 10 8/9 8/9 8/9 1/9 0/9 8/9c
4-5 9 10Δofs2/12 0/9 0/9 0/9 5/9 4/9 0/9
7-8 4 10 2/4 1/4 2/4 2/4 1/4 1/4
7-8 4 10Δofs2/12 1/4 1/4 1/4 3/4 0/4 1/4
a

German Landrace piglets from a herd free of sly+ epf+ mrp+ cps2 S. suis strains.

b

In particular, apathy, persistent anorexia, and/or neural disorder (lameness was not observed in any piglet).

c

All eight piglets had a fever of >41°C.

TABLE 3.

Scoring of pathological findings of piglets infected with wild-type and isogenic ofs mutant strains of S. suis serotype 2

Age of infected pigs (wk) Total no. of infected pigs S. suis strain No. of pigs/total no. of pigs per score
ωd
Brain
Serosa
Lung
Pleuritis
Peritonitis
2 (pneumonia)b 1c
5 (meningitis)a 3 (meningitis)b 1c 4a 2b 4a 2b
4-5 9 10 0/9 0/9 6/9 5/9 0/9 2/9 2/9 4/9 3/9 2.6
4-5 9 10Δofs2/12 0/9 0/9 0/9 0/9 0/9 0/9 0/9 0/9 1/9 0.1
7-8 4 10 1/4 0/4 1/4 0/4 0/4 0/4 0/4 0/4 1/4 1.5
7-8 4 10Δofs2/12 0/4 0/4 1/4 0/4 0/4 0/4 1/4 0/4 1/4 0.5
a

Scores of 5 and 4 indicate moderate to severe diffuse fibrinous-suppurative inflammations of the brain and serosae, respectively.

b

Scores of 3 and 2 indicates mild focal fibrinous-suppurative inflammations of the respective organs.

c

Increased intravascular neutrophilic granulocytes suggestive of early inflammatory changes received a score of 1.

d

ω = Σscoremax/nanimals (see Materials and Methods).

TABLE 4.

Reisolation of the challenge strain in pigs inoculated with wild-type and isogenic ofs mutant of S. suis serotype 2

Age of infected pigs (wk) Total no. of infected pigs S. suis strain No. of pigs in which the S. suis challenge straina was isolated/total no. of pigs
Tonsilsb
Lungc Serosad Spleen Cerebrospinal fluid Joint fluide
2-7 dpi 20 dpi
4-5 9 10 6/9 1/1 7/9 5/9f 2/9g 2/9g 0/9
4-5 9 10Δofs2/12 5/9 6/9 3/9 0/9 0/9 0/9 0/9
7-8 4 10 1/4 3/3 0/4 0/4 0/4 1/4 0/4
7-8 4 10Δofs2/12 1/4 1/3 0/4 1/4 0/4 0/4 0/4
a

Challenge strains were identified through PCR assays (see Materials and Methods).

b

Either tonsil swabs or organ samples.

c

One cranial lobe was investigated.

d

Pleural, peritoneal, or pericardial cavity.

e

One tarsal puncture was investigated.

f

Four of the five animals were also positive in the lung.

g

The challenge strain was detectable in multiple organs from these animals.

DISCUSSION

Although a number of putative virulence factors of S. suis have been described, proof of their function is lacking for most of them. In this study, we identified a gene of S. suis, named ofs, which encodes a protein homologous to FnBA of S. dysgalactiae and SOF of S. pyogenes. Expression of ofs was demonstrated by Northern blot analysis of S. suis serotype 2. Experimental infections of piglets revealed that OFS is a major virulence determinant in S. suis serotype 2. The results are in accordance with the attenuation of virulence in an SOF knockout S. pyogenes mutant described previously by Courtney et al. (5). Those authors studied a mutant with an insertional inactivation of sof. Thus, most likely, the sfbX gene, located downstream of and cotranscribed with sof, was also affected (12). Here, we established an in-frame deletion mutagenesis strategy for S. suis to exclude such effects on genes located downstream of the target gene. Furthermore, this study is the first to demonstrate the importance of a serum opacification factor for pathogenesis in the natural host. Bacteriological investigations suggested that, in contrast to virulence, colonization of the respiratory tract was not affected in the ofs mutant.

The identification of this novel virulence factor allows us to reveal important aspects of the pathogenesis of S. suis. For this, it is essential to functionally characterize OFS. As OFS carries the typical structural elements of MSCRAMMs, it might be speculated that OFS functions as an adhesin and in particular that the C-terminal repeats of OFS bind fibronectin. We were not able to detect fibronectin binding of rOFS, rOFSΔrep, and rOFSrep in ligand Western blots, in contrast to the recombinant FNBR of SfbI, which was used as a positive control (data not shown). The lack of detectable binding might be explained by significant differences between the repetitive sequences of OFS and the fibronectin-binding repeats of FnBA of S. dysgalactiae and SOF of S. pyogenes. Interestingly, two adjacent G residues in the MSCRAMM consensus sequence, which were found to be essential for fibronectin binding in the FnBA repeats (18), are lacking in the respective sequences of OFS (Fig. 1). However, similar to MSCRAMMs, the repeats of OFS have a high content of acidic amino acids. This might also explain the discrepancy of calculated molecular weight and migration in SDS-PAGE gels, which has also been described for the repetitive sequences of MSCRAMMs (13, 23). Whatever the precise function of the OFS repeats might be, it is rather unlikely that the investigated ofs mutant is completely deficient in fibronectin binding, as the fibronectin- and fibrinogen-binding protein FBPS was identified in the same parental strain. Furthermore, attenuation of virulence of the FBPS knockout mutant suggests that FBPS's function in the pathogenesis of S. suis is not redundant (9).

In this study, a major question was whether the high level of homology of OFS to SOF and FnBA at the N terminus is actually related to a serum opacification activity of OFS. In accordance, serum opacification activity was demonstrated in SDS overlay assays and with drop tests for recombinant OFS constructs. Sera from different species including pigs and humans were opacified in these assays (results are shown for equine serum only). SDS extracts of ofs+ S. suis strains tested in the microwell plate assay also opacified serum, in contrast to extracts of isogenic ofs mutants. Importantly, the addition of antiserum against rOFSΔrep inhibited this activity of S. suis extracts, which supports the conclusion that this opacification activity is OFS mediated. Finally, overexpression of OFS in L. lactis resulted in surface-associated serum opacification activity as high as that in SOF+ S. pyogenes strains.

In contrast to SOF+ S. pyogenes strains, concentrated supernatants of wild-type S. suis were negative for serum opacification in different assays (data not shown). It has previously been reported that surface-associated proteins other than SOF of S. pyogenes are not secreted and are difficult to remove from the cell surface with chaotropic agents (23). At present, we can only speculate that these differences are related to the variations in the LPXTG motifs (LPSTG for OFS versus LPASG for SOF).

Interestingly, the addition of protease inhibitors 2 h before SDS extraction was crucial for the demonstration of surface-associated serum opacification in S. suis. This observation suggests the proteolytic degradation of OFS under culture conditions, which has been described previously for other surface-associated virulence factors (20, 34). Based on the results of the animal experiments, we speculate that in the host, OFS expression might be upregulated and/or the half-life of OFS might be longer than that in vitro. Heterologous expression of OFS in L. lactis clearly demonstrated that a high level of expression of OFS is sufficient to provide serum opacification activity on the surface of the bacterium, similar to SOF+ S. pyogenes strains. Future studies will have to show whether S. suis actually upregulates OFS expression during infection.

The finding that the repeats of OFS were not required for serum opacification of rOFS is in agreement with mapping experiments performed with SOF (5, 23). The serum opacification activity was located between amino acids 148 and 843 in SOF of S. pyogenes M2 (5) and N terminal to residue 812 in SOF of M22 (23). Amino acids 148 to 843 of SOF were identified to be homologous to amino acids 56 to 723 of OFS in this study. As rOFSΔrep opacified horse serum, the serum opacification function is apparently located N terminal to P672 in OFS, which corresponds to P802 in SOF.

Taken together, our results allow us to conclude that the virulence factor OFS confers surface-associated serum opacification activity. This activity has not been proven to be essential for virulence, and other as-yet-unknown functions of OFS might be involved in pathogenesis. However, as the C termini of OFS and SOF differ significantly and fibronectin binding was undetectable for rOFS, it is plausible that the shared activity of the N-terminal domain of SOF and OFS contributes to virulence. Opacification of serum by SOF is related to the disruption of HDL (7). HDL has anti-inflammatory functions; e.g., it inhibits C-reactive protein-induced upregulation of adhesion molecules such as vascular cell adhesion molecule 1, intercellular adhesion molecule 1, and E-selectin (33). Recently, Courtney et al. (7) showed that SOF-mediated disruption of HDL correlated with the binding of apolipoprotein A-I (ApoA-I). Interestingly, ApoA-I has been described as a negative acute-phase protein in pigs. In experimental S. suis infections, this decrease starts as early as the first day postinfection, and the ApoA-I concentration is maintained at low levels (4). Future studies will have to show whether this is related to the expression of OFS and how putative targeting of ApoA-I by OFS might modulate the host response favoring the survival of this pathogen.

Acknowledgments

Kerstin Thies (Tieraerztliche Hochschule Hannover) is acknowledged for excellent help in establishing the infection model. We thank H. Smith (DLO-Lelystad, The Netherlands) for S. suis strains 10 and 10cpsΔEF as well as for the anti-MRP antibody. Daisuke Takamatsu (National Institute of Animal Health, Japan), Bernd Kreikemeyer (Hospital of the Rostock University), and Dieter Reinscheid (Fachhochschule Bonn-Rhein-Sieg, Germany) kindly provided pSET5s and the S. pyogenes and the L. lactis pOri23 strains, respectively. We thank the company Valois for the actuators and Frank Matanic (Valois) as well as Phillip Willson (Veterinary Infectious Disease Organization, Canada) for technical support. Furthermore, Christina Neis, Laurentiu Benga, and numerous collaborators from the Institut fuer Virologie (Tieraerztliche Hochschule Hannover) were involved in the animal experiments. Andreas Mietze is acknowledged for excellent work during his practical.

This study was supported by a grant from the Akademie für Tiergesundheit, Bonn, Germany, to Christoph Baums and a grant of the Deutsche Forschungsgemeinschaft (DFG), Bonn, Germany (SFB587), to Ralph Goethe and Peter Valentin-Weigand.

Editor: J. N. Weiser

REFERENCES

  • 1.Allen, A. G., S. Bolitho, H. Lindsay, S. Khan, C. Bryant, P. Norton, P. Ward, J. Leigh, J. Morgan, H. Riches, S. Eastty, and D. Maskell. 2001. Generation and characterization of a defined mutant of Streptococcus suis lacking suilysin. Infect. Immun. 69:2732-2735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Allgaier, A., R. Goethe, H. J. Wisselink, H. E. Smith, and P. Valentin-Weigand. 2001. Relatedness of Streptococcus suis isolates of various serotypes and clinical backgrounds as evaluated by macrorestriction analysis and expression of potential virulence traits. J. Clin. Microbiol. 39:445-453. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Arends, J. P., and H. C. Zanen. 1988. Meningitis caused by Streptococcus suis in humans. Rev. Infect. Dis. 10:131-137. [DOI] [PubMed] [Google Scholar]
  • 4.Carpintero, R., M. Pineiro, M. Andres, M. Iturralde, M. A. Alava, P. M. Heegaard, J. L. Jobert, F. Madec, and F. Lampreave. 2005. The concentration of apolipoprotein A-I decreases during experimentally induced acute-phase processes in pigs. Infect. Immun. 73:3184-3187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Courtney, H. S., D. L. Hasty, Y. Li, H. C. Chiang, J. L. Thacker, and J. B. Dale. 1999. Serum opacity factor is a major fibronectin-binding protein and a virulence determinant of M type 2 Streptococcus pyogenes. Mol. Microbiol. 32:89-98. [DOI] [PubMed] [Google Scholar]
  • 6.Courtney, H. S., Y. Li, J. B. Dale, and D. L. Hasty. 1994. Cloning, sequencing, and expression of a fibronectin/fibrinogen-binding protein from group A streptococci. Infect. Immun. 62:3937-3946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Courtney, H. S., Y. M. Zhang, M. W. Frank, and C. O. Rock. 2006. Serum opacity factor, a streptococcal virulence factor that binds to apolipoproteins A-I and A-II and disrupts high-density lipoprotein structure. J. Biol. Chem. 281:5515-5521. [DOI] [PubMed] [Google Scholar]
  • 8.Degnan, B. A., M. C. Fontaine, A. H. Doebereiner, J. J. Lee, P. Mastroeni, G. Dougan, J. A. Goodacre, and M. A. Kehoe. 2000. Characterization of an isogenic mutant of Streptococcus pyogenes Manfredo lacking the ability to make streptococcal acid glycoprotein. Infect. Immun. 68:2441-2448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.de Greeff, A., H. Buys, R. Verhaar, J. Dijkstra, L. van Alphen, and H. E. Smith. 2002. Contribution of fibronectin-binding protein to pathogenesis of Streptococcus suis serotype 2. Infect. Immun. 70:1319-1325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Goethe, R., and L. Phi-van. 1998. Posttranscriptional lipopolysaccharide regulation of the lysozyme gene at processing of the primary transcript in myelomonocytic HD11 cells. J. Immunol. 160:4970-4978. [PubMed] [Google Scholar]
  • 11.Gruening, P., M. Fulde, P. Valentin-Weigand, and R. Goethe. 2006. Structure, regulation, and putative function of the arginine deiminase system of Streptococcus suis. J. Bacteriol. 188:361-369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jeng, A., V. Sakota, Z. Li, V. Datta, B. Beall, and V. Nizet. 2003. Molecular genetic analysis of a group A Streptococcus operon encoding serum opacity factor and a novel fibronectin-binding protein, SfbX. J. Bacteriol. 185:1208-1217. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Joh, H. J., K. House-Pompeo, J. M. Patti, S. Gurusiddappa, and M. Hook. 1994. Fibronectin receptors from gram-positive bacteria: comparison of active sites. Biochemistry 33:6086-6092. [DOI] [PubMed] [Google Scholar]
  • 14.Johnson, D. R., and E. L. Kaplan. 1988. Microtechnique for serum opacity factor characterization of group A streptococci adaptable to the use of human sera. J. Clin. Microbiol. 26:2025-2030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Katerov, V., P. E. Lindgren, A. A. Totolian, and C. Schalen. 2000. Streptococcal opacity factor: a family of bifunctional proteins with lipoproteinase and fibronectin-binding activities. Curr. Microbiol. 40:149-156. [DOI] [PubMed] [Google Scholar]
  • 16.Kreikemeyer, B., D. R. Martin, and G. S. Chhatwal. 1999. SfbII protein, a fibronectin binding surface protein of group A streptococci, is a serum opacity factor with high serotype-specific apolipoproteinase activity. FEMS Microbiol. Lett. 178:305-311. [DOI] [PubMed] [Google Scholar]
  • 17.Kreikemeyer, B., S. Oehmcke, M. Nakata, R. Hoffrogge, and A. Podbielski. 2004. Streptococcus pyogenes fibronectin-binding protein F2: expression profile, binding characteristics, and impact on eukaryotic cell interactions. J. Biol. Chem. 279:15850-15859. [DOI] [PubMed] [Google Scholar]
  • 18.McGavin, M. J., S. Gurusiddappa, P. E. Lindgren, M. Lindberg, G. Raucci, and M. Hook. 1993. Fibronectin receptors from Streptococcus dysgalactiae and Staphylococcus aureus. Involvement of conserved residues in ligand binding. J. Biol. Chem. 268:23946-23953. [PubMed] [Google Scholar]
  • 19.Norton, P. M., C. Rolph, P. N. Ward, R. W. Bentley, and J. A. Leigh. 1999. Epithelial invasion and cell lysis by virulent strains of Streptococcus suis is enhanced by the presence of suilysin. FEMS Immunol. Med. Microbiol. 26:25-35. [DOI] [PubMed] [Google Scholar]
  • 20.Nyberg, P., M. Rasmussen, U. Pawel-Rammingen, and L. Bjorck. 2004. SpeB modulates fibronectin-dependent internalization of Streptococcus pyogenes by efficient proteolysis of cell-wall-anchored protein F1. Microbiology 150:1559-1569. [DOI] [PubMed] [Google Scholar]
  • 21.Pallares, F. J., P. G. Halbur, C. S. Schmitt, J. A. Roth, T. Opriessnig, P. J. Thomas, J. M. Kinyon, D. Murphy, D. E. Frank, and L. J. Hoffman. 2003. Comparison of experimental models for Streptococcus suis infection of conventional pigs. Can. J. Vet. Res. 67:225-228. [PMC free article] [PubMed] [Google Scholar]
  • 22.Que, Y. A., J. A. Haefliger, P. Francioli, and P. Moreillon. 2000. Expression of Staphylococcus aureus clumping factor A in Lactococcus lactis subsp. cremoris using a new shuttle vector. Infect. Immun. 68:3516-3522. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Rakonjac, J. V., J. C. Robbins, and V. A. Fischetti. 1995. DNA sequence of the serum opacity factor of group A streptococci: identification of a fibronectin-binding repeat domain. Infect. Immun. 63:622-631. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Rehder, C. D., D. R. Johnson, and E. L. Kaplan. 1995. Comparison of methods for obtaining serum opacity factor from group A streptococci. J. Clin. Microbiol. 33:2963-2967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 26.Silva, L., C. G. Baums, T. Rehm, H. Wisselink, R. Goethe, and P. Valentin-Weigand. 2006. Virulence-associated gene profiling of Streptococcus suis isolates by PCR. Vet. Microbiol. 115:117-127. [DOI] [PubMed] [Google Scholar]
  • 27.Smith, H. E., M. Damman, J. van der Velde, F. Wagenaar, H. J. Wisselink, N. Stockhofe-Zurwieden, and M. A. Smits. 1999. Identification and characterization of the cps locus of Streptococcus suis serotype 2: the capsule protects against phagocytosis and is an important virulence factor. Infect. Immun. 67:1750-1756. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Smith, H. E., H. J. Wisselink, U. Vecht, A. L. J. Gielkens, and M. A. Smits. 1995. High-efficiency transformation and gene inactivation in Streptococcus suis type-2. Microbiology 141:181-188. [DOI] [PubMed] [Google Scholar]
  • 29.Takamatsu, D., M. Osaki, and T. Sekizaki. 2001. Thermosensitive suicide vectors for gene replacement in Streptococcus suis. Plasmid 46:140-148. [DOI] [PubMed] [Google Scholar]
  • 30.van der Vossen, J. M., D. van der Lelie, and G. Venema. 1987. Isolation and characterization of Streptococcus cremoris Wg2-specific promoters. Appl. Environ. Microbiol. 53:2452-2457. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Vecht, U., J. P. Arends, E. J. van der Molen, and L. A. van Leengoed. 1989. Differences in virulence between two strains of Streptococcus suis type II after experimentally induced infection of newborn germ-free pigs. Am. J. Vet. Res. 50:1037-1043. [PubMed] [Google Scholar]
  • 32.Vecht, U., H. J. Wisselink, J. E. van Dijk, and H. E. Smith. 1992. Virulence of Streptococcus suis type 2 strains in newborn germfree pigs depends on phenotype. Infect. Immun. 60:550-556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wadham, C., N. Albanese, J. Roberts, L. Wang, C. J. Bagley, J. R. Gamble, K. A. Rye, P. J. Barter, M. A. Vadas, and P. Xia. 2004. High-density lipoproteins neutralize C-reactive protein proinflammatory activity. Circulation 109:2116-2122. [DOI] [PubMed] [Google Scholar]
  • 34.Wei, L., V. Pandiripally, E. Gregory, M. Clymer, and D. Cue. 2005. Impact of the SpeB protease on binding of the complement regulatory proteins factor H and factor H-like protein 1 by Streptococcus pyogenes. Infect. Immun. 73:2040-2050. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Wisselink, H. J., H. E. Smith, N. Stockhofe-Zurwieden, K. Peperkamp, and U. Vecht. 2000. Distribution of capsular types and production of muramidase-released protein (MRP) and extracellular factor (EF) of Streptococcus suis strains isolated from diseased pigs in seven European countries. Vet. Microbiol. 74:237-248. [DOI] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES