Abstract
SC7A1 is a cosmid with an insert of chromosomal DNA from Streptomyces coelicolor A3(2). Its insertion into the chromosome of S. coelicolor strains caused a duplication of a segment of ca. 40 kb and delayed actinorhodin antibiotic production and sporulation, implying that SC7A1 carried a gene negatively affecting these processes. The subcloning of SC7A1 insert DNA resulted in the identification of the open reading frame SCO5582 as nsdA, a gene negatively affecting Streptomyces differentiation. The disruption of chromosomal nsdA caused the overproduction of spores and of three of four known S. coelicolor antibiotics of quite different chemical types. In at least one case (that of actinorhodin), this was correlated with premature expression of a pathway-specific regulatory gene (actII-orf4), implying that nsdA in the wild-type strain indirectly repressed the expression of the actinorhodin biosynthesis cluster. nsdA expression was up-regulated upon aerial mycelium initiation and was strongest in the aerial mycelium. NsdA has DUF921, a Streptomyces protein domain of unknown function and a conserved SXR site. A site-directed mutation (S458A) in this site in NsdA abolished its function. Blast searching showed that NsdA homologues are present in some Streptomyces genomes. Outside of streptomycetes, NsdA-like proteins have been found in several actinomycetes. The disruption of the nsdA-like gene SCO4114 had no obvious phenotypic effects on S. coelicolor. The nsdA orthologue SAV2652 in S. avermitilis could complement the S. coelicolor nsdA-null mutant phenotype.
Soil-dwelling actinobacteria of the genus Streptomyces are mycelial sporulating organisms that are the major natural source of antibiotics. The genetically well-studied Streptomyces coelicolor A3(2) produces at least four antibiotics, blue-pigmented polyketide actinorhodin (Act), red-pigmented prodigiosins (Red), a lipopeptide calcium-dependent antibiotic (CDA), and the SCP1-plasmid-encoded cyclopentanone antibiotic methylenomycin (Mmy). The triggering of physiological differentiation (secondary metabolism) in Streptomyces concurs with the initiation of morphological differentiation, and both processes are under rigorous genetic modulation via a hierarchical regulatory network, integrating various physiological and environmental signals (4, 10).
Pathway-specific regulatory genes, such as actII-orf4, redD, cdaR, and mmyR, are at the bottom of the regulatory network, each controlling one antibiotic biosynthetic pathway (4). Global regulators, such as bldA (16), bldB (14), bldD (15), and bldG (5), perform the highest-level regulation and affect both morphological and physiological differentiation (9, 10). At intermediate levels in the regulatory cascades, many regulatory genes, such as afsB (22), abaA (17), absB (7), afsK-afsR (21, 36), and tcrA (33), and two-component systems, such as afsQ1-afsQ2 (26), absA1-absA2 (1, 42), cutS-cutR (8), and phoR-phoP (44), have been identified that regulate the synthesis of two or more antibiotics. absA1-absA2, cutS-cutR, phoR-phoP, and tcrA and some pathway-specific repressors regulate antibiotic production in a negative way, since null mutations in these genes resulted in the overproduction of the corresponding antibiotic(s). Global regulators may also play a negative role, as in the case of the A-factor receptor protein ArpA in Streptomyces griseus. When A-factor is absent, ArpA binds to the adpA promoter and represses the expression of AdpA, which is an activator of a regulon that consists of operons involved in mycelial differentiation and antibiotic production. arpA-null mutants produced more streptomycin and formed aerial hyphae earlier than did the wild-type strain (39). Recent microarray data have indicated a cross-regulation among disparate antibiotic biosynthetic pathways and even some back regulation from cluster-situated regulators to a “higher level” pleiotropic regulatory gene (23).
The identification of new genes that regulate antibiotic biosynthesis and mycelial differentiation is important for understanding the factors affecting antibiotic yield. In this study, we report the identification of a new gene negatively affecting both processes.
MATERIALS AND METHODS
Bacterial strains, plasmids, and growth conditions.
Streptomyces coelicolor A3(2) strains (Table 1) were manipulated as described previously (27). For routine subcloning, Escherichia coli K-12 strains DH5α (43) and ET12567 (dam dcm hsdS) (34) were grown and transformed according to the method of Sambrook et al. (43). ET12567 was used to propagate unmethylated DNA for introduction into S. coelicolor by transformation or conjugation. Bacillus mycoides Flugge ATCC 6462 was purchased from the China Center for Type Culture Collection. E. coli BW25113/pIJ790 was the host for λRED-mediated PCR-targeted mutagenesis (20). pIJ773 or pIJ778 was used as the template for the amplification of a disruption cassette containing the apramycin resistance gene aac(3)IV or streptomycin/spectinomycin resistance gene aadA and the RK2 origin of transfer (oriT), flanked by recognition sites for FLP recombinase (20). pHP45Ωaac(3)IV (6) was used as a source of aac(3)IV disruption cassette. pHJL401, a medium-copy-number SCP2*-based vector (27), was used for subcloning in S. coelicolor. pIJ8600 (46) and pSET152 (27), which integrate into the S. coelicolor chromosome by site-specific recombination at the bacteriophage ΦC31 attachment site, i.e., attB (30), were used to introduce single copies of genes into the S. coelicolor chromosome. pIJ2925 (27) and pHZ199 (reppUC oriT bla tsr hyg) (see reference 31) were used to construct gene disruption vectors. Thirty cosmids, i.e., SCP8, SC3B6, SC7G11, SCCB12, SC6G9, SC6G5, SC8D9, SC1C2, SC7A1, SC2E1, SC6A9, SC8B7, SC5H4, SC9F2, SC7C7, SC4H8, SC4H2, SC5B8, SC3F7, SC10A5, SC7B7, SC1C3, SC9D7, SC9B2, SC3C8, SC9C7, SC8A6, SC1F2, SC4G2, and SC4C6 (41), with inserts of genomic DNA from the 5 o'clock position of the S. coelicolor chromosome were used to transform J1501, and transformants were screened for reduced actinorhodin production. SCD72A carrying SCO4114 was used to construct the SCO4114 gene replacement plasmid SCD72SST. pIJ8635 (46) containing egfp was used to construct a plasmid with the nsdA promoter region fused to egfp. pSET151 (27), containing xylE, was used to construct a plasmid with the nsdA promoter region fused to xylE. Plasmids constructed in this study are listed in Table 2.
TABLE 1.
S. coelicolor strains used in this study
| Strain | Features | Source |
|---|---|---|
| M145 | Wild type | 27 |
| M600 | Wild type | 27 |
| J1501 | hisA1 uraA1 strA1 Pgl− SCP1− SCP2− | 27 |
| J1506 | J1501/SCP1+ | C. J. Bruton and K. F. Chater |
| YX2 | M145 ΔnsdA (870 bp)::aac(3)IV | This study |
| LW9 | M145 ΔnsdA::aac(3)IV | This study |
| LW6 | M145 ΔSCO4114::aadA | This study |
| LW4 | M600 ΔSCO4114::aadA | This study |
TABLE 2.
Plasmids constructed in this study and their characteristics
| Plasmid | Characteristic(s) |
|---|---|
| pHZ2701 | 33-kb EcoRI fragment of SC7A1 inserted in pHJL401 |
| pHZ2702 | 12-kb EcoRI fragment of SC7A1 inserted in pHJL401 |
| pHZ2703 | 18-kb BglII fragment of SC7A1 inserted in pHJL401 |
| pHZ2704 | 8-kb BglII fragment of SC7A1 inserted in pHJL401 |
| pHZ2705 | 6-kb BglII fragment of SC7A1 inserted in pHJL401 |
| pHZ2706 | 3-kb XhoI fragment removed from pHZ2703 |
| pHZ2707 | 3-kb and 8-kb XhoI fragments removed from pHZ2703 |
| pHZ2712 | 870-bp BamHI fragment removed from pHZ2706 |
| pHZ2714 | 3.5-kb BamHI fragment of pHZ2703 inserted in pHJL401 |
| pHZ2717 | 4.1-kb BclI fragment of pHZ2706 inserted in pHZ199 |
| pHZ2718 | 870-bp nsdA internal BamHI fragment in pHZ2717 replaced by 1.7-kb BamHI fragment from pHP45Ωaac3(IV) |
| pHZ2721 | 2.9-kb StuI-BclI fragment of pHZ2706 inserted in pHJL401 |
| pHZ2731 | 2.9-kb StuI-BclI fragment of pHZ2706 inserted in pIJ8600 |
| pHZ2733 | 1.3-kb SacI fragment of pHZ2731 inserted in pIJ2925 |
| pHZ2733* | TCC→GCC mutant (nsdA S458A) of pHZ2733 |
| pHZ2735 | Carrying nsdA S458A mutation; 1.3-kb SacI fragment of pHZ2731 replaced by same fragment of pHZ2733* with TCC→GCC mutation |
| pHL123 | nsdA gene in SC7A1 was replaced by an oriT+aac(3)IV cassette from pIJ773 |
| pHL127 | 1.7-kb SacI-PstI fragment containing aac(3)IV in pSET152 replaced by 1.3-kb SacI-PstI fragment containing aadA from pIJ778 |
| pHL128 | 2.9-kb StuI-BclI fragment of pHZ2706 inserted in pHL127 |
| pHL129 | 2.9-kb StuI-BclI fragment of pHZ2706 inserted in pHL127 carrying a TCC→GCC mutation in nsdA S458 site |
| pHL116 | 544-bp PCR fragment of nsdA promoter region inserted between the KpnI-BamHI sites of pIJ8635 |
| pHL117 | BglII-EcoRI region of pIJ8600 replaced by BglII-EcoRI fragment of pHL116 |
| pHL133 | 931-bp fragment of promoterless xylE amplified from pSET151 inserted between the BglII-BamHI sites of pHL117 |
| pHL134 | 1.3-kb aadA+oriT fragment inserted into the EcoRI site of pHL133 |
| pHL134-nsdAp | 544-bp fragment of nsdA promoter region inserted into the BglII site of pHL134 |
| pHL561 | 2.2-kb fragment (containing SAV2652 and 637-bp upstream region) of S. avermitilis inserted in pHL127 |
Several different Streptomyces media were used. SMMS medium was as previously reported by Takano et al. (47). MS agar (27) was used to make spore suspensions and for plating out conjugations with E. coli ET12567 containing the RP4 derivative pUZ8002 (18). R2YE (27) was used for protoplast transformation. Yeast extract-malt extract (YEME) was a liquid medium (27). All Streptomyces cultivation was at 30°C.
DNA manipulations.
DNA restriction and modifying enzymes were used as recommended by the manufacturers (BRL and Takara). Standard recombinant DNA techniques were used as previously described by Sambrook et al. (43). DNA fragments were purified from agarose gels with the Geneclean kit II (BIO101). Southern hybridization was carried out as previously described by Sambrook et al. (43).
Construction of an nsdA gene replacement mutant.
The nsdA gene replacement mutant was constructed through a homologous recombination strategy. First a gene replacement vector pHZ2718 carrying a mutant nsdA gene was constructed as follows. A 4,095-bp BclI fragment containing nsdA and flanking DNA was cloned in the BamHI site of pHZ199 to generate pHZ2717. An 870-bp internal BamHI fragment, encoding amino acids 77 to 367 of NsdA, was then replaced by a 1.7-kb aac(3)IV cassette from pHP45Ωaac(3)IV (6) to give pHZ2718. Then pHZ2718 was conjugated into M145. Two apramycin-resistant and thiostrepton-sensitive strains (named YX2) were obtained from the conjugation plates. The double-crossover replacements in YX2 were confirmed by Southern hybridization.
In an alternative method, an nsdA gene replacement vector was constructed using λRED-mediated PCR-targeted mutagenesis (20). Primers PNSDAD1 (5′-TCGGCGACAGGTGGTCTCAGGGATGGGGGCGTTCCAGTGATTCCGGGGATCCGTCGACC-3′) and PNSDAD2 (5′-TTCGGGAGGGCCGGCCGCGGCCGGGGCTGGTGGGGGTTCATGTAGGCTGGAGCTGCTTC-3′) were used to amplify an oriT+aac(3)IV fragment of pIJ773. The amplified fragment was used to replace the whole nsdA gene in cosmid SC7A1, leaving only the start and stop codons. The resulting plasmid, named pHL123, was verified by PCR and then conjugated into M145. Seven apramycin-resistant and kanamycin-sensitive strains (named LW9-2 to LW9-8) were obtained from conjugation plates, and the double-crossover replacements in them were verified by PCR.
Construction of a SCO4114-null mutant.
A SCO4114 gene replacement vector was constructed by λRED-mediated PCR-targeted mutagenesis (20). Two PCR primers, orf1590-L (5′-CAGCGCGGCAGCCGTCTGTGTCGACGGGTGGCGCATGATTCCGGGGATCCGTCGACC-3′) and orf1590-R (5′-TGCCCTCAAACCCGTCAGGGGCGGGCGGTCGGGCGATCATGTAGGCTGGAGCT GCTTC-3′), corresponding to the regions immediately upstream and downstream of the SCO4114 coding region, were used to amplify aadA from pIJ778. In order to replace the whole of SCO4114 from its ATG start codon to its TGA stop codon, the amplified DNA was introduced into the cosmid SCD72A using λRED-mediated recombination (20). The SCO4114 gene replacement in the resulting cosmid SCD72SST was verified by restriction digestion and PCR. Then SCD72SST was conjugated into M145 and M600. Five spectinomycin-/streptomycin-resistant and kanamycin-sensitive strains (named LW6) were obtained from M145, and six (named LW4) were obtained from M600. The SCO4114 mutations in LW6 and LW4 were verified by PCR using primers orf1590-1 (5′-GTCCGCGAGACCGATCTCGTGG-3′) and orf1590-2 (5′-ACTGGATCCAGTACAGCGGG-3′).
Antibiotic production assays.
The bioassays of CDA and Mmy were carried out as previously described by Kieser et al. (27). B. mycoides Flugge ATCC 6462 was used as a bioassay indicator of CDA activity. In order to test methylenomycin production, SCP1, the S. coelicolor linear plasmid harboring the methylenomycin gene cluster, was introduced into YX2 and M145 by mating with J1506 (J1501/SCP1+) (Table 1). SCP1 is found in essentially all of the progeny of such crosses, but chromosomal recombination is several orders of magnitude less efficient. Prototrophic, streptomycin-sensitive progeny were tested for methylenomycin production by bioassay using the methylenomycin-sensitive strain J1501 (hisA1 uraA1 strA1 Pgl− SCP1− SCP2−) as an indicator. The detection of actinorhodin and prodigiosin production in solid culture was carried out as described previously by Kieser et al. (27).
Northern blot detection of actII-orf4 mRNA.
RNA was isolated from S. coelicolor cultures grown on SMMS medium covered with cellophane disks as described previously by Strauch et al. (45). The RNA concentration was determined by UV absorbance at 260 nm. The probe for Northern analysis of the actII-orf4 gene was generated from the S. coelicolor chromosome by PCR with the forward primer actII-4a (5′-CAACTTATTGGGACGTGTCCAT-3′) and the reverse primer actII-4b (5′-CACCGTTGAGAATTTCCATGTG-3′). The 743-bp PCR product contained a large part of the structural gene actII-orf4, encoding amino acids 4 to 250 of ActII-orf4. The actII-orf4 probe was labeled with dUTP-digoxin using the DIG DNA labeling and detection kit (Roche). A digoxin-labeled synthetic oligonucleotide P16Sdig (5′-CCGCCTTCGCCACCGGT-3′) was used as a probe for the detection of 16S rRNA. Twenty micrograms of total RNA was loaded for each sample and fractionated on a 1% formaldehyde-MOPS (morpholinepropanesulfonic acid) agarose gel, transferred to a HybondN membrane, and hybridized with digoxigenin-labeled probe at 53°C in hybridization buffer containing 50% formamide.
Construction of nsdA promoter-egfp and nsdA promoter-xylE fusion plasmids.
To construct an nsdA promoter-egfp fusion plasmid, a 544-bp fragment from −18 to −561 upstream of the nsdA GTG start codon was amplified with primers pnsdAp1 (5′ ACGGGGTACCAGATCTACAGTCCGCTGAACTCGGCCA, where underlined letters indicate engineered restriction sites) and pnsdAp2 (5′ ACGCGGATCCTGAGACCACCTGTCGCCGA). The fragment was then digested by KpnI and BamHI and ligated into pIJ8635 (46), generating pHL116. Then the BglII-EcoRI fragment of pHL116 was ligated between the BglII and EcoRI sites of pIJ8600, generating pHL117, which contained the tfd-nsdA promoter region fused to egfp, and the apramycin-resistant gene aac(3)IV.
To construct an nsdA promoter-xylE fusion plasmid, a 931-bp fragment of the xylE coding region and 11 bp upstream of its ATG start codon was amplified from pSET151 (27) with primers PxylEstart (5′ TGATAGATCTGATTTAAACTGGTACCGGAGGGACGTCATGAACAAAGGTGT, where underlined letters indicate restriction sites and boldface letters indicate the start codon of xylE) and PxylEstop (5′ TGATAGATCTATCAGGTCAGCACGGTCAT). The fragment was then digested by BglII and ligated between the BglII and BamHI sites of pHL117, generating pHL133. A 1.3-kb aadA+oriT fragment was amplified from pIJ778 (20) by primers PaadAstart (5′ GATCGAATTCAAGTTCCCGCCAGCCTCGCA) and PaadAstop (5′ GATCGAATTCCTGGCGAGCGGCATCTTATT) and then digested by EcoRI and inserted into pHL133, generating pHL134. The 0.5-kb BamHI/BglII fragment containing nsdA promoter region was ligated into the BglII site of pHL134, generating pHL134-nsdAp, which contained the tfd-nsdA promoter region fused to xylE, and the antibiotic-resistant gene aac(3)IV and aadA.
pHL117, pHL134, and pHL134-nsdAp were then conjugated into M145.
Fluorescence microscopy and XylE activity detection.
M145/pHL117 was inoculated on MS and SMMS against a sterile coverslip inserted into the media (46). The culture grown at 30°C was observed at various time points with a fluorescence microscope (Olympus BX51, WIB filter; 40× objective). The method of XylE activity detection was described previously (25).
Quantitative RT-PCR.
M145 RNA was isolated from S. coelicolor cultures grown on SMMS medium covered with cellophane disks. Quantitative reverse transcriptase (RT)-PCR was conducted using 1 μg total RNA as the template and the Access RT-PCR system (catalog no. A1260; Promega) following the manufacturer's instructions. Primers pnsdArt1 (5′-GCGGTACGAGCGCGGGGAGC-3′) and pnsdArt2 (5′-GCGTGAGGTGTCGGTGGAGATGTGGT-3′) were used to detect nsdA. Primers phrdBrt1 (5′-GCGCACCCGAAAGAGCGTCGCAG-3′) and phrdBrt2 (5′-CGGCGGGAGCGGTCGCCTTCC-3′) were used to detect hrdB (the RNA polymerase principal sigma factor gene as an internal control). RT-PCR conditions were as follows: 42°C for 1 h, 95°C for 2 min, 25 cycles of 95°C for 30 s, 53°C for 30 s, and 68°C for 20 s.
Site-directed mutagenesis.
The site-directed mutagenesis of nsdA was carried out following the instruction manual for the Stratagene QuikChange site-directed mutagenesis kit. First a 1.3-kb SacI fragment, encoding the last 312-amino-acid sequence (including S458) and the downstream intergenic region, was cloned into pIJ2925 to generate pHZ2733. pHZ2733 was then used as the PCR template for site-directed mutagenesis. Two synthetic oligonucleotides, W40230 (5′-GGTCCGCGCCGAACGCGTCAACACC-3′, where the desired mutation is underlined) and W40231 (5′-GCGTTCGGCGCGGACCTTCTTGG-3′), were designed complementary to opposite strands of the S458-encoding region of nsdA and containing the desired mutation. The mutagenesis PCR was carried out with Pfu DNA polymerase. Dimethyl sulfoxide was added to the reaction mixture to a final concentration of 5% (vol/vol). After temperature cycling, the PCR product was treated with DpnI to digest the methylated parental DNA template and to select for mutation-containing synthesized DNA. The mixture was then used to transform E. coli DH5α. Plasmid DNA from two transformants was sequenced to show that the inserted DNA fragments contained the designed mutation and there was no other mutation. Then the 1.3-kb SacI fragment was excised from the mutated plasmid pHZ2733* and used to replace the same fragment in pHZ2731 to generate pHZ2735. The 2-kb region from 479 bp upstream to 40 bp downstream of nsdA in pHZ2735 was sequenced to confirm the designed TCCGCC mutation and that there was no other mutation.
RESULTS
Identification of nsdA, a gene negatively affecting differentiation.
In the course of trying to clone a gene that had been mapped genetically to the 5 o'clock region of the linkage map, thirty cosmids containing insert DNA from the corresponding region of the chromosome of S. coelicolor A3(2) (strain M145) were separately introduced into strain J1501 by protoplast transformation. Since they contained no Streptomyces replication origin, the cosmids could be maintained only via homologous recombinational integration into the chromosome. We found it interesting that all SC7A1 transformants on R2YE medium showed delayed sporulation and formed blue pigment poorly and late compared with the parent J1501. The transformation of a different A3(2) derivative, M145, by SC7A1 showed similar results (Fig. 1), implying that one or more genes carried by this cosmid negatively affect sporulation and pigmentation.
FIG. 1.

Streptomyces cosmid SC7A1 and some subclones carrying nsdA on pHJL401, a medium-copy-number SCP2*-based vector, delay actinorhodin production of M145. The cultures were grown on R2YE for 5 days at 30°C. The back of the plate is shown.
SC7A1 carries a 46-kb insert with 41 annotated genes (http://www.sanger.ac.uk/Projects/S_coelicolor) (3). To identify the possible negative gene(s), restriction fragments of SC7A1 were subcloned in pHJL401 and then used to transform M145 (Fig. 2). Only subclones with orf26 (i.e., SCO5582) caused the pigment delay phenotype on R2YE medium (Fig. 1). In the S. coelicolor chromosome, SCO5582 is followed by five genes in the same transcriptional direction (Fig. 2). Whether they are cotranscribed with SCO5582 has not been documented. Since pHZ2721, containing only one entire open reading frame, i.e., SCO5582, was sufficient to delay pigmentation and sporulation (Fig. 1), extra copies of the downstream genes were not required for the negative function. We therefore designated SCO5582 as nsdA, meaning a gene negatively affecting Streptomyces differentiation.
FIG. 2.
Identification of nsdA, which negatively affects Streptomyces differentiation by subcloning in M145. Lines with double arrows represent insert DNAs in each subclone. Open arrows represent genes, with their names shown above. The gray arrow represents nsdA. Some restriction enzyme sites are also shown. +, Act production was delayed. −, Act production was not delayed.
Aerial mycelium formation was delayed, but more spores were eventually produced in nsdA-null mutants.
An nsdA mutant, YX2, was constructed by replacing an nsdA internal 870-bp BamHI fragment with the apramycin resistance gene aac(3)IV via homologous recombination. The gene replacement was confirmed by Southern hybridization (data not shown).
On different solid media, YX2 differed from M145 in the rate and extent of sporulation (Fig. 3). On MS and R2YE media, the mutant began to grow aerial mycelium about 1 to 2 days later and sporulated 2 to 3 days later, but both aerial mycelium amounts and eventual sporulation levels appeared to be greater than those of the parent strain. When we plated out diluted spores harvested from colonies on MS medium grown for 10 days and counted the CFU, YX2 spore suspensions reproducibly formed about twice as many CFU/colony as did M145. On SMMS medium, M145 lawns sporulated poorly after 13 days' growth but YX2 sporulated well and produced nearly twenty times more spores than did M145 (data not shown). In liquid culture YEME, in which S. coelicolor does not sporulate, the biomass was not changed by the gene disruption (data not shown). Complementation of the altered developmental time course was obtained by introducing pHZ2731 into YX2 (data not shown). To confirm that the phenotype was not attributable to any residual part of nsdA in YX2, the whole nsdA gene was replaced by an oriT+aac(3)IV cassette by using PCR targeting. Seven mutant strains, LW9-2 to LW9-8, were obtained easily and were confirmed by PCR (see Materials and Methods). These strains had phenotypes very similar to that of YX2 and could be fully complemented by pHL128, a plasmid containing an nsdA gene and a spectinomycin-/streptomycin-resistant gene aadA (Fig. 3). This convincingly confirmed the nsdA mutant phenotype.
FIG. 3.

In nsdA mutants, aerial mycelium formation was delayed but more spores were eventually produced. Strains were grown on MS medium at 30°C. The upper sides of the plates are shown. Time points of observation are shown at the top. Strain names are to the left. M145, wild-type strain. YX2, an nsdA mutant strain in which amino acids 77 to 367 of NsdA were replaced by a 1.7-kb aac(3)IV cassette. LW9 was an nsdA-null mutant strain in which the whole nsdA gene was replaced by an oriT+aac(3)IV cassette. LW9/pHL128, LW9 complemented by pHL128 (a pHL127-derived plasmid containing nsdA).
nsdA disruption elevated biosynthesis of three antibiotics.
When cultured on SMMS or MS solid medium, nsdA mutants YX2 and LW9 produced more blue pigment (the polyketide antibiotic actinorhodin or Act) than did M145 (Fig. 4A and B). On R2YE, they became pigmented a few hours to 2 days sooner than did M145, although all strains produced large amounts of Act upon longer incubation (5 to 6 days, data not shown). The change of Act production and timing was reversed to the wild-type level by the introduction of nsdA back into YX2 or LW9 (Fig. 4), excluding potential polar effects on adjacent genes as an explanation and suggesting that nsdA in the wild-type strain represses Act production.
FIG. 4.

nsdA disruption results in the overproduction of actinorhodin on (A) SMMS (6-day culture) and (B) MS media (4-day culture). The backs of the plates are shown. YX2 and LW9, nsdA disruption mutants. M145, parent strain. pHZ2731 carried nsdA inserted into pIJ8600. pHL127 is a pSET152-derived plasmid with aac(3)IV replaced by aadA. pHL128 carried nsdA inserted into pHL127. pHL129 carried the nsdA with the S458A mutation inserted in pHL127. The nsdA-null mutation phenotype was complemented by pHL128 but not by pHL129.
In addition to Act, the production of the lipopeptide antibiotic CDA was elevated by nsdA disruption, as indicated by the inhibition of a CDA-sensitive Bacillus mycoides strain, and the overproduction phenotype was complemented by reintroducing nsdA (Fig. 5A). In view of the fact that the Act and CDA biosynthetic pathways are quite unlike each other, this result suggested that nsdA might be having some general effect on secondary metabolism. We therefore further investigated this possibility by introducing the biosynthetic pathway for another kind of antibiotic, the epoxycyclopentanone methylenomycin (Mmy), into an nsdA mutant. This was carried out by the conjugal introduction of the plasmid SCP1, which carries the mmy genes (and which had been previously eliminated at an early stage of the M145 pedigree). Compared to that of M145/SCP1, YX2/SCP1 gave a larger inhibition zone on the indicator S. coelicolor J1501, which is Mmy sensitive because it lacks SCP1, and the Mmy overproduction phenotype was complemented by reintroducing nsdA (Fig. 5B). This conclusion was not affected by the slight complication that, for reasons that have yet to be investigated, the control strain YX2/SCP1/pIJ8600 gave a larger inhibition zone than did YX2/SCP1.
FIG. 5.

nsdA gene disruption results in the overproduction of CDA (A) and methylenomycin (B). Compared to that of M145, YX2 culture plugs generated a larger inhibition zone with the CDA-sensitive Bacillus mycoides indicator strain. Similarly, compared to that of M145/SCP1, YX2/SCP1 gave a larger inhibition zone on the Mmy-sensitive indicator S. coelicolor J1501. The CDA and methylenomycin overproduction phenotype was complemented by pHZ2731 but not by pIJ8600.
The nsdA mutation did not affect the production of the red-pigmented prodiginines, in liquid or on solid media. We also found that extracellular amylase activity was not influenced by the nsdA gene replacement (data not shown). Thus, although the mutant phenotype was strikingly pleiotropic, it did not affect all aspects of secondary metabolism or stationary-phase biology.
Actinorhodin overproduction in the nsdA mutant was associated with the up-regulation of the pathway-specific regulator actII-orf4.
The expression of many antibiotic biosynthesis clusters is regulated by pathway-specific regulators, most of which are transcriptional activators. In S. coelicolor, Act biosynthesis has been shown to depend on the transcriptional activation of the Act biosynthesis cluster by ActII-orf4 protein, and increased expression of ActII-orf4 results in the overproduction of Act (4). The transcription of actII-orf4 in the nsdA mutant YX2 was therefore analyzed by Northern blotting. Total RNA was isolated from different developmental stages of M145 and YX2 grown on SMMS medium. As shown in Fig. 6, the transcription of actII-orf4 increased markedly and was comparatively early in YX2, suggesting that the negative effect of nsdA on Act production involved the repression of the transcription of the pathway-specific activator actII-orf4, either directly or indirectly.
FIG. 6.

Northern blot analysis indicating an increase of actII-orf4 mRNA in the nsdA mutant strain. Total RNA was isolated from solid SMMS cultures grown for 28, 40, 52, 64, and 76 h. The same blot was stripped and hybridized with probe for 16S rRNA.
nsdA expression was developmentally regulated and was strongest in the aerial mycelium.
The developmental effects of nsdA led us to investigate its expression in relation to colony differentiation. A 544-bp fragment from −18 to −561 upstream of the nsdA GTG start codon was amplified by PCR and fused to a promoterless egfp gene. The resulting plasmid pHL117 was conjugated into M145. Fluorescence signals were not detected in newly grown germ tubes and substrate mycelium but were relatively high in aerial mycelium and spore chains (Fig. 7A). The signal became weaker in spore chains after prolonged incubation. Thus, nsdA expression is strong only in aerial mycelium.
FIG. 7.
Localization and time of nsdA expression. (A) EGFP fluorescence microscopy (A1 to A4). M145/pHL117 (A1 and A2), in which a 544-bp fragment from −18 to −561 upstream of the nsdA GTG start codon was fused to a promoterless egfp gene, and M145 (A3 and A4) were grown on MS for 37 h. Phase-contrast (A1 and A3) and fluorescence (enhanced green fluorescent protein) (A2 and A4) micrographs are shown. Fluorescence signals of M145/pHL117 were relatively high in aerial mycelium and spore chains. SM, substrate mycelium; AM, aerial mycelium; SC, spore chain. Bar, 10 μm. (B) XylE activity assay. Strains were grown on SMMS medium for 28 to 76 h. They began to form aerial mycelium and sporulate at about 40 and 64 h, respectively. C23O activities were measured quantitatively (25). C23O activities were obviously detected in only M145/pHL134-nsdAp at 40, 52, 64, and 76 h. pHL134, M145/pHL134; PnsdA, M145/pHL134-nsdAp. Error bars indicate standard deviations. (C) RT-PCR. M145 was grown on SMMS medium for 18 to 76 h. It began to form aerial mycelium (Am) and sporulate (Sp) at about 28 and 52 h, respectively. nsdA was expressed at about 28 h. hrdB, as a control, was expressed throughout growth.
An nsdA promoter-xylE fusion plasmid was also constructed. xylE encodes a catechol 2,3-dioxygenase (C23O) which converts colorless catechol to the yellow compound 2-hydroxy muconic semialdehyde and its activity can be quantitatively measured (25). Two strains, M145/pHL134 (a control strain with promoterless xylE) and M145/pHL134-nsdAp, were grown on SMMS medium covered with cellophane for 28 to 76 h. C23O activities were obviously detected in only M145/pHL134-nsdAp at 40, 52, 64, and 76 h (Fig. 7B). The RT-PCR using surface-growing culture also showed that nsdA was expressed when M145 was growing aerial mycelium (Fig. 7C). These results indicated that nsdA was developmentally regulated and were consistent with the fluorescence observations.
In liquid medium YEME, nsdA was not found to be expressed by both fluorescence observation and XylE assay (data not shown).
A conserved serine at position 458 in NsdA is required for its function.
Bioinformatic analysis of NsdA using the Prosite database search tool Proscan (12) identified “SXR” at positions 458 to 460 as a putative protein kinase C phosphorylation site (28). This site is highly conserved in NsdA homologues (Fig. 8). To test whether this conserved motif is required for the negative function of NsdA, the serine residue was mutated to alanine to generate an NsdA (S458A) mutant. The nsdA(S458A) mutation in plasmid pHL129 was then introduced into the nsdA mutants to test for complementation (Fig. 4B). YX2/pHL129 and LW9/pHL129 still overproduced Act, just as YX2, LW9, and the vector controls YX2/pHL127 and LW9/pHL127 did, whereas the wild-type nsdA gene (YX2/pHL128 and LW9/pHL128) restored Act production to the low level typical of the wild type. This indicated that nsdA(S458A) had lost its negative function and that the hydroxyl group in the conserved serine residue is required for this function.
FIG. 8.
Sequence alignment of the SXR site (shown in the dashed box) in several NsdA-like proteins.
NsdA belongs to a protein family that also includes a Streptomyces sporulation-associated regulator.
nsdA encodes a 500-amino-acid protein that shares 28% sequence identity with the Streptomyces griseus sporulation-associated protein P56 (2) and 31% identity (end to end) with the P56 orthologue SCO4114 of S. coelicolor. The S. coelicolor genome encodes three other proteins showing over 30% sequence identity with NsdA: SCO7252 (41%), SCO2192 (33%), and SCO4399 (32%). In the sequenced Streptomyces avermitilis genome (24), there is an orthologue with sequence identity over 80% to each of these NsdA-like proteins and NsdA itself. Streptomyces chartreusis, producing a potent antitumor agent chartreusin, contains an NsdA homologue ChaR2 (27% identity), whose gene is inside the chartreusin gene cluster (49). Blast searching indicated that besides Streptomyces, several other actinomycetes (i.e., cellulolytic Thermobifida fusca, GenBank accession number NC_007333; symbiotic nitrogen-fixing Frankia sp. strain NC_007777 and NZ_AAII00000000; and the causative agent of nocardiosis, Nocardia farcinica, NC_006361) contain NsdA homologues. NsdA contains a conserved domain, DUF921, that is defined as a Streptomyces protein domain of unknown function. Proteins containing the DUF921 domain include several putative regulatory proteins from S. coelicolor and S. griseus (35). A search in the Superfamily server also revealed that NsdA, P56, and other homologous proteins in S. coelicolor and S. avermitilis have tetratricopeptide repeat (TPR)-like repeats (19) which mediate protein-protein interactions (13).
The S. griseus orf1590, which encodes P56 (see above), was discovered as a suppressor of the morphological deficiencies of certain bld mutants of S. griseus (2, 29) and renamed to nrsA due to its negative role on sporulation (37). The nrsA counterpart in S. coelicolor is SCO4114 (91% sequence identity at the amino acid level). When present at a high copy number, SCO4114 suppressed the morphological deficiency of bld mutants of S. griseus (38), implying it as well plays a role in sporulation.
To investigate this further, we constructed SCO4114-null mutants LW6 and LW4 from M145 and M600, respectively, by replacing the entire open reading frame with the streptomycin/spectinomycin resistance cassette (aadA) by using the PCR-targeting strategy (20). When cultured on solid MS, R2YE, and MM media, LW6 and LW4 were indistinguishable from the parent strains in sporulation and pigment production (data not shown), suggesting that SCO4114 is not essential for growth and does not negatively regulate differentiation in S. coelicolor, as had been proposed previously (37). Alternatively, any negative regulatory effects of SCO4114 may be masked by other effects of culture conditions or additional negative regulators.
The NsdA orthologue SAV2652 in S. avermitilis showed 84% amino acid identity with NsdA in S. coelicolor. To investigate the function of this gene, we amplified a fragment containing this gene from the total DNA of S. avermitilis and inserted it into pHL127. The resulting plasmid pHL561 was conjugated to LW9, the nsdA-null mutant strain. We observed that pHL561 can complement the phenotype of LW9 to the wild-type level just like pHL128 can (carrying nsdA from S. coelicolor). This indicated that SAV2652 in S. avermitilis may function like nsdA in S. coelicolor.
DISCUSSION
In this study, nsdA (SCO5582) in S. coelicolor was identified by gene dosage effects and gene disruption as a gene negatively affecting antibiotic production and sporulation. The repressing effect was obvious even when the supernumerary gene was introduced on plasmids that integrate at the prophage ΦC31 attachment site (data not shown). Such insertions usually involve one or sometimes two tandem copies. This implies that the natural effective levels of NsdA must be very precisely controlled.
The disruption of nsdA resulted in higher productions of Act, CDA, Mmy, and spores. actII-orf4 mRNA was increased in an nsdA mutant, suggesting that the negative effect of nsdA on Act biosynthesis was exerted at the level of transcription of the pathway-specific activator gene. A newly identified transcription factor AtrA (48), which activated actII-orf4, is a potential target of a NsdA-controlling pathway on Act. Possibly, NsdA causes a deficiency in the transcription of other cluster-situated genes, such as cdaR (homologous to actII-orf4 and redD) in the case of CDA (42) and mmyB in the case of methylenomycin (40).
Despite the negative effects of extra copies of nsdA on antibiotic production and sporulation, aerial mycelium formation was delayed, rather than accelerated, in nsdA-null mutants. The cause of this paradox remains to be elucidated. Possible explanations might lie either in the redirection of nutrients and energy to antibiotic production at the expense of aerial growth or in the complexity of cross-regulation between secondary metabolism and morphological differentiation, as indicated by microarray experiments (23) and the complex phenotypes of mutants (32). Since the disruption of nsdA did not completely abolish aerial mycelium formation, it can be regarded as important but not essential for development.
Huang's microarray data (23) had suggested that the expression of nsdA (SC7A1.26) was up-regulated from about 32 h after inoculating on the surface of R5 medium. Our results showed that its expression was also growth-phase dependent in SMMS medium: unexpectedly, it was expressed mainly in the aerial mycelium. Antibiotic production generally appears to be confined to the older substrate mycelium, as exemplified by redD, the pathway-specific regulator of RED, which was expressed in only ageing substrate mycelium (46). Thus, one role of nsdA may be to suppress antibiotic production in aerial mycelium.
NsdA belongs to a protein family containing a function-unknown domain, DUF921, which is so far found in only streptomycetes and several other actinomycetes. One member of this family, the S. griseus P56 protein, which is thought to be involved in the regulation of sporulation, contains a typical helix-turn-helix motif in its amino-terminal region (2). However, NsdA does not contain a helix-turn-helix DNA binding domain, leaving open the question of whether NsdA works via binding to its target gene. NsdA also has a TPR-like domain, which may mediate protein-protein interactions. Another TPR-containing protein TcrA related to secondary metabolism of S. coelicolor has recently been reported (33). We are currently using an E. coli two-hybrid system to seek NsdA-interacting proteins. The disruption of another member of this gene family, SCO4114, which had previously been shown to prevent premature sporulation septation of another streptomycetes organism (S. griseus), had no obvious phenotypic effects on S. coelicolor. Possibly, there are differences in the way that different members of this paralogous family are deployed in the two species. Other differences in the central regulation of their sporulation have been described previously (11). These may perhaps account for the comparatively rapid and synchronous sporulation of S. griseus and its ability to sporulate in submerged culture.
Acknowledgments
This work was supported by grants from National Natural Science Foundation of China (NSFC; no. 30200005), from the Youth Chengguang Project of Science and Technology of Wuhan City of China to M. Tao, and by a Joint Project grant from the Royal Society and NSFC to K. Chater and Z. Deng.
Footnotes
Published ahead of print on 13 October 2006.
REFERENCES
- 1.Anderson, T. B., P. Brian, and W. C. Champness. 2001. Genetic and transcriptional analysis of absA, an antibiotic gene cluster-linked two-component system that regulates multiple antibiotics in Streptomyces coelicolor. Mol. Microbiol. 39:553-566. [DOI] [PubMed] [Google Scholar]
- 2.Babcock, M. J., and K. E. Kendrick. 1990. Transcriptional and translational features of a sporulation gene of Streptomyces griseus. Gene 95:57-63. [DOI] [PubMed] [Google Scholar]
- 3.Bentley, S. D., K. F. Chater, A. M. Cerdeno-Tarraga, G. L. Challis, N. R. Thomson, K. D. James, D. E. Harris, M. A. Quail, H. Kieser, D. Harper, A. Bateman, S. Brown, G. Chandra, C. W. Chen, M. Collins, A. Cronin, A. Fraser, A. Goble, J. Hidalgo, T. Hornsby, S. Howarth, C. H. Huang, T. Kieser, L. Larke, L. Murphy, K. Oliver, S. O'Neil, E. Rabbinowitsch, M. A. Rajandream, K. Rutherford, S. Rutter, K. Seeger, D. Saunders, S. Sharp, R. Squares, S. Squares, K. Taylor, T. Warren, A. Wietzorrek, J. Woodward, B. G. Barrell, J. Parkhill, and D. A. Hopwood. 2002. Complete genome sequence of the model actinomycete Streptomyces coelicolor A3(2). Nature 417:141-147. [DOI] [PubMed] [Google Scholar]
- 4.Bibb, M. 1996. 1995 Colworth Prize Lecture. The regulation of antibiotic production in Streptomyces coelicolor A3(2). Microbiology 142:1335-1344. [DOI] [PubMed] [Google Scholar]
- 5.Bignell, D. R., J. L. Warawa, J. L. Strap, K. F. Chater, and B. K. Leskiw. 2000. Study of the bldG locus suggests that an anti-anti-sigma factor and an anti-sigma factor may be involved in Streptomyces coelicolor antibiotic production and sporulation. Microbiology 146:2161-2173. [DOI] [PubMed] [Google Scholar]
- 6.Blondelet-Rouault, M. H., J. Weiser, A. Lebrihi, P. Branny, and J. L. Pernodet. 1997. Antibiotic resistance gene cassettes derived from the omega interposon for use in E. coli and Streptomyces. Gene 190:315-317. [DOI] [PubMed] [Google Scholar]
- 7.Champness, W., P. Riggle, T. Adamidis, and P. Vandervere. 1992. Identification of Streptomyces coelicolor genes involved in regulation of antibiotic synthesis. Gene 115:55-60. [DOI] [PubMed] [Google Scholar]
- 8.Chang, H. M., M. Y. Chen, Y. T. Shieh, M. J. Bibb, and C. W. Chen. 1996. The cutRS signal transduction system of Streptomyces lividans represses the biosynthesis of the polyketide antibiotic actinorhodin. Mol. Microbiol. 21:1075-1085. [PubMed] [Google Scholar]
- 9.Chater, K. F. 1993. Genetics of differentiation in Streptomyces. Annu. Rev. Microbiol. 47:685-713. [DOI] [PubMed] [Google Scholar]
- 10.Chater, K. F. 2001. Regulation of sporulation in Streptomyces coelicolor A3(2): a checkpoint multiplex? Curr. Opin. Microbiol. 4:667-673. [DOI] [PubMed] [Google Scholar]
- 11.Chater, K. F., and S. Horinouchi. 2003. Signaling early developmental events in two highly diverged Streptomyces species. Mol. Microbiol. 48:9-15. [DOI] [PubMed] [Google Scholar]
- 12.Combet, C., C. Blanchet, C. Geourjon, and G. Deleage. 2000. NPS@: network protein sequence analysis. Trends Biochem. Sci. 25:147-150. [DOI] [PubMed] [Google Scholar]
- 13.D'Andrea, L. D., and L. Regan. 2003. TPR proteins: the versatile helix. Trends Biochem. Sci. 28:655-662. [DOI] [PubMed] [Google Scholar]
- 14.Eccleston, M., R. A. Ali, R. Seyler, J. Westpheling, and J. Nodwell. 2002. Structural and genetic analysis of the BldB protein of Streptomyces coelicolor. J. Bacteriol. 184:4270-4276. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Elliot, M., F. Damji, R. Passantino, K. Chater, and B. Leskiw. 1998. The bldD gene of Streptomyces coelicolor A3(2): a regulatory gene involved in morphogenesis and antibiotic production. J. Bacteriol. 180:1549-1555. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Fernández-Moreno, M. A., J. L. Caballero, D. A. Hopwood, and F. Malpartida. 1991. The act cluster contains regulatory and antibiotic export genes, direct targets for translational control by the bldA tRNA gene of Streptomyces. Cell 66:769-780. [DOI] [PubMed] [Google Scholar]
- 17.Fernández-Moreno, M. A., A. J. Martin-Triana, E. Martinez, J. Niemi, H. M. Kieser, D. A. Hopwood, and F. Malpartida. 1992. abaA, a new pleiotropic regulatory locus for antibiotic production in Streptomyces coelicolor. J. Bacteriol. 174:2958-2967. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Flett, F., V. Mersinias, and C. P. Smith. 1997. High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting streptomycetes. FEMS Microbiol. Lett. 155:223-229. [DOI] [PubMed] [Google Scholar]
- 19.Gough, J., K. Karplus, R. Hughey, and C. Chothia. 2001. Assignment of homology to genome sequences using a library of hidden Markov models that represent all proteins of known structure. J. Mol. Biol. 313:903-919. [DOI] [PubMed] [Google Scholar]
- 20.Gust, B., G. L. Challis, K. Fowler, T. Kieser, and K. F. Chater. 2003. PCR-targeted Streptomyces gene disruption identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc. Natl. Acad. Sci. USA 100:1541-1546. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Horinouchi, S., and T. Beppu. 1992. Regulation of secondary metabolism and cell differentiation in Streptomyces: A-factor as a microbial hormone and the AfsR protein as a component of a two-component regulatory system. Gene 115:167-172. [DOI] [PubMed] [Google Scholar]
- 22.Horinouchi, S., O. Hara, and T. Beppu. 1983. Cloning of a pleiotropic gene that positively controls biosynthesis of A-factor, actinorhodin, and prodigiosin in Streptomyces coelicolor A3(2) and Streptomyces lividans. J. Bacteriol. 155:1238-1248. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Huang, J., J. Shi, V. Molle, B. Sohlberg, D. Weaver, M. J. Bibb, N. Karoonuthaisiri, C. J. Lih, C. M. Kao, M. J. Buttner, and S. N. Cohen. 2005. Cross-regulation among disparate antibiotic biosynthetic pathways of Streptomyces coelicolor. Mol. Microbiol. 58:1276-1287. [DOI] [PubMed] [Google Scholar]
- 24.Ikeda, H., J. Ishikawa, A. Hanamoto, M. Shinose, H. Kikuchi, T. Shiba, Y. Sakaki, M. Hattori, and S. Omura. 2003. Complete genome sequence and comparative analysis of the industrial microorganism Streptomyces avermitilis. Nat. Biotechnol. 21:526-531. [DOI] [PubMed] [Google Scholar]
- 25.Ingram, C., M. Brawner, P. Youngman, and J. Westpheling. 1989. xylE functions as an efficient reporter gene in Streptomyces spp.: use for the study of galP1, a catabolite-controlled promoter. J. Bacteriol. 171:6617-6624. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Ishizuka, H., S. Horinouchi, H. M. Kieser, D. A. Hopwood, and T. Beppu. 1992. A putative two-component regulatory system involved in secondary metabolism in Streptomyces spp. J. Bacteriol. 174:7585-7594. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Kieser, T., M. J. Bibb, M. J. Buttner, K. F. Chater, and D. A. Hopwood. 2000. Practical Streptomyces genetics. John Innes Foundation, Norwich, United Kingdom.
- 28.Kishimoto, A., K. Nishiyama, H. Nakanishi, Y. Uratsuji, H. Nomura, Y. Takeyama, and Y. Nishizuka. 1985. Studies on the phosphorylation of myelin basic protein by protein kinase C and adenosine 3′:5′-monophosphate-dependent protein kinase. J. Biol. Chem. 260:12492-12499. [PubMed] [Google Scholar]
- 29.Kudo, N., M. Kimura, T. Beppu, and S. Horinouchi. 1995. Cloning and characterization of a gene involved in aerial mycelium formation in Streptomyces griseus. J. Bacteriol. 177:6401-6410. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Kuhstoss, S., and R. N. Rao. 1991. Analysis of the integration function of the streptomycete bacteriophage ΦC31. J. Mol. Biol. 222:897-908. [DOI] [PubMed] [Google Scholar]
- 31.Li, X., X. Zhou, and Z. Deng. 2003. Vector systems allowing efficient autonomous or integrative gene cloning in Micromonospora sp. strain 40027. Appl. Environ. Microbiol. 69:3144-3151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Liu, G., Y. Tian, H. Yang, and H. Tan. 2005. A pathway-specific transcriptional regulatory gene for nikkomycin biosynthesis in Streptomyces ansochromogenes that also influences colony development. Mol. Microbiol. 55:1855-1866. [DOI] [PubMed] [Google Scholar]
- 33.Liu, J. M., and K. Q. Yang. 2006. Functional analyses of TcrA—a TPR-containing regulatory protein in Streptomyces coelicolor A3(2). Wei Sheng Wu Xue Bao 46:33-37. [PubMed] [Google Scholar]
- 34.MacNeil, D. J., J. L. Occi, K. M. Gewain, T. MacNeil, P. H. Gibbons, C. L. Ruby, and S. J. Danid. 1992. Complex organization of the Streptomyces avermitilis genes encoding the avermectin polyketide synthetase. Gene 115:119-125. [DOI] [PubMed] [Google Scholar]
- 35.Marchler-Bauer, A., J. B. Anderson, C. DeWeese-Scott, N. D. Fedorova, L. Y. Geer, S. He, D. I. Hurwitz, J. D. Jackson, A. R. Jacobs, C. J. Lanczycki, C. A. Liebert, C. Liu, T. Madej, G. H. Marchler, R. Mazumder, A. N. Nikolskaya, A. R. Panchenko, B. S. Rao, B. A. Shoemaker, V. Simonyan, J. S. Song, P. A. Thiessen, S. Vasudevan, Y. Wang, R. A. Yamashita, J. J. Yin, and S. H. Bryant. 2003. CDD: a curated Entrez database of conserved domain alignments. Nucleic Acids Res. 31:383-387. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Matsumoto, A., S. K. Hong, H. Ishizuka, S. Horinouchi, and T. Beppu. 1994. Phosphorylation of the AfsR protein involved in secondary metabolism in Streptomyces species by a eukaryotic-type protein kinase. Gene 146:47-56. [DOI] [PubMed] [Google Scholar]
- 37.McCue, L. A., J. Kwak, J. Wang, and K. E. Kendrick. 1996. Analysis of a gene that suppresses the morphological defect of bald mutants of Streptomyces griseus. J. Bacteriol. 178:2867-2875. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.McCue, L. A., J. Kwak, M. J. Babcock, and K. E. Kendrick. 1992. Molecular analysis of sporulation in Streptomyces griseus. Gene 115:173-179. [DOI] [PubMed] [Google Scholar]
- 39.Onaka, H., N. Ando, T. Nihira, Y. Yamada, T. Beppu, and S. Horinouchi. 1995. Cloning and characterization of the A-factor receptor gene from Streptomyces griseus. J. Bacteriol. 177:6083-6092. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.O'Rourke, S. 2004. Regulation of methylenomycin production in Streptomyces coelicolor. Ph.D. thesis. University of East Anglia, Norwich, United Kingdom.
- 41.Redenbach, M., H. M. Kieser, D. Denapaite, A. Eichner, J. Cullum, H. Kinashi, and D. A. Hopwood. 1996. A set of ordered cosmids and a detailed genetic and physical map for the 8 Mb Streptomyces coelicolor A3(2) chromosome. Mol. Microbiol. 21:77-96. [DOI] [PubMed] [Google Scholar]
- 42.Ryding, N. J., T. B. Anderson, and W. C. Champness. 2002. Regulation of the Streptomyces coelicolor calcium-dependent antibiotic by absA, encoding a cluster-linked two-component system. J. Bacteriol. 184:794-805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning. A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- 44.Sola-Landa, A., R. S. Moura, and J. F. Martin. 2003. The two-component PhoR-PhoP system controls both primary metabolism and secondary metabolite biosynthesis in Streptomyces lividans. Proc. Natl. Acad. Sci. USA 100:6133-6138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45.Strauch, E., E. Takano, H. A. Baylis, and M. J. Bibb. 1991. The stringent response in Streptomyces coelicolor A3(2). Mol. Microbiol. 5:289-298. [DOI] [PubMed] [Google Scholar]
- 46.Sun, J., G. H. Kelemen, J. M. Fernandez-Abalos, and M. J. Bibb. 1999. Green fluorescent protein as a reporter for spatial and temporal gene expression in Streptomyces coelicolor A3(2). Microbiology 145:2221-2227. [DOI] [PubMed] [Google Scholar]
- 47.Takano, E., R. Chakraburtty, T. Nihira, Y. Yamada, and M. J. Bibb. 2001. A complex role for the γ-butyrolactone SCB1 in regulating antibiotic production in Streptomyces coelicolor A3(2). Mol. Microbiol. 41:1015-1028. [DOI] [PubMed] [Google Scholar]
- 48.Uguru, G. C., K. E. Stephens, J. A. Stead, J. E. Towle, S. Baumberg, and K. J. McDowall. 2005. Transcriptional activation of the pathway-specific regulator of the actinorhodin biosynthetic genes in Streptomyces coelicolor. Mol. Microbiol. 58:131-150. [DOI] [PubMed] [Google Scholar]
- 49.Xu, Z., K. Jakobi, K. Welzel, and C. Hertweck. 2005. Biosynthesis of the antitumor agent chartreusin involves the oxidative rearrangement of an anthracyclic polyketide. Chem. Biol. 12:579-588. [DOI] [PubMed] [Google Scholar]



