Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2006 Dec 12.
Published in final edited form as: J Virol Methods. 2005 Jun;126(1-2):13–20. doi: 10.1016/j.jviromet.2005.01.016

Virus-inducible reporter genes as a tool for detecting and quantifying influenza A virus replication

Andrew Lutz 1, Julie Dyall 2, Paul D Olivo 2, Andrew Pekosz 1,*
PMCID: PMC1698269  NIHMSID: NIHMS14021  PMID: 15847914

Summary

The use of influenza A virus-inducible reporter gene segments in detecting influenza A virus replication was investigated. The RNA polymerase I promoter/terminator cassette was used to express RNA transcripts encoding green fluorescence protein or firefly luciferase flanked by the untranslated regions of the influenza A/WSN/33 NP segment. Reporter gene activity was detected after reconstitution of the influenza A virus polymerase complex from cDNA or after virus infection, and was influenza A virus-specific. Reporter gene activity could be detected as early as 6 hours post infection and was virus dose-dependent. Inhibitory effects of antibodies or amantadine could be detected a nd quantified rapidly, providing a means of not only identifying influenza A virus -specific replication, but of determining the antigenic subtype as well as antiviral drug susceptibility. Induction of virus-specific reporter genes provides a rapid, sensitive method for detecting virus replication, quantifying virus titers and assessing antiviral sensitivity as well as antigenic subtype.

Keywords: influenza, diagnostics, reporter gene, cell culture

Abbreviations: PCR, polymerase chain reaction; NP, nucleoprotein; vRNPs, viral ribonucleoprotein; UTRs, untranslated regions; VIRGS virus inducible reporter gene segment; luc, firefly luciferase; GFP, green fluorescent protein; FluA, influenza A virus; MDCK, Madin-Darby canine kidney cells; 293T, human embryonal kidney cells; BHK-21, baby hamster kidney cells; DMEM, Dulbecco’s modified Eagle’s medium; FBS, fetal bovine serum; PFU, plaque -forming unit; PBS, phosphate -buffered saline; hpi, hours post infection; RSV, respiratory syncytial virus; IC 50, 50%; inhibitory concentration; pol I P, RNA polymerase I promoter; pol I T, RNA polymerase I terminator; MOI, multiplicity of infection; LAC, La Crosse virus; h, hours

1. Introduction

Influenza A, B and C viruses are the causative agents of influenza, a disease that results in over 36,000 deaths and 114,000 hospitalizations annually in the United States alone (Thompson et al., 2003). The availability of antiviral drugs has resulted in an increased need for rapid techniques that can reliably diagnose influenza infection (Ruest et al., 2003; Storch, 2003).

Virus isolation by cell culture, followed by antigen-specific immunofluorescence has been the most widely used method for identifying viruses from patient samples (Ogilvie, 2001). The technique relies on the availability of permissive cell lines and antibodies capable of recognizing viral proteins. Virus isolation often takes several days due to the presence of very low amounts of virus in the sample, and antibodies capable of detecting antigenic variants are not always available. Direct, rapid antigen detection techniques have been developed to reduce the time and complexity of viral diagnosis (Storch, 2003; Uyeki, 2003). Although they have the potential to become standard methodology, some questions exist about the sensitivity and reliability of the tests (Landry and Ferguson, 2003; Ruest et al., 2003). Finally, nucleic acid-based techniques such as real time multiplex PCR (Ellis and Zambon, 2002; Yang and Rothman, 2004) or microarrays (Kessler et al., 2004; Wang et al., 2002) can provide specific, sensitive and rapid diagnosis of clinical samples but are expensive and require significant expertise.

Virus detection using cell lines expressing reporter genes under the control of virus-derived promoters combines the sensitivity of virus culture with the rapid detection provided by reporter genes (Olivo, 1996). Subgenomic RNAs containing virus -inducible reporter genes have been described for several RNA viruses (Kohl et al., 2004; Lo et al., 2003; Muhlberger et al., 1998; Olivo et al., 1998; Olivo et al., 1994) and a test kit utilizing a herpes simplex type 1-responsive gene is commercially available (Stabell et al., 1993; Tebas et al., 1998). The inherent enzymatic or fluorescence activity of the reporter gene precludes the need for antigen- or sequence-specific reagents and the use of cis-acting promoter elements that are highly conserved among virus strains provides the requisite specificity.

Influenza A, B and C viruses are Orthomyxoviridae family viruses that possess a single -stranded, negative sense RNA genome consisting of eight (influenza A and B viruses) or seven (influenza C virus) distinct segments (Lamb and Krug, 2001; Wright and Webster, 2001). Genome replication and transcription occurs in the host cell nucleus and requires a polymerase complex (consisting of the PA, PB1 and PB2 proteins) and the nucleoprotein (NP) in addition to viral RNA (Huang et al., 1990). Binding of NP to the influenza A virus genomic RNA segments forms the viral ribonucleoprotein (vRNP) complexes that can be recognized by the viral polymerase. The untranslated regions (UTRs) at the 5’ and 3’ termini of genomic segments are conserved and have been shown to be necessary and sufficient cis-acting elements for RNA replication and transcription of viral (Catchpole et al., 2003; Fodor et al., 1999; Fodor et al., 1998; Neumann et al., 1999; Neumann et al., 1994; Zobel et al., 1993) as well as nonviral or reporter genes (Azzeh et al., 2001; Enami et al., 1991; Flick et al., 1996; Neumann and Hobom, 1995). In this report, we describe the application of influenza A virus -specific, virus-inducible reporter gene segments (VIRGS) to the detection and quantitation of influenza A virus.

2. Materials and Methods

2.1.Plasmids and reporter gene construction

Firefly luciferase (luc) or enhanced Green Fluorescent Protein (GFP) reporter gene constructs were generated by PCR using the following primers:

Luc 1 – 5’ ATACGTCTCGGGG

AGTAGAAACAGGGTAGATAATCACTCACTGAGTGACATCGGT

AAAATGGAAGACGCCAAAAACATAAAG

Luc 2 - 5’ ATACGTCTCATATT AGTAGAAACAAGGGTATTTTTCT

TTACAATTTGGACTTTCCGCCC

GFP 1 – 5’ ATACGTCTCGGGG

AGTAGAAACAGGGTAGATAATCACTCACTGAGTGACATCGGT

ACCATGGTGAGCAAGGGCGAGG

GFP 2 – 5’ ATACGTCTCATATT AGTAGAAACAAGGGTATTTTTCT

TTACTTGTACAGCTCGTCC

The italicized portion of the primer corresponds to sequences within the coding region of the reporter gene. The remaining 5’ sequences of the primer are necessary for cloning (underlined) into the RNA polymerase I expression vector pHH21 (Neumann et al., 1999) or correspond to the untranslated regions of the A/WSN/33 NP segment (bold). Polymerase chain reaction (PCR) was performed using Vent polymerase (New England Biolabs, Beverly, MA) and annealing/extension conditions predicted by Primer Designer v. 4 (Sci Ed Central, Durham, NC). PCR products were digested with BsmBI, ligated into BsmBI digested pHH21 and plasmids containing the luc (FluA luc) or GFP (FluA GFP) insert were sequenced to ensure the absence of unwanted nucleotide changes.

For generating stable cell lines expressing FluA luc, the FluA luc plasmid was digested with Nhe I and Pci I restriction enzymes. The DNA fragment containing the RNA polymerase I promoter, the reporter gene construct and the RNA polymerase I terminator was purified using the QIAquick gel extraction kit (Qiagen, Valencia, CA) and blunt ended with Klenow enzyme (New England Biolabs, Beverly, MA). The DNA fragment was then cloned into Pvu II-digested pREP4 (Invitrogen, Carlsbad, CA) generating pREP4-FluA luc.

Plasmids encoding the PA, PB1, PB2 (Neumann et al., 1999) and NP (Takeda et al., 2002) proteins have been described previously.

2.2. Cells

Madin-Darby canine kidney (MDCK) cells, human embryonal kidney (293T) cells and baby hamster kidney (BHK-21) cells were obtained from the American Type Culture Center (ATCC, Manassas, VA) and cultured in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (FBS, Atlanta Biologicals, Atlanta, GA), 100 units/ml penicillin (Invitrogen, Carlsbad, CA), and 100 μg/ml streptomycin (Invitrogen, Carlsbad, CA) and incubated in a 95% air/5% CO2 humidified incubator. For transfection of 293T cells, the TransIT-LT1 (Mirus, Madison, WI) reagent was used according to manufacturer’s instructions at a ratio of 2 μl transfection reagent per 1 μg of plasmid DNA. Transfection efficiencies of >80% percent are routinely achieved with 293T cells in our hands. Stable cell lines expressing FluA luc were generated by transfecting pREP4 – FluA luc into 293T cells and selecting with 150 μg/ml hygromycin for 14 days. The uncloned cell population was used for all experiments.

2.3. Viruses and Infections

Infections with influenza A virus strains A/WSN/33(H1N1), A/Udorn/72(H3N2), A/Hong Kong/68(H3N2) and influenza B/Yamagata/16/88 virus were performed as previously described (Paterson and Lamb, 1993). Infections with influenza C/Jerusalem/99 virus were performed as previously described (Pekosz and Lamb, 1997). Infections with La Crosse virus were performed as previously described (Pekosz et al., 1995). Influenza A and B virus titers were determined on MDCK cells while La Crosse virus titers were determined on BHK-21 cells. Mock infections are performed with media alone.

Inhibition of influenza A virus infection with amantadine was assessed by incubating 293T cells with varying concentrations of amantadine for 15 minutes before the addition of either 105 plaque forming units (PFU) or 10-fold serial dilutions of influenza A/Udorn/72 virus. After a one hour incubation, the cells were washed in phosphate buffered saline (PBS), then incubated overnight at 37°C in DMEM with 1 μg /ml N-acetyl trypsin containing amantadine.

For antibody neutralization studies, 10,000 PFU of influenza A/WSN/33 was incubated with various dilutions of polyclonal goat anti-H0 A/PR/8/34 (NIAID reference reagent V-314-511-157) that recognizes the H1 subtype. All dilutions were made in DMEM. After a one-hour incubation, the virus-antibody mixture was added to 293T cells that had been transfected with the FluA luc plasmid. The cells were then plated into a 96 well tissue culture dish and incubated for 6 hours at 37°C in DMEM with 10% FBS before luciferase activity was measured.

2.4. Flow cytometry

A dual laser excitation FACSCalibur (Becton Dickinson, San Jose, CA) was used to analyze the samples. Data were analyzed using CellQuest software (Becton Dickinson, San Jose, CA). All GFP experiments were performed at least three times and a representative histogram is shown.

2.5. Luciferase assays

Cell lysates were analyzed for luciferase activity using the Luciferase Assay System (Promega, Madison, WI) and a Lumax luminometer (Molecular Technologies, Phillipsburg, NJ). Values at each timepoint were analyzed in triplicate and graphed with standard deviations.

3. Results

3.1. Detection of influenza A virus polymerase activity using viral UTR driven-reporter genes

Expression of foreign genes under control of influenza A virus promoters has been used to study cis- and trans-acting elements required for viral replication (Enami et al., 1991; Neumann and Hobom, 1995; Watanabe et al., 2003; Zobel et al., 1993). We constructed artificial RNA segments encoding green fluorescent protein (FluA GFP) or firefly luciferase (Flu A luc) under control of the influenza A/WSN/33 NP segment UTRs (Figure 1A). These artificial RNA segments were cloned into the RNA polymerase I promoter/terminator cassette present in the pHH21 vector in order to produce RNA transcripts containing no additional nucleotide sequences or modifications at either the 5’ or 3’ end (Neumann et al., 1999; Zobel et al., 1993).

Figure 1.

Figure 1

Open in a new tab

Construction and characterization of influenza A virus responsive reporter gene constructs. (A) Schematic of the FluA reporter constructs. The GFP (FluA GFP) or luciferase (FluA luc) open reading frames were cloned in place of the influenza A virus NP protein (in the negative sense, as shown by the inverted and backwards text), conserving the 5’ and 3’ untranslated regions (UTRs). The entire construct was then cloned between the human RNA polymerase I promoter (pol I P) and murine RNA polymerase I terminator (pol I T). (B) 293T cells transfected with FluA luc were mock-infected or infected with influenza A/WSN/33 (MOI=2.0). 293T cells were co-transfected with plasmids encoding the influenza polymerase proteins (PA, PB1, PB2), the nucleoprotein (NP) and the FluA luc plasmid to reconstitute the viral polymerase (Luc viral polymerase lane). 24 hours later, the cells were harvested and analyzed for luciferase activity. (C) 293T cells were transfected with FluA GFP and the indicated plasmids. 24 hours post-transfection, the cells were analyzed for GFP fluorescence by flow cytometry. MCF stands for the mean channel fluorescence of the cell population, FL 1-H is GFP fluorescence and counts indicate the number of cells with the indicated fluorescence intensity. (D-F) 293T cells were transfected with FluA GFP (thick line) or an empty vector (thin line) and infected 24 hours post-transfection with (D) A/WSN/33, (E) A/Udorn/72 or (F) A/Hong Kong/68 at an MOI of approximately 2.0. 18 hours post infection (hpi) the cells were analyzed for GFP fluorescence by flow cytometry.

VIRGS activity was detected by reconstituting the influenza A virus polymerase from cDNA. 293T cells transfected with FluA luc and plasmids expressing PA, PB1, PB2 and NP (Perez and Donis, 1998; Takeda et al., 2002) contained high levels of luciferase activity when compared to cells transfected with FluA luc alone (Figure 1B). The FluA GFP construct was analyzed in a similar fashion, using flow cytometry to detect and quantify fluorescence. Expression of the four influenza A viral polymerase proteins led to increased GFP expression in FluA GFP-transfected cells when compared to cells transfected with FluA GFP alone, or when the plasmid encoding the NP protein was omitted from the transfection (Figure 1C).

The ability of influenza A virus infection to drive luciferase production was assessed by infecting FluA luc-transfected 293T cells with influenza A/WSN/33 virus at 24 hours post transfection. Infection with influenza A virus led to a nearly 300-fold increase in luciferase activity when compared to mock-infected cells (Figure 1B). The background luciferase signal in untransfected cells was similar to Flu A luc-transfected cells, indicating no significant luciferase protein expression from the construct in the absence of an authentic influenza A virus polymerase (data not shown). Three influe nza A virus strains, A/WSN/33, A/Udorn/72 and A/Hong Kong/68 were then tested and all three viruses induced comparable levels of GFP expression in FluA GFP-transfected cells (Figure 1D-F).

The specificity of the VIRGS was determined by infecting FluA luc -transfected-293T cells with four different viruses (Figure 2A). Infection with either influenza C virus or the bunyavirus La Crosse virus did not stimulate a significant increase in luciferase activity relative to mock-infected cells. Infection with influenza B virus resulted in a modest 5 -fold increase in luciferase activity while influenza A virus infection resulted in a >500-fold increase in activity (Figure 2A). All infected cultures showed evidence of an active infection as judged by cytopathic effect, viral antigen expression and/or infectious virus production (data not shown). When the FluA GFP construct was tested for activity in response to influenza A or B virus infection (Figure 2B), virtually no GFP signal was detected in influenza B virus -infected cells. This data indicates the FluA luc and FluA GFP reporter gene activity is specifically activated by the influenza A virus polymerase complex.

Figure 2.

Figure 2

Open in a new tab

Specificity of the FluA luc and GFP constructs. (A) 293T cells were transfected with FluA luc and infected at 24 hours post-transfection with influenza A/WSN/33 (Flu A), influenza B/Yamagata/16/88 Flu B), influenza C/Jerusalem/99 (Flu C) or La Crosse virus (LAC). The cells were analyzed for luciferase activity 24 hours post infection. (B) 293T cells transfected with FluA GFP were infected at an MOI of approximately 2.0 with influenza A/WSN/33 virus (dashed line) or influenza B/Yamagata/16/88 virus (thin, solid line) or mock-infected (thick, solid line) and analyzed for GFP fluorescence by flow cytometry at 18-hpi.

3.2. Quantitation of influenza A virus replication

Transfection of the FluA luc construct into 293T cells led to efficient reporter gene expression after infection with influenza A virus. This implies that the viral polymerase can recognize and replicate the “naked” RNA present in FluA luc-transfected cells. This most likely occurs by association of the FluA luc RNA transcripts with NP protein made early in infection, thereby providing a suitable template that can be recognized by the viral polymerase. In contrast, infection with respiratory syncitial virus (RSV) did not stimulate reporter gene activity in cells expressing a reporter gene under control of the RSV cis-acting elements unless other components of the vRNP were provided in trans (Olivo et al., 1998). To determine if induction of the reporter gene activity could be altered by co-expression of the NP protein, 293T cells were transfected with FluA luc and a plasmid expressing the NP protein or the parental vector (pCAGGS). The cells were analyzed for luciferase activity at various times post infection. Co- expression of NP protein led to slightly lower background levels of luciferase activity, however, virus-induced luciferase activity was not affected by NP protein expression, indicating that preformed vRNPs did not significantly increase the VIRGS activity (Figure 3A).

Figure 3.

Figure 3

Open in a new tab

Detection limits and quantitation ranges for the FluA luc reporter gene assay. (A) 293T cells were transfected with FluA luc or FluA luc and a plasmid expressing the NP protein. 18 hours post-transfection, the cells were infected (solid lines) with 1x106 PFU of influenza A/WSN/33 (MOI=2.0) or mock-infected (dashed lines) and luciferase activity assayed at the indicated times post infection. (B) Approximately 4x105 293T cells transfected with FluA luc were infected with the indicated virus inoculum and cell lysates tested for luciferase activity at 6 or 24 hours post infection. Background fluorescence levels are indicated by the dashed (24h) or solid (6h) horizontal lines.

To further investigate the sensitivity of VIRGS, we transfected 4x105 293T cells with FluA luc, infected with varying quantities of influenza A virus and assayed luciferase activity at 6 and 24 hours post infection (Figure 3B). At 6 hours post infection (hpi), infection with 1000 PFU resulted in luciferase activity significantly above background levels and the linear range of quantitation was between 1x103 to 4x104 PFU. After incubation for 24 h, an input of 10 PFUs was detectable with a linear range of quantitation from 10 to 1x104 PFU. Taken together, these results indicate 293T cells transiently expressing VIRGS could be used in lieu of a plaque assay to quantitate the infectivity of influenza A virus samples of unknown titer.

3.3. The effect of antivirals and antisera on VIRGS activity

The FluA luc reporter gene system was then used to quantify influenza virus antiviral drug sensitivity. FluA luc -transfected 293T cells were infected with influenza A/Udorn/72 virus in the presence or absence of the antiviral drug amantadine. Amantadine inhibits the ion channel activity of the M2 protein, reducing the efficiency of virus entry (Hay et al., 1985; Pinto et al., 1992; Takeda et al., 2002). As shown in Figure 4A, luciferase activity was sensitive to the presence of very low concentrations of amantadine. The mean effective 50% inhibitory concentration (IC 50) was determined to be 0.21 μM, consistent with published values using other virus quantitation methods (Smee et al., 2002), and the inhibitory effect of amantadine was also detected over a large range of input virus concentrations using a 6- (Figure 4B) or 24-hpi (Figure 4C) timepoint.

Figure 4.

Figure 4

Open in a new tab

Assesing antiviral and neutralizing antibody activity using the FluA luc reporter system. (A) 293T cells transfected with FluA luc were infected with 1x105 PFU of A/Udorn/72 in the presence of varying concentrations of amantadine. At 6-hpi, the cells were analyzed for luciferase activity. Luciferase activity in untreated, infected-cells is indicated by the horizontal line. (B and C) 293T cells transfected with FluA luc were infected with various PFUs of influenza A/Udorn/72 in the presence or absence of 5 μM amantadine. Cell lysates were analyzed for luciferase activity at (B) 6- or (C) 24-hpi. (D) Influenza A/WSN/33 virus (10,000 PFU, MOI=2) was incubated with the indicated dilutions of a goat anti-H1 sera for 30 minutes, then added to 293T cells transfected with the FluA luc plasmid. Six hours post infection, the cell lysates were analyzed for luciferase activity.

To assess the utility of the FluA luc reporter gene in detecting neutralizing antibody titers, we incubated influenza A/WSN/33 with various concentrations of an NIH reference antibody specific for the H1 subtype. Figure 4D shows specific reduction in luciferase activity at 1:20 and 1:160 dilutions of the antibody, indicating the virus was neutralized.

3.4. Establishing a stably transfected cell line expressing VIRGS

Finally, we attempted to establish a stably-transfected cell line expressing a VIRGS. The FluA luc construct illustrated in Figure 1A was subcloned into the pREP4 vector (Invitrogen), transfected into 293T cells and selected with hygromycin. The uncloned cell population was infected with the indicated viruses and luciferase activity quantified 24-hpi (Figure 5). Consistent with the results obtained with transiently transfected cells, only infection with influenza A virus strains yielded luciferase activity significantly above background.

Figure 5.

Figure 5

Open in a new tab

A stable cell line expressing a VIRGS. 293T cells were stably transfected with the FluA luc construct, infected with the indicated viruses (MOI=2.0) and luciferase activity quantified at 24 ho urs post infection.

4. Discussion

The data demonstrate the utility of VIRGS in detecting virus replication, quantifying virus titers and assessing antiviral and neutralizing antibody sensitivities. The use of VIRGS in quantifying virus titers is especially appealing because it allows for more rapid, quantitative and sensitive detection of virus titers when compared to standard plaque assays. With little effort, a clinical virology laboratory with expertise in virus isolation could begin to utilize cells expressing VIRGS for routine clinical diagnostics using either a same-day or overnight incubation (see Figure 3B). VIRGS could also be used in parallel with an established virus detection procedure in order to confirm test results rapidly. As these assays are sequence- and strain-independent, they should be insensitive to the genetic drift and shift demonstrated by influenza A virus strains, thereby making them useful in identifying infections with rare or new influenza A virus strains. As all of our studies were performed with laboratory strains of viruses, it will be important to judge the effectiveness and efficiency of VIRGS in detecting virus in clinical specimens.

The utility of VIRGS in quantitating antiviral sensitivity could also be used in a clinical setting, either in combination with or immediately following a viral diagnostic test. The two classes of anti-influenza A virus compounds available currently are the ion channel blockers (amantadine or rimantadine) and the neuraminidase inhibitors (oseltamivir or zanamivir). It is well documented that amantadine- or rimantadine-resistant viruses are capable of causing disease and spreading person-to-person (Hayden and Hay, 1992; Iwahashi et al., 2001; Shiraishi et al., 2003). A recent study suggests that oseltamivir-resistant viruses can develop in humans, and patients harboring oseltamivir-resistant viruses can shed virus for significant amounts of time (Kiso et al., 2004). Although it is still unclear whether these viruses maintain their virulence and are transmissable, it does suggest that methods of screening for drug resistance should be put in place to monitor for the emergence of drug-resistant viruses.

The VIRGS we generated showed much greater sensitivity for influenza A virus versus influenza B and other viruses. The influenza B virus polymerase complex has been shown previously to replicate and transcribe RNA transcripts containing influenza A virus 5’ and 3’ UTRs (Crescenzo-Chaigne et al., 1999; Jackson et al., 2002; Jambrina et al., 1997; Muster et al., 1991), but in all cases the level of reporter gene expression was significantly reduced. Our results show even lower levels of VIRGS activity in response to influenza B virus infection. This may be a consequence of using the A/WSN/33 NP segment UTRs or perhaps a reduced ability of the influenza B/Yamagata/16/88 polymerase complex to recognize influenza A virus promoters. Virtually no GFP signal was detected in influenza B virus-infected, FluA GFP-transfected cells while low levels of luciferase activity were detected in influenza B virus-infected, FluA luc-transfected cells. The increased sensitivity of enzymatic reporter genes (luciferase) when compared to non-enzymatic reporter gene (GFP) is the most likely explanation for this result. Further testing with a variety of virus strains and isolates is required to confirm and extend this observation of influenza A virus- specificity.

VIRGS also provide a convenient and rapid system for identifying and characterizing new antiviral compounds. Drugs specifically targeting the viral polymerase could be identified by using reporter gene activity reconstituted by cDNA expression of influenza A virus polymerase proteins. Alternatively, drugs targeting other steps of the virus life cycle (e.g. entry, uncoating, interactions between viral proteins, virus assembly) could be identified by using the VIRG- expressing cell lines in combination with influenza A virus infection.

Acknowledgments

The pHH21 vector was kindly provided by Yoshi Kawaoka and Gerd Hobom. We thank Henry Huang for critical reading of the manuscript and the members of the Pekosz laboratory and Apath, LLC for insightful comments and discussions.

References

  1. Azzeh M, Flick R, Hobom G. Functional analysis of the influenza A virus cRNA promoter and construction of an ambisense transcription system. Virology. 2001;289(2):400–10. doi: 10.1006/viro.2001.1107. [DOI] [PubMed] [Google Scholar]
  2. Catchpole AP, Mingay LJ, Fodor E, Brownlee GG. Alternative base pairs attenuate influenza A virus when introduced into the duplex region of the conserved viral RNA promoter of either the NS or the PA gene. J Gen Virol. 2003;84(3):507–515. doi: 10.1099/vir.0.18795-0. [DOI] [PubMed] [Google Scholar]
  3. Crescenzo-Chaigne B, Naffakh N, van der Werf S. Comparative Analysis of the Ability of the Polymerase Complexes of Influenza Viruses Type A, B and C to Assemble into Functional RNPs that Allow Expression and Replication of Heterotypic Model RNA Templates In Vivo. Virology. 1999;265(2):342–353. doi: 10.1006/viro.1999.0059. [DOI] [PubMed] [Google Scholar]
  4. Ellis JS, Zambon MC. Molecular diagnosis of influenza. Rev Med Virol. 2002;12(6):375–89. doi: 10.1002/rmv.370. [DOI] [PubMed] [Google Scholar]
  5. Enami M, Sharma G, Benham C, Palese P. An influenza virus containing nine different RNA segments. Virology. 1991;185(1):291–8. doi: 10.1016/0042-6822(91)90776-8. [DOI] [PubMed] [Google Scholar]
  6. Flick R, Neumann G, Hoffmann E, Neumeier E, Hobom G. Promoter elements in the influenza vRNA terminal structure. Rna. 1996;2(10):1046–57. [PMC free article] [PubMed] [Google Scholar]
  7. Fodor E, Devenish L, Engelhardt OG, Palese P, Brownlee GG, Garcia-Sastre A. Rescue of influenza A virus from recombinant DNA. J Virol. 1999;73(11):9679–82. doi: 10.1128/jvi.73.11.9679-9682.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Fodor E, Palese P, Brownlee GG, Garcia-Sastre A. Attenuation of Influenza A Virus mRNA Levels by Promoter Mutations. J Virol. 1998;72(8):6283–6290. doi: 10.1128/jvi.72.8.6283-6290.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Hay AJ, Wolstenholme AJ, Skehel JJ, Smith MH. The molecular basis of the specific anti-influenza action of amantadine. Embo J. 1985;4(11):3021–4. doi: 10.1002/j.1460-2075.1985.tb04038.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Hayden F, Hay A. Emergence and transmission of influenza A viruses resistant to amantadine and rimantadine. Curr Top Microbiol Immunol. 1992;17:119–130. doi: 10.1007/978-3-642-77011-1_8. [DOI] [PubMed] [Google Scholar]
  11. Huang TS, Palese P, Krystal M. Determination of influenza virus proteins required for genome replication. J Virol. 1990;64(11):5669–73. doi: 10.1128/jvi.64.11.5669-5673.1990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Iwahashi J, Tsuji K, Ishibashi T, Kajiwara J, Imamura Y, Mori R, Hara K, Kashiwagi T, Ohtsu Y, Hamada N, Maeda H, Toyoda M, Toyoda T. Isolation of amantadine-resistant influenza a viruses (H3N2) from patients following administration of amantadine in Japan. J Clin Microbiol. 2001;39(4):1652–3. doi: 10.1128/JCM.39.4.1652-1653.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Jackson D, Cadman A, Zurcher T, Barclay WS. A Reverse Genetics Approach for Recovery of Recombinant Influenza B Viruses Entirely from cDNA. J Virol. 2002;76(22):11744–11747. doi: 10.1128/JVI.76.22.11744-11747.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Jambrina E, Barcena J, Uez O, Portela A. The Three Subunits of the Polymerase and the Nucleoprotein of Influenza B Virus Are the Minimum Set of Viral Proteins Required for Expression of a Model RNA Template, Virology. 1997;235(2):209–217. doi: 10.1006/viro.1997.8682. [DOI] [PubMed] [Google Scholar]
  15. Kessler N, Ferraris O, Palmer K, Marsh W, Steel A. Use of the DNA Flow-Thru Chip, a Three-Dimensional Biochip, for Typing and Subtyping of Influenza Viruses. J Clin Microbiol. 2004;42(5):2173–2185. doi: 10.1128/JCM.42.5.2173-2185.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Kiso M, Mitamura K, Sakai-Tagawa Y, Shiraishi K, Kawakami C, Kimura K, Hayden FG, Sugaya N, Kawaoka Y. Resistant influenza A viruses in children treated with oseltamivir: descriptive study. The Lancet. 2004;364(9436):759–765. doi: 10.1016/S0140-6736(04)16934-1. [DOI] [PubMed] [Google Scholar]
  17. Kohl A, Hart TJ, Noonan C, Royall E, Roberts LO, Elliott RM. A Bunyamwera Virus Minireplicon System in Mosquito Cells. J Virol. 2004;78(11):5679–5685. doi: 10.1128/JVI.78.11.5679-5685.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Lamb RA, Krug RM. Orthomyxoviridae: The Viruses and Their Replication. In: Knipe DM, Howley PM, editors. Fields Virology. Lippincott, Williams & Wilkins; Philadelphia: 2001. pp. 1487–532. [Google Scholar]
  19. Landry ML, Ferguson D. Suboptimal Detection of Influenza Virus in Adults by the Directigen Flu A+B Enzyme Immunoassay and Correlation of Results with the Number of Antigen-Positive Cells Detected by Cytospin Immunofluorescence. J Clin Microbiol. 2003;41(7):3407–3409. doi: 10.1128/JCM.41.7.3407-3409.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Lo MK, Tilgner M, Shi PY. Potential high-throughput assay for screening inhibitors of West Nile virus replication. J Virol. 2003;77(23):12901–6. doi: 10.1128/JVI.77.23.12901-12906.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Muhlberger E, Lotfering B, Klenk HD, Becker S. Three of the Four Nucleocapsid Proteins of Marburg Virus, NP, VP35, and L, Are Sufficient To Mediate Replication and Transcription of Marburg Virus-Specific Monocistronic Minigenomes. J Virol. 1998;72(11):8756–8764. doi: 10.1128/jvi.72.11.8756-8764.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Muster T, Subbarao E, Enami M, Murphy B, Palese P. An Influenza A Virus Containing Influenza B Virus 5' and 3' Noncoding Regions on the Neuraminidase Gene is Attenuated in Mice. Proc Natl Acad Sci U S A. 1991;88(12):5177–5181. doi: 10.1073/pnas.88.12.5177. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Neumann G, Hobom G. Mutational analysis of influenza virus promoter elements in vivo. J Gen Virol. 1995;76 ( Pt 7):1709–17. doi: 10.1099/0022-1317-76-7-1709. [DOI] [PubMed] [Google Scholar]
  24. Neumann G, Watanabe T, Ito H, Watanabe S, Goto H, Gao P, Hughes M, Perez DR, Donis R, Hoffmann E, Hobom G, Kawaoka Y. Generation of influenza A viruses entirely from cloned cDNAs. Proc Natl Acad Sci U S A. 1999;96(16):9345–50. doi: 10.1073/pnas.96.16.9345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Neumann G, Zobel A, Hobom G. RNA polymerase I-mediated expression of influenza viral RNA molecules. Virology. 1994;202(1):477–9. doi: 10.1006/viro.1994.1365. [DOI] [PubMed] [Google Scholar]
  26. Ogilvie M. Molecular techniques should not now replace cell culture in diagnostic virology laboratories. Rev Med Virol. 2001;11(6):351–4. doi: 10.1002/rmv.335. [DOI] [PubMed] [Google Scholar]
  27. Olivo PD. Transgenic cell lines for detection of animal viruses. Clin Microbiol Rev. 1996;9(3):321–34. doi: 10.1128/cmr.9.3.321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Olivo PD, Collins PL, Peeples ME, Schlesinger S. Detection and Quantitation of Human Respiratory Syncytial Virus (RSV) Using Minigenome cDNA and a Sindbis Virus Replicon: A Prototype Assay for Negative-Strand RNA Viruses. Virology. 1998;251(1):198–205. doi: 10.1006/viro.1998.9419. [DOI] [PubMed] [Google Scholar]
  29. Olivo PD, Frolov I, Schlesinger S. A cell line that expresses a reporter gene in response to infection by Sindbis virus: a prototype for detection of positive strand RNA viruses. Virology. 1994;198(1):381–4. doi: 10.1006/viro.1994.1046. [DOI] [PubMed] [Google Scholar]
  30. Paterson RG, Lamb RA. Molecular Virology: A Practical Approach. Oxford University Press; Oxford, U.K: 1993. The molecular biology of influenza viruses and paramyxoviruses; pp. 35–73. [Google Scholar]
  31. Pekosz A, Griot C, Nathanson N, Gonzalez-Scarano F. Tropism of bunyaviruses: evidence for a G1 glycoprotein-mediated entry pathway common to the California serogroup. Virology. 1995;214(2):339–48. doi: 10.1006/viro.1995.0043. [DOI] [PubMed] [Google Scholar]
  32. Pekosz A, Lamb RA. The CM2 protein of influenza C virus is an oligomeric integral membrane glycoprotein structurally analogous to influenza A virus M2 and influenza B virus NB proteins. Virology. 1997;237(2):439–51. doi: 10.1006/viro.1997.8788. [DOI] [PubMed] [Google Scholar]
  33. Perez DR, Donis RO. The Matrix 1 Protein of Influenza A Virus Inhibits the Transcriptase Activity of a Model Influenza Reporter Genomein Vivo. Virology. 1998;249(1):52–61. doi: 10.1006/viro.1998.9318. [DOI] [PubMed] [Google Scholar]
  34. Pinto LH, Holsinger LJ, Lamb RA. Influenza virus M2 protein has ion channel activity. Cell. 1992;69(3):517–28. doi: 10.1016/0092-8674(92)90452-i. [DOI] [PubMed] [Google Scholar]
  35. Ruest A, Michaud S, Deslandes S, Frost EH. Comparison of the Directigen Flu A+B Test, the QuickVue Influenza Test, and Clinical Case Definition to Viral Culture and Reverse Transcription-PCR for Rapid Diagnosis of Influenza Virus Infection. J Clin Microbiol. 2003;41(8):3487–3493. doi: 10.1128/JCM.41.8.3487-3493.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Shiraishi K, Mitamura K, Sakai-Tagawa Y, Goto H, Sugaya N, Kawaoka Y. High frequency of resistant viruses harboring different mutations in amantadine-treated children with influenza. J Infect Dis. 2003;188(1):57–61. doi: 10.1086/375799. [DOI] [PubMed] [Google Scholar]
  37. Smee DF, Morrison AC, Barnard DL, Sidwell RW. Comparison of colorimetric, fluorometric, and visual methods for determining anti-influenza (H1N1 and H3N2) virus activities and toxicities of compounds. J Virol Methods. 2002;106(1):71–9. doi: 10.1016/s0166-0934(02)00137-4. [DOI] [PubMed] [Google Scholar]
  38. Stabell EC, O'Rourke SR, Storch GA, Olivo PD. Evaluation of a genetically engineered cell line and a histochemical beta-galactosidase assay to detect herpes simplex virus in clinical specimens. J Clin Microbiol. 1993;31(10):2796–8. doi: 10.1128/jcm.31.10.2796-2798.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Storch GA. Rapid diagnostic tests for influenza. Curr Opin Pediatr. 2003;15(1):77–84. doi: 10.1097/00008480-200302000-00013. [DOI] [PubMed] [Google Scholar]
  40. Takeda M, Pekosz A, Shuck K, Pinto LH, Lamb RA. Influenza A virus M2 ion channel activity is essential for efficient replication in tissue culture. J Virol. 2002;76(3):1391–9. doi: 10.1128/JVI.76.3.1391-1399.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Tebas P, Scholl D, Jollick J, McHarg K, Arens M, Olivo PD. A rapid assay to screen for drug-resistant herpes simplex virus. J Infect Dis. 1998;177(1):217–20. doi: 10.1086/517357. [DOI] [PubMed] [Google Scholar]
  42. Thompson WW, Shay DK, Weintraub E, Brammer L, Cox N, Anderson LJ, Fukuda K. Mortality associated with influenza and respiratory syncytial virus in the United States. Jama. 2003;289(2):179–86. doi: 10.1001/jama.289.2.179. [DOI] [PubMed] [Google Scholar]
  43. Uyeki TM. Influenza diagnosis and treatment in children: a review of studies on clinically useful tests and antiviral treatment for influenza. Pediatr Infect Dis J. 2003;22(2):164–77. doi: 10.1097/01.inf.0000050458.35010.b6. [DOI] [PubMed] [Google Scholar]
  44. Wang D, Coscoy L, Zylberberg M, Avila PC, Boushey HA, Ganem D, DeRisi JL. Microarray-based detection and genotyping of viral pathogens. PNAS. 2002;99(24):15687–15692. doi: 10.1073/pnas.242579699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Watanabe T, Watanabe S, Noda T, Fujii Y, Kawaoka Y. Exploitation of Nucleic Acid Packaging Signals To Generate a Novel Influenza Virus-Based Vector Stably Expressing Two Foreign Genes. J Virol. 2003;77(19):10575–10583. doi: 10.1128/JVI.77.19.10575-10583.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Wright PF, Webster RG. Orthomyxoviruses. In: Knipe DM, Howley PM, editors. Fields Virology. Lippincott, Williams & Wilkins; Philadelphia: 2001. pp. 1533–1580. [Google Scholar]
  47. Yang S, Rothman RE. PCR-based diagnostics for infectious diseases: uses, limitations, and future applications in acute-care settings. The Lancet Infectious Diseases. 2004;4(6):337–348. doi: 10.1016/S1473-3099(04)01044-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Zobel A, Neumann G, Hobom G. RNA polymerase I catalysed transcription of insert viral cDNA. Nucleic Acids Res. 1993;21(16):3607–14. doi: 10.1093/nar/21.16.3607. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES