Skip to main content
NCBI home page
Immunology logoLink to Immunology
. 2002 Sep;107(1):102–110. doi: 10.1046/j.1365-2567.2002.01468.x

Loxosceles spider venom induces metalloproteinase mediated cleavage of MCP/CD46 and MHCI and induces protection against C-mediated lysis

Carmen W van den Berg *,†, Rute M Gonçalves de Andrade †, Fabio C Magnoli †, Kevin J Marchbank ‡, Denise V Tambourgi †
PMCID: PMC1782767  PMID: 12225368

Abstract

We have recently shown that sphingomyelinase D toxins from the spider Loxosceles intermedia induce Complement (C) -dependent haemolysis of autologous erythrocytes by the induction of cleavage of cell-surface glycophorins through activation of a membrane-bound metalloproteinase. The aim of this study was to investigate the effects of these toxins on C-regulator expression and the C-resistance of nucleated cells. Cells were incubated with Loxosceles venom/toxins and the expression of C-regulators was assessed by flow cytometry. A reduced expression of membrane co-factor protein (MCP) was observed, while expression of decay-accelerating factor (DAF) and CD59 was not affected. Analysis of other cell-surface molecules showed a reduced expression of major histocompatibility complex I (MHCI). Western blotting showed that a truncated form of MCP was released into the supernatant. Release could be prevented by inhibitors of metalloproteinases of the adamalysin family but not by inhibitors specific for matrix metalloproteinases. Cleavage of MCP was induced close to or within the membrane as demonstrated by the cleavage of transmembrane chimeras of CD59 and MCP. Although the venom/toxins induced a release of MCP, the C-susceptibility was decreased. The mechanism of this induction of resistance may involve a change in membrane fluidity induced by the sphingomyelinase activity of the toxin/venom and/or involvement of membrane-bound proteases. The soluble forms of MCP found in tissues and body under pathological conditions like cancer and autoimmune diseases may be released by a similar mechanism. The identity of the metalloproteinase(s) activated by the spider venom and the role in pathology of Loxoscelism remains to be established.

Introduction

Envenomation by spiders belonging to the genus Loxosceles, found in temperate and tropical regions of America, Africa and Europe, commonly results in impressive local necrotic skin lesions and more rarely causes systemic effects, including profound intravascular haemolysis.1–5 The predominant clinical sign is a cutaneous reaction characterized by the appearance of necrosis around the bite, resulting in ulceration. Healing of the ulcer often requires months. The scale of these lesions is remarkable considering that the spider injects only a few-tenths of a microlitre of venom, containing no more than 30 µg of protein. Mild systemic effects induced by envenomation, such as fever, malaise, pruritus and exanthema, are common, while intravascular haemolysis and coagulation, sometimes accompanied by thrombocytopenia and renal failure, occur in approximately 16% of the victims.1–5Loxosceles is the most poisonous spider in Brazil and children who develop the more severe systemic effects after envenomation frequently die, mainly as a result of kidney failure. At least three Loxosceles species of medical importance are known in Brazil (L. intermedia, L. gaucho, L. laeta) and more than 1500 cases of envenomation by L. intermedia alone are reported each year. In the USA at least six Loxosceles species (including L. reclusa: the brown recluse) are known to cause numerous incidents.1,2,4 Because of a lack of understanding of the mechanism of action of the venom, an effective treatment is not available. Biochemical and functional characterization of the active components in the venom may aid the development of a suitable therapy.

We have previously identified and characterized the toxins from L. intermedia venom that are responsible for all the local (dermonecrosis), and systemic [intravascular haemolysis, induction of tumour necrosis factor (TNF) and intravascular coagulation] effects induced by whole venom6–9 as two highly homologous sphingomyelinases (P1 and P2). The aim of our investigation is to understand how a molecule with a single biological activity can induce such a wide variety of biological effects. We have focused our recent investigations on the effects of Loxosceles toxins on erythrocytes and have found that the toxins induce complement susceptibility by induction of cleavage of glycophorins from the cell surface, thus rendering them susceptible to activation by the alternative pathway of Complement (C).9 The cleavage of glycophorins was accomplished by the induction of the activity of an as yet unidentified erythrocyte-bound metalloproteinase. The membrane-bound regulators CD59, decay-accelerating factor (DAF/CD55) and complement receptor 1 (CR1/CD35) were not affected.

The aim of this study was to investigate the effects of the Loxosceles toxins on nucleated cells, in particular the effect on expression of C-regulators and the C-susceptibility of cells that are always in contact with serum-like endothelial cells. In this study we chose the ECV304 cell line, which is frequently used as a model for endothelial cells but also has characteristics of epithelial cells.10–12 We show here that the Loxosceles toxins induce cleavage of the C-regulator membrane co-factor protein (MCP/CD46) and major histocompatibility complex I (MHCI) from the cell surface by activation of a metalloproteinase of the adamalysin family. However, this reduced expression of MCP resulted in an increased resistance to C-mediated lysis, the mechanism of this and the role in pathology of Loxoscelism remains to be established.

Materials and methods

Chemicals, reagents and buffers

Phenylmethylsulphonyl fluoride (PMSF), 1,10-phenanthroline, Tween-20, bovine serum albumin (BSA) and propidium iodide were purchased from Sigma (St Louis, MO). Tissue inhibitor of metalloproteinases 2 (TIMP2) was from TCS (Buckingham, UK), Galardin was from Calbiochem (Nottingham, UK). The buffers used were: veronal-buffered saline (VBS2+), pH 7·4, containing 10 mm sodium barbitone, 0·15 mm CaCl2 and 0·5 mm MgCl2; GVB (VBS2+ containing 0·1% gelatin); phosphate-buffered saline (PBS; 10 mm sodium phosphate, 150 mm NaCl pH 7·2; FACS buffer (PBS, 1% BSA, 0·01% sodium azide).

Cells

The ECV304 cell line was obtained from the European Collection for Animal Cell Cultures (Porton Down, Salisbury, UK). Cells were cultured in Dulbecco's modified Eagle's medium supplemented with 5% fetal calf serum at 37° and 5% CO2. Cells were released by trypsinization. The promyeloid cell line U937 was transfected with the cDNA-encoding glycosyl phosphatidylinositol (GPI)-anchored form of CD5913 or the cDNA encoding a CD59-MCP cyt2 construct (generated as described below). This resulted in the stable expression of CD59 that was GPI-anchored or transmembrane-anchored with the transmembrane and cytoplasmic tail 2 of MCP. Pig endothelial cells were harvested and cultured as described14 and used at passage 2.

Antibodies

The following monoclonal antibodies (mAbs) were kindly donated by Dr Vaclav Horeji, Prague, Czech Republic: monoclonal anti-MHCI (MEM-123) and β2-microglobulin (β2m-01), CD9 (MEM-192), CD29 (MEM-101A), CD44 (MEM-85), CD54 (MEM-112), CD98 (MEM-108), CD147 (M6/1). Anti-CD59 (Bric229), anti-DAF (Bric216) and antiglycophorin C (Bric4) were from IBGRL (Bristol, UK). Anti-MCP mAbs were kindly donated by Dr Bruce Loveland (mAb E4.3, Melbourne, Australia) and Dr John Atkinson (mAb GB24, St Louis, MO) and polyclonal anti-MCP antibody was generated in-house. The mAb anti-C3b (clone C3/30) was produced in-house; mAb anti-CR1 was from Serotec (Oxford, UK). ShAM/Ig-FITC and ShAR/Ig-FITC were from Amersham Pharmacia Biotech (Buckinghamshire, England, UK), GAR/IgG-HRPO was from Sigma (St Louis, MO). Rabbit polyclonal serum against ECV304 cells was generated in house.

Venom

Loxosceles intermedia Mello-Leitão spiders were provided by the Laboratório de Imunoquímica, Instituto Butantan, SP, Brazil. The venom was obtained by electrostimulation using the method of Bucherl15 with slight modifications. Briefly, 15–20-V electrical stimuli were applied repeatedly to the spider sternum and the venom drops were collected with a micropipette, vacuum-dried and stored at −20°. Stock solutions were prepared in PBS at 1·0 mg/ml. Toxin P1 from L. intermedia and its inactive isoform P3 were purified by Superose 12 gel filtration followed by reverse-phase high-performance liquid chromatography using a Wide-Pore Butyl C4 column (Pharmacia, Uppsala, Sweden) as described.7

Normal human serum

Human blood was obtained from healthy donors. Blood samples drawn to obtain sera were collected without anticoagulant and allowed to clot for 2 hr at room temperature, the normal human serum (NHS) was stored at −80°. C8-depleted human serum (C8d-HS) was obtained by passage of NHS over a mAb anti-C8 Sepharose 4B column.

C-lysis assay

C-susceptibility was measured by the propidium iodide exclusion assay. Cells were harvested and incubated in GVB at 107 cells/ml with Loxosceles venom or toxin (20 µg/ml; 30 min 37°). ECV304 cells were subsequently sensitized by incubation with a rabbit polyclonal anti-ECV304 antiserum (diluted 1/5) for 20 min on ice. A pig endothelial cells killing assay was carried out without sensitization. Cells were washed, resuspended at 3×106 cells/ml and 50 µl cells were mixed with 100 µl of NHS at different concentrations. After 1-hr incubation at 37°, 50 µl propidium iodide (1 µg/ml in GVB) was added and cell lysis was measured by flow cytometry.

Flow cytometry

ECV304 cells were harvested and incubated at 107 cells/ml in GVB2+ with Loxosceles venom or toxin (20 µg/ml, 30 min 37°) or at the indicated concentration and for the indicated period of time. Cells were washed and resuspended in FACS buffer at 3×106 cells/ml. Fifty microlitres of cells were incubated with 50 µl of primary antibody (between 1 and 10 µg/ml) and incubated for 30 min at 4°. Cells were washed three times and incubated with ShAM/Ig-FITC or ShAR/Ig-FITC for 30 min at 4°. The cells were washed and fixed in FACS buffer containing 1% paraformaldehyde and analysed by flow cytometry (FACScalibur, Becton Dickinson, CA).

C3-deposition

ECV304 cells were incubated with Loxosceles venom (20 µg/ml; 30 min 37°) and subsequently sensitized by incubation with a rabbit polyclonal anti-ECV304 antiserum (diluted 1/5) for 20 min on ice. Cells were washed, resuspended at 3×106 cells/ml and 50 µl cells were mixed with 100 µl of C8-depleted serum (prepared by passage over an anti-C8 affinity column). After 1 hr incubation at 37°, cells were washed and incubated with mAb anti-C3b (clone C3/30) followed by ShAM/Ig-FITC. Cells were fixed with 1% paraformaldehyde and analysed by flow cytometry.

Electrophoresis and Western blotting

Supernatants of ECV304 cells incubated with venom or nonidet P-40 (NP-40) extracts of untreated ECV304 cells (1% NP-40 in PBS, 30 min on ice) were run on 10% sodium dodecyl sulphate–polyacrylamide gels under non-reducing conditions. Gels were blotted onto nitrocellulose, the membranes were blocked with PBS/5% milk and incubated with purified rabbit anti-MCP immunoglobulin G (IgG; 10 µg/ml) for 1 hr at room temperature. Membranes were washed three times with PBS/0·05% Tween-20 for 10 min, and incubated with GAR/IgG-HRPO (1/1000) in PBS/5% milk for 1 hr at room temperature. After washing three times with PBS/0·05% Tween-20 for 10 min, and twice with PBS, blots were developed using Supersignal chemiluminescent substrate (Pierce) and Kodak X-ray film (Eastman Kodak, Rochester, NY).

MCP-specific enzyme-linked immunosorbent assay (ELISA)

Microtitre plates were coated with 100 µl of polyclonal anti-MCP IgG (1 mg/ml; overnight at 4°). Plates were blocked with 1% BSA in PBS (30 min room temperature) and dilutions of ECV304 supernatants were made in PBS. A standard curve of dilutions of recombinant soluble MCP (kind gift of Dr Bruce Loveland, Melbourne, Australia) in PBS was made. After 1 hr at room temperature, plates were washed with PBS/0·1% Tween-20 and mAb anti-MCP E4.3 (1 µg/ml) was added to each well. After 1 hr incubation at room temperature, plates were washed with PBS/0·1% Tween-20 and incubated with RAM/HRPO (1/1000; 1 hr, room temperature). Plates were washed and developed with OPD substrate according to the manufacturers conditions (Dako, High Wycombe, Bucks, UK).

Generation of transmembrane CD59

A transmembrane form of CD59 was constructed by splice overlap PCR. The specific primers were used to obtain the CD59 mature protein-encoding sequence (amino acids −25 to 7616) and the sequence encoding amino acids 292 to 353 of MCP-cyt-2.17 The GPI-anchor attachment site residues ω, ω1 and ω2 of CD59 were all mutated in order to prevent post-transcriptional modification and GPI attachment. Mutating only the ω site from N to K still resulted in the production of a GPI-anchor form of CD59 (data not shown). The primers used were as follows. Primer A: 5′ GCCTCTAGATTCTGTGGACAATCACA 3′; cDNA sequence of CD59 upstream of start codon, an XbaI restriction site was included to facilitate directional ligation. Primer B: 5′ CAAACTGTCAAGTATCGTAGGTTTTTCAAG 3′; encoding CD59 amino acids 75,76(LE), mutated GPI-attachment site: residues ‘NGG’ replaced by ‘KPT’, followed by amino acids 292–297 (ILDSLD) of MCP. Primer C: 5′ CTTGAAAAACCTACGATACTTGACAGTTTG 3′; encoding the same sequence as primer B but in reverse orientation. Primer D: 5′ GCGGGATCCTATTCAGCCTCTCTGCTCT 3′; encoding amino acids 350–353 of MCP-cyt-2, stop codon and downstream sequence, a BamHI restriction site was included to facilitate directional ligation.

In the first round of PCR CD59 (truncated protein) and MCP (transmembrane and cytoplasmic tail) encoding fragment were generated. In the second round of PCR these products were mixed and ligated by PCR using primers A and D. The resulting PCR product was cut with restriction enzymes BamHI and XbaI and ligated into the eukaryotic expression vector pDR2EF1α (a kind gift from Dr I. Anegon, Nantes, France)18 freshly cut with the same enzymes. Plasmids were transfected into Escherichia coli DH5α. Plasmids were isolated and sequenced using an automated ABI 392 sequencer, confirming the predicted cDNA sequence encoding amino acids 1–76 of CD59,16 followed by amino acids KPT and amino acids 292–353 of MCP-cyt-2 (Fig. 4a).17

Figure 4.

Figure 4

Open in a new tab

Cleavage of CD59-MCP chimera by Loxosceles venom. (a) C-terminal amino acid sequence alignments of mature expressed GPI-anchored CD59 (CD59-GPI), CD59-MCP2 chimera and MCP (cyt2 tail). GPI-anchor attachment site (N) is in bold, the transmembrane region of the MCP is underlined. Numbering above sequence is for CD59-GPI, numbering below the sequences is for MCP. (b) U937 cells expressing the GPI-anchored form of CD59 (CD59-GPI) or CD59-MCP chimera (CD59-MCP2) were incubated with Loxosceles venom (20 µg/ml; 30 min 37°; ▪) or buffer (□) and analysed for the expression of the CD59 constructs and of endogenously expressed MCP (MCP) by flow cytometry. Results are expressed as median fluorescence ± SD of experiments carried out in triplicate.

Generation of stable transfected cells

U937 cells were transfected by electroporation with the expression vector containing the cDNA for GPI- or transmembrane-anchored CD59 or an empty vector as control as described.13 In brief, cells growing in log-phase were washed and resuspended in ice-cold RPMI-1640 at 3×107/ml. Cells (450 µl) were added to a chilled cuvette and 10 µg of supercoiled plasmid DNA was added. The cuvette was placed on ice for 7 min and electroporated at 270 V and 960 µF using the Biorad Genepulser with capacitance extender. The cells were left on ice for another 15 min and subsequently added to 5 ml ice-cold RPMI-1640 and left at room temperature for 10 min; then 30 ml of culture medium at room temperature was added. The cells were then incubated for 24 hr under normal tissue culture conditions. The cells were spun and resuspended in medium containing 0·2 mg/ml hygromycin B (Boehringer Mannheim, Lewes, UK) to select for stable cell lines containing the pDR2ΔEF1α/CD59 plasmids. Selection was continued for 2 weeks, during which time the medium was changed every 3 days. When stable transfected cells were obtained, cells were grown in medium without hygromycin as this agent interfered with the functional assays. Levels of CD59 did not change upon omission of the hygromycin.

Results

ECV304 cells lose MCP after incubation with Loxosceles intermedia venom

ECV304 cells were incubated with Loxosceles intermedia venom and analysed by flow cytometry for the expression of C-regulatory molecules and glycophorin C (GPC). ECV304 cells did not express CR1 or GPC and no alteration in expression of DAF and CD59 was observed. However, the expression of MCP was almost completely abolished (Fig. 1a). Analysis of several other cell surface antigens showed that MHCI and β2-microglobulin were also lost from the ECV304 plasma membranes upon incubation with the Loxosceles venom (Fig. 1b).

Figure 1.

Figure 1

Open in a new tab

Effect of Loxosceles intermedia venom on expression of C-regulators. ECV304 cells (107 cells/ml) were incubated with buffer (□) or with Loxosceles intermedia venom (▪) (20 µg/ml; 30 min 37°: (a and b) and analysed for the expression of C regulators (a) and other cell-surface antigens (b) by flow cytometry. (c) ECV304 cells were incubated for 2 hr at 37° with whole Loxosceles venom (20 µg/ml) or the purified Loxosceles toxin P1 (40 µg/ml) or its inactive isoform P3 (40 µg/ml) and analysed for the expression of MCP (□) and MHCI (▪) by flow cytometry. Results are representative for three different experiments and expressed as mean of duplicates ± SD.

We have previously shown that alteration of the cell surface of human erythrocytes by Loxosceles venom is due to the sphingomyelinase toxin of the venom. In order to assess if the reduction in MCP and MHCI expression after incubation of cells was induced by the Loxosceles sphingomyelinase or by another factor in the venom, ECV304 cells were incubated with the purified toxin P1 and analysed for expression of MCP and MHCI. The purified toxin P1 also induced reduction of expression of MCP and MHCI (Fig. 1c). In most studies addressing the mechanism of action of Loxosceles venom, whole venom is used but the purified toxin can also induce all the same biological effects as whole venom and is thus thought to be solely responsible for the pathology caused by Loxosceles envenomation.7 Considering the difficulty in obtaining large amounts of Loxosceles venom, the loss of protein during purification and the fact that purified protein rapidly loses its activity, most of the further experiments presented here were carried out with whole venom.

Loss of MCP is dose and time dependent

ECV304 cells were incubated with a range of concentrations of Loxosceles venom. Reduction of expression of MCP was dose dependent, and more venom was required for the release of MCP than of MHCI (Fig. 2a). Incubation of adherent ECV304 cells over a 24-hr period showed a time-dependent release of MCP and MHCI, again MCP was more resistant to the action of the venom than MHCI (Fig. 2b). Maximum release was obtained within 4 hr of incubation. The venom did not have an effect on the viability of the cells.

Figure 2.

Figure 2

Open in a new tab

Dose–response and time–course of release of MCP and MHCI. (a) ECV304 cells were incubated with various concentrations of Loxosceles venom for 30 min at 37° and analysed for the expression of MCP (▪) and MHCI (▴) by flow cytometry. (b) ECV304 cells, grown in tissue culture flasks were incubated with Loxosceles venom (5 µg/ml) for various periods of time, trypsinized and analysed for expression of MCP and MHCI by flow cytometry. Results are expressed as mean± SD of experiments carried out in duplicate.

Loxosceles venom induces release of MCP into the supernatant

To assess whether reduction of cell surface expression of MCP was due to internalization or shedding, supernatants of ECV304 cells incubated with Loxosceles venom were analysed by ELISA and by Western blotting. ELISA showed that the concentration of MCP in the supernatant of venom-treated cells (223 ng/ml) was more than 10 times higher than in the supernatant of control cells (19 ng/ml). On Western blot the MCP released in the supernatant of venom-treated cells showed a MW slightly lower than the MCP expressed on the surface of untreated cells (56 000 and 64 000, respectively), demonstrating that MCP was cleaved and confirming that MCP was released in the supernatant and not internalized (Fig. 3). Preincubation of cells with chloroquine or ammonium chloride had no effect on the release of MCP induced by the venom, demonstrating that internalization and intracellular processing prior to shedding was not required (data not shown).

Figure 3.

Figure 3

Open in a new tab

Loxosceles venom induces cleavage of MCP. Supernatant of ECV304 cells treated with Loxosceles venom (20 µg/ml; 30 min 37°; lane 1) and an NP-40 cell lysate of untreated cells (lane 2) were run on 10% sodium dodecyl sulphate–polyacrylamide gel electrophoresis and Western blotted onto nitrocellulose. MCP was detected using a polyclonal anti-MCP antibody. MCP-specific bands are indicated with arrows.

Site of cleavage of MCP

The extracellular part of MCP consists of four highly homologous short consensus repeats followed by a serine, threonine, proline-rich serine threonine proline (STP) region. MCP is anchored to the membrane by a transmembrane anchor and can be expressed with two different cytoplasmic tails cyt-1 and cyt-2. Loxosceles venom induced loss of epitopes in SCR1 (as detected by mAb E4.3) and SCR3/4 (as detected by mAb GB24). However, no antibodies are available to the STP region or transmembrane and cytoplasmic tail. To investigate in more detail the site of cleavage of MCP we used a CD59-MCP construct expressed in the promyeloid CD59 negative cell line U937 by transfection. This construct consisted of amino acids 1–76 of the mature CD59 molecule followed by 10 extracellular amino acids, the transmembrane region and cytoplasmic tail cyt2 (CD59-MCP2) of MCP (Fig. 4a). This results in the expression of a CD59 molecule that is anchored to the membrane via a transmembrane anchor. U937 cells expressing the GPI-anchored form of CD59, also generated by transfection of the cells with the cDNA of the natural form of CD59,13 were used as control cells. Loxosceles venom induced cleavage of endogenously expressed MCP and of the CD59-MCP2 constructs in the U937 cells but no change in expression of the GPI-anchored CD59 was observed (Fig. 4b). These results suggest that MCP is cleaved close to or in the membrane, which is consistent with the difference in molecular weight of 8 000 found between the shed and cell-bound MCP (Fig. 3).

Inhibition of release of MCP and MHCI by metalloproteinase inhibitors

Release of glycophorins from erythrocytes by Loxosceles venom/toxin is not a direct effect of the sphingomyelinase toxin on the glycophorins but an indirect effect of activation of an as yet unidentified endogenous metalloproteinase, which causes cleavage of the glycophorins close to the cell membrane.9 To investigate if release of MCP and MHCI was mediated by a similar mechanism, ECV304 cells were incubated with Loxosceles venom in the presence of metalloproteinase inhibitor 1,10-phenanthroline and the serine protease inhibitor PMSF. Only 1,10-phenanthroline was able to inhibit the release of MCP and MHCI, demonstrating that release of these molecules was mediated through cleavage by a metalloproteinase (Fig. 5). To investigate further whether the metalloproteinase responsible for the cleavage was a member of the matrix metalloproteinases (MMPs) or the adamalysins, the effect of purified TIMP2 (an inhibitor specific for MMPs) and galardin (a hydroxamic acid inhibitor of both MMPs and the adamalysin family of metalloproteinases) on the cleavage of MCP was investigated. Figure 5 shows that only galardin was able to prevent the release of MCP, demonstrating the involvement of an adamalysin.

Figure 5.

Figure 5

Open in a new tab

Effect of protease inhibitors on the release of MCP from ECV304 cells. ECV304 cells were incubated with Loxosceles venom (20 µg/ml; 30 min 37°) in the presence or absence of the metalloproteinase inhibitor 1,10-phenanthroline (V+phen; 10 µm), serine proteinase inhibitor PMSF (V + PMSF; 5 µm), the MMP-specific inhibitor TIMP2 (V + TIMP2; 10 µg/ml), or galardin (inhibitor of MMPs and adamalysins: V + galardin; 10 µg/ml). Expression of MCP was assessed by flow cytometry. Results are expressed as fluorescence relative to control cells ± SD of experiments carried out in duplicate.

Loxosceles venom induces complement resistance in ECV304 cells

Expression of C-regulators DAF, MCP and CD59 protects cells by lysis of complement. However when the ECV304 cells were incubated with Loxosceles venom or the purified toxin P1, which results in the reduction of expression of MCP, no increase but rather a decrease in C-susceptibilty wa observed (Fig. 6a). Analysis of binding of the sensitizing antibody to the cells showed a slightly increased binding to the venom-treated cells (Fig. 6b), thus excluding the possibility that the decreased C-susceptibility was due to a decrease in sensitizing antibody binding. Incubation of the sensitized cells with C8-depleted serum followed by analysis of C3 deposition, showed no difference between the control and venom-treated cells (Fig. 6c). These results show that the decrease in C-susceptibility is not a result of an effect on the classical pathway of complement activation. The increased resistance to C-mediated lysis was not unique to the ECV304 cell line. When primary pig aortic endothelial cells were incubated with venom, concomitant with the release of pig MCP (not shown) there was also a large increase in complement resistance (Fig. 6d).

Figure 6.

Figure 6

Open in a new tab

Complement susceptibility of Loxosceles venom treated cells. ECV304 cells were incubated with Loxosceles venom (20 µg/ml; 30 min 37°) or buffer, sensitized with rabbit anti-ECV304 antiserum and analysed for: (a) C-susceptibility (▪, venom; ▴, P1; •, buffer), (b) binding of sensitizing antibody (solid line, venom; broken line, control; dotted line, background fluorescence), and (c) deposition of C3b (□, control cells; ▪, venom-treated cells). (d) Pig aortic endothelial cells were incubated with Loxosceles venom (20 µg/ml; 30 min 37°; ▪) or buffer (•) and analysed for C-susceptibility. Results in (a), (c) and (d) are expressed as mean± SD of experiments carried out in triplicate. Results in (b) are representative for experiments carried out in triplicate.

Discussion

We have previously shown that the intravascular haemolysis observed after Loxosceles envenomation is due to induction of release of glycophorin from the erythrocyte cell surface resulting in activation of the alternative pathway of complement.9 The release of glycophorin was caused by the induction of activation of an as yet unidentified metalloproteinase in the erythrocyte by the Loxosceles toxin. The aim of this study was to investigate the effects of the Loxosceles toxins on nucleated cells, in particular cells that are always in close contact with plasma, like endothelial cells. Endothelial cell activation resulting in intravascular coagulation and neutrophil adhesion has been shown to play a role in the pathology of loxoscelism but the mechanism of this endothelial cell activation is not known. Endothelial cells are always exposed to C and C-activation on these cells can lead to cell activation, resulting in up-regulation of adhesion molecules, followed by neutrophil adhesion and intravascular coagulation.19 Endothelial cells are protected from C-induced activation by the expression of C-regulators, DAF, MCP and CD59. We wanted to investigate if C-mediated activation of endothelial cells may play a role in the pathology of loxoscelism. For this study we used the ECV304 cell line, which is frequently used as a model for endothelial cells, however, it also displays some characteristics of epithelial cells and keratinocytes.10–12 In our experiments we could not find induction of adhesion molecules, neither by Loxosceles venom nor by TNF-α, which was used as a positive control (data not shown). This confirms previous observations that the cells of the ECV304 cell line do not behave in all aspects as endothelial cells.

We show here that incubation of the ECV304 cells with Loxosceles venom or purified toxin induced a significant reduction in expression of the C-regulator MCP and MHCI (Fig. 1). The reduction was due to cleavage of the extracellular domain of the MCP molecule resulting in the release of soluble MCP (Figs 3 and 4). The release could be inhibited by an inhibitor of metalloproteinases of adamalysins (Fig. 5). The adamalysin family has over 25 members of membrane-bound metalloproteinases, which are responsible for the cleavage/shedding of the ectodomains of a range of otherwise unrelated transmembrane molecules such as cytokines (e.g. TNF-α) and cytokine receptors (e.g. interleukin-6R, TNF receptors), membrane-anchored growth factors, cell adhesion molecules (e.g. l-selectin) and ectoenzymes.20–23 In most cases the metalloproteinase responsible for cleavage has not been identified. The site of cleavage of all these molecules is close to the membrane but there is no apparent sequence or structural homology at the cleavage site and little is known about the regulation of the shedding. We found that a chimera of CD59 and MCP was cleaved upon incubation of the cells with Loxosceles venom, which demonstrated that cleavage of MCP also takes place close to the membrane. Sequence analysis of the cleaved MCP molecule is required to identify the exact cleavage site. TNF-α is one of the cytokines that is being released by the adamalysin TACE (TNF-α-converting enzyme) and we have previously found that after injection of mice with Loxosceles venom, an increase of TNF-α was observed.8 This release may be caused by a mechanism similar to that in the release of MCP and MHCI from the ECV304 cells. Little is known about the regulation of activation of the adamalysins and how the metalloproteinase(s) responsible for the cleavage of glycophorin on erythrocytes and MCP and MHCI on the ECV304 cells are being activated remains to be investigated. Our Loxosceles intermedia venom or purified toxin preparations are devoid of gelatinase activity as investigated by zymography and our previous observation that the Loxosceles toxin-induced cleavage of glycophorin was the result of the activation of a membrane-bound metalloproteinase and not the effect of a direct action of the toxin or venom on glycophorin itself,9 suggests that the cleavage of MCP and MHCI is also an indirect effect of the Loxosceles venom on the cells and not an effect of a direct proteolytic action of the venom or toxin.

Soluble forms of MCP have been found in various body fluids and have been found to be increased in plasma and urine under various pathological conditions including cancer, systemic lupus erythematosis, rheumatoid arthritis and glomerulonephritis.24–28 The mechanism of release of this MCP has not been investigated but in all these conditions increased metalloproteinase activity may account for the release of soluble MCP and the mechanism of release may be similar to that observed in our study. The biological significance of release of soluble MCP is not known. Soluble MCP generated by genetic engineering has been shown to inhibit C-activation in the fluid phase,29 however, the levels of soluble MCP found in the clinical situations are likely not to be high enough to contribute to regulation of C-activation. Release of soluble MHCI has also been observed in clinical situations, including after transplantation. This release was shown to be mediated by a metalloproteinase activity,30 which is in accordance with our observation that MCP and also MHCI release (not shown) could be inhibited by galardin.

It was expected that the release of MCP would result in an increased C-susceptibility, however, we found that Loxosceles venom and toxin increased the C-resistance (Fig. 6a). It could be excluded that this increased resistance was due to a loss of binding of the sensitizing antibody or due to a reduced C3-convertase formation (Fig. 6b,c). The most likely explanation for the reduction in C-susceptibility may be that the Loxosceles toxin, which has sphingomyelinase activity, may alter membrane composition/fluidity, which may result in a change in C-susceptibility for example by a change of the ability of the membrane attack complex to insert into the membrane. There are still many aspects about resistance of nucleated cell to C-mediated cell death that are poorly understood31 and maybe the metalloproteinases that are activated by the Loxosceles toxins have a direct effect on the C-components deposited on the cell surface, however, we did not observe a change in C3b deposition.

Our observations described in this paper are not unique to ECV304 cells but can be generalized for other nucleated cells. Some of the experiments were also carried out with other nucleated cells including primary pig aortic endothelial cells (PAEC), human neutrophils, the promyeloid cell line U937, the erythroblast cell line K562 and in all cases MCP and MHC1 were released from the cell surface. Furthermore we also observed the increased C-resistance of PAEC after incubation with the Loxosceles venom (Fig. 6d).

In conclusion, we have found that Loxosceles venom and toxins can induce the release of the transmembrane-anchored molecules MCP and MHCI by induction of activation of a membrane-bound matrix metalloproteinase of the adamalysin family. The metalloproteinase-induced cleavage of MCP may well resemble the release of MCP observed in several other pathological conditions. In contrast to what was expected, the cells became more resistant to C-mediated killing, but whether they also become more resistant to C-induced activation events will be subject to further investigation.

Acknowledgments

This study was supported by the Wellcome Trust as a Collaborative Research Initiative Grant to D.V.T. and C.W.B. and a Royal Society Travel Grant to C.W.B.

References

  • 1.Ginsburg CM, Weinberg AG. Hemolytic anemia and multiorgan failure associated with localized cutaneous lesion. J Pediatr. 1988;112:496–9. doi: 10.1016/s0022-3476(88)80348-2. [DOI] [PubMed] [Google Scholar]
  • 2.Gendron BP. Loxosceles reclusa envenomation. Am J Emerg Med. 1990;8:51–4. doi: 10.1016/0735-6757(90)90297-d. [DOI] [PubMed] [Google Scholar]
  • 3.Futrell J. Loxoscelism. Am J Med Sci. 1992;304:261. doi: 10.1097/00000441-199210000-00008. [DOI] [PubMed] [Google Scholar]
  • 4.Bey TA, Walter FG, Lober W, Schmidt J, Spark R, Schlievert PM. Loxosceles arizonica bite associated with shock. Ann Emerg Med. 1997;30:701–3. doi: 10.1016/s0196-0644(97)70092-1. [DOI] [PubMed] [Google Scholar]
  • 5.Sezerino UM, Zannin M, Coelho LK, et al. A clinical and epidemiological study of Loxosceles spider envenoming in Santa Catarina. Brazil Trans R Soc Trop Med Hyg. 1998;92:546–8. doi: 10.1016/s0035-9203(98)90909-9. [DOI] [PubMed] [Google Scholar]
  • 6.Tambourgi DV, Magnoli FC, Von Eickstedt VR, Benedetti ZC, Petricevich VL, da Silva WD. Incorporation of a 35-kilodalton purified protein from Loxosceles intermedia spider venom transforms human erythrocytes into activators of autologous complement alternative pathway. J Immunol. 1995;155:4459–66. [PubMed] [Google Scholar]
  • 7.Tambourgi DV, Magnoli FC, van den Berg CW, Morgan BP, de Araujo PS, Alves EW, Da Silva WD. Sphingomyelinases in the venom of the spider Loxosceles intermedia are responsible for both dermonecrosis and complement-dependent hemolysis. Biochem Biophys Res Commun. 1998;251:366–73. doi: 10.1006/bbrc.1998.9474. [DOI] [PubMed] [Google Scholar]
  • 8.Tambourgi DV, Petricevich VL, Magnoli FC, Assaf SL, Jancar S, Dias Da Silva W. Endotoxemic-like shock induced by Loxosceles spider venoms: pathological changes and putative cytokine mediators. Toxicon. 1998;36:391–403. doi: 10.1016/s0041-0101(97)00063-9. [DOI] [PubMed] [Google Scholar]
  • 9.Tambourgi DV, Morgan BP, de Andrade RM, Magnoli FC, van den Berg CW. Loxosceles intermedia spider envenomation induces activation of an endogenous metalloproteinase, resulting in cleavage of glycophorins from the erythrocyte surface and facilitating complement-mediated lysis. Blood. 2000;95:683–91. [PubMed] [Google Scholar]
  • 10.Kiessling F, Kartenbeck J, Haller C. Cell–cell contacts in the human cell line ECV304 exhibit both endothelial and epithelial characteristics. Cell Tissue Res. 1999;297:131–40. doi: 10.1007/s004410051340. [DOI] [PubMed] [Google Scholar]
  • 11.Brown J, Reading SJ, Jones S, et al. Critical evaluation of ECV304 as a human endothelial cell model defined by genetic analysis and functional responses: a comparison with the human bladder cancer derived epithelial cell line T24/83. Lab Invest. 2000;80:37–45. doi: 10.1038/labinvest.3780006. [DOI] [PubMed] [Google Scholar]
  • 12.Suda K, Rothen-RutishauSeries B, Gunthert M, Wunderli-Allenspach H. Phenotypic characterization of human umbilical vein endothelial (ECV304) and urinary carcinoma (T24) cells: endothelial versus epithelial features. In Vitro Cell Dev Biol Anim. 2001;37:505–14. doi: 10.1290/1071-2690(2001)037<0505:PCOHUV>2.0.CO;2. [DOI] [PubMed] [Google Scholar]
  • 13.Powell MB, Marchbank KJ, Rushmere NK, van den Berg CW, Morgan BP. Molecular cloning, chromosomal localization, expression, and functional characterization of the mouse analogue of human CD59. J Immunol. 1997;158:1692–702. [PubMed] [Google Scholar]
  • 14.van den Berg CW, Rix C, Hanna SM, Perez de la Lastra JM, Morgan BP. Role and regulation of pig CD59 and membrane cofactor protein/CD46 expressed on pig aortic endothelial cells. Transplantation. 2000;70:667–73. doi: 10.1097/00007890-200008270-00022. [DOI] [PubMed] [Google Scholar]
  • 15.Bucherl W. Biology and venoms of the most important South American spiders of the genera Phoneutria, Loxosceles, Lycosa, and Latrodectus. Am Zool. 1969;9:157–9. doi: 10.1093/icb/9.1.157. [DOI] [PubMed] [Google Scholar]
  • 16.Davies A, Simmons DL, Hale G, Harrison RA, Tighe H, Lachmann PJ, Waldmann H. CD59, an LY-6-like protein expressed in human lymphoid cells, regulates the action of the complement membrane attack complex on homologous cells. J Exp Med. 1989;170:637–54. doi: 10.1084/jem.170.3.637. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Post TW, Liszewski MK, Adams EM, Tedja I, Miller EA, Atkinson JP. Membrane cofactor protein of the complement system: alternative splicing of serine/threonine/proline-rich exons and cytoplasmic tails produces multiple isoforms that correlate with protein phenotype. J Exp Med. 1991;174:93–102. doi: 10.1084/jem.174.1.93. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Charreau B, Cassard A, Tesson L, et al. Protection of rat endothelial cells from primate complement-mediated lysis by expression of human CD59 and/or decay-accelerating factor. Transplantation. 1994;58:1222–9. [PubMed] [Google Scholar]
  • 19.Tedesco F, Fischetti F, Pausa M, Dobrina A, Sim RB, Daha MR. Complement–endothelial cell interactions: pathophysiological implications. Mol Immunol. 1999;36:261–8. doi: 10.1016/s0161-5890(99)90054-8. [DOI] [PubMed] [Google Scholar]
  • 20.Killar L, White J, Black R, Peschon J. Adamalysins. A family of metzincins including TNF-alpha converting enzyme (TACE) Ann N Y Acad Sci. 1999;878:442–52. doi: 10.1111/j.1749-6632.1999.tb07701.x. [DOI] [PubMed] [Google Scholar]
  • 21.Turner AJ, Hooper NM. Role for ADAM-family proteinases as membrane protein secretases. Biochem Soc Trans. 1999;27:255–9. doi: 10.1042/bst0270255. [DOI] [PubMed] [Google Scholar]
  • 22.Mullberg J, Althoff K, Jostock T, Rose-John S. The importance of shedding of membrane proteins for cytokine biology. Eur Cytokine Netw. 2000;11:27–38. [PubMed] [Google Scholar]
  • 23.Yamamoto S, Higuchi Y, Yoshiyama K, Shimizu E, Kataoka M, Hijiya N, Matsuura K. ADAM family proteins in the immune system. Immunol Today. 1999;20:278–84. doi: 10.1016/s0167-5699(99)01464-4. [DOI] [PubMed] [Google Scholar]
  • 24.Jensen TS, Bjorge L, Wollen AL, Ulstein M. Identification of the complement regulatory proteins CD46, CD55, and CD59 in human fallopian tube, endometrium, and cervical mucosa and secretion. Am J Reprod Immunol. 1995;34:1–9. doi: 10.1111/j.1600-0897.1995.tb00913.x. [DOI] [PubMed] [Google Scholar]
  • 25.Seya T, Hara T, Iwata K, et al. Purification and functional properties of soluble forms of membrane cofactor protein (CD46) of complement: identification of forms increased in cancer patients' sera. Int Immunol. 1995;7:727–36. doi: 10.1093/intimm/7.5.727. [DOI] [PubMed] [Google Scholar]
  • 26.Kawano M, Seya T, Koni I, Mabuchi H. Elevated serum levels of soluble membrane cofactor protein (CD46, MCP) in patients with systemic lupus erythematosus (SLE) Clin Exp Immunol. 1999;116:542–6. doi: 10.1046/j.1365-2249.1999.00917.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Shoji T, Nakanishi I, Kunitou K, et al. Urine levels of CD46 (membrane cofactor protein) are increased in patients with glomerular diseases. Clin Immunol. 2000;95:163–9. doi: 10.1006/clim.2000.4847. [DOI] [PubMed] [Google Scholar]
  • 28.Soldan SS, Fogdell-Hahn A, Brennan MB, et al. Elevated serum and cerebrospinal fluid levels of soluble human herpesvirus type 6 cellular receptor, membrane cofactor protein, in patients with multiple sclerosis. Ann Neurol. 2001;50:486–93. doi: 10.1002/ana.1135. [DOI] [PubMed] [Google Scholar]
  • 29.Christiansen D, Milland J, Thorley BR, McKenzie IF, Loveland BE. A functional analysis of recombinant soluble CD46 in vivo and a comparison with recombinant soluble forms of CD55 and CD35 in vitro. Eur J Immunol. 1996;26:578–85. doi: 10.1002/eji.1830260312. [DOI] [PubMed] [Google Scholar]
  • 30.Demaria S, Bushkin Y. Soluble HLA proteins with bound peptides are released from the cell surface by the membrane metalloproteinase. Hum Immunol. 2000;61:1332–8. doi: 10.1016/s0198-8859(00)00213-5. [DOI] [PubMed] [Google Scholar]
  • 31.Jurianz K, Ziegler S, Garcia-Schuler H, Kraus S, Bohana-Kashtan O, Fishelson Z, Kirschfink M. Complement resistance of tumor cells: basal and induced mechanisms. Mol Immunol. 1999;36:929–39. doi: 10.1016/s0161-5890(99)00115-7. [DOI] [PubMed] [Google Scholar]

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES