Skip to main content
NCBI home page
Immunology logoLink to Immunology
. 2002 Sep;107(1):118–128. doi: 10.1046/j.1365-2567.2002.01477.x

Conjunctival macrophage-mediated influence of the local and systemic immune response after corneal herpes simplex virus-1 infection

Dirk Bauer *,‡, Andreas Schmitz *, Nico van Rooijen †, Klaus-Peter Steuhl *, Arnd Heiligenhaus *,‡
PMCID: PMC1782771  PMID: 12225370

Abstract

Recently it has been shown that selective subconjunctival macrophage depletion reduced the incidence and severity of stromal herpes simplex virus (HSV) keratitis in mice. In this study, we examined the effect of conjunctival macrophage depletion on the corneal and systemic T-cell-mediated immune response. BALB/c mice were treated with subconjunctival injections of dichloromethylene diphosphonate (Cl2MDP)-liposomes (Cl2MDP-LIP) or phosphate-buffered saline (PBS) 7 and 2 days before corneal infection with 105 plaque-forming units (PFU) of HSV-1 (KOS strain). Interferon (IFN)-γ, interleukin (IL)-2, and IL-4 production in the cornea was analysed by enzyme-linked immunosorbent assay (ELISA), and cytokine mRNA levels (IFN-γ, IL-4) were measured by semiquantitative reverse transcription–polymerase chain reaction (RT-PCR). Cell culture supernatants from submandibular lymph nodes were analysed by ELISA for expression of IFN-γ, IL-2, and IL-4 and by bioassay for IL-6. The HSV-1-specific proliferative response of lymphocytes from regional lymph nodes and the delayed-type hypersensitivity (DTH) response were tested after corneal infection. Virus-neutralizing antibody titres and HSV-1-specific immunoglobulin G (IgG)2a/IgG1-ratios were measured. Cytokine mRNA expression (IFN-γ, IL-4) and secretion (IFN-γ, IL-2, IL-4) in the corneas were decreased after HSV-1 corneal infection in the macrophage-depleted mice. The secretion of IFN-γ and IL-2 was decreased in the regional lymph nodes from Cl2MDP-LIP-treated animals (P < 0·05). Furthermore, Cl2MDP-LIP-treated mice had decreased HSV-1 specific proliferative responses (P < 0·05) and DTH response after corneal HSV-1 infection (P < 0·05). The virus-neutralizing serum-antibody levels (P < 0·05) increased while the HSV-1 specific IgG2a/IgG1-ratio was unaffected after macrophage depletion. Macrophage depletion did not induce a shift between the T helper 1 (Th1) and Th2 response in this HSK model. The data suggest that conjunctival macrophage functions are enhancing the T-cell-mediated immune response after corneal infection. This effect is at least in part responsible for the impaired course of herpetic keratitis after macrophage depletion.

Introduction

Herpes simplex virus type 1 (HSV-1) is often acquired in early childhood. After primary infection of the eye region, the virus replicates in the epithelium of the cornea, travels to the trigeminal ganglion by retrograde transport and establishes a latent infection. Recurrent ocular HSV infections may occur later in life via axonal transport of the virus back to the eye. These episodes of reinfection are often associated with immune-mediated inflammatory disease of the cornea termed ‘herpes simplex stromal keratitis’ (HSK). In fact, HSV-1 is a leading cause of human visual impairment and blindness worldwide.

Previous experimental studies have shown that T-cells, predominantly of the T helper 1 (Th1) type, are major contributors to the development of HSK.1–4 There is evidence that the Th1-type cytokines interferon-γ (IFN-γ) and interleukin (IL)-2 are secreted during the progression of disease, and neutralization of these cytokines significantly reduces the severity of HSK.5 In contrast, the Th2-related cytokines IL-4 and IL-10 are found in the corneas predominantly during the healing phase of the disease6,7 and treatment of the animals with IL-10 before infection improves the outcome of keratitis.8 There is evidence that polymorphonuclear cells (PMNs) are essential in clearing the virus from the HSV-1 infected eye. However, PMNs also contribute to T-cell mediated destruction of the corneal architecture.9,10

The humoral immune response is another important component in the course of HSV-1 keratitis. Systemic administration of anti-HSV-1 antibodies improves cytopathological epithelial HSV lesions and prevents mice from developing stromal keratitis.11–13

The macrophages in the subepithelial tissue of the conjunctiva are one of the first to come into contact with foreign material and therefore play a decisive role in the acute defence system against micro-organisms.14–16 It has been shown that macrophages play a highly significant role in non-specific resistance to viral infections.17,18 Macrophages are multifunctional cells.19 They participate in scavenger functions, such as clearance of non-self material, microorganisms and altered self-materials, functions that are based on their phagocytosis and intracellular degradation capacity. They also play an important role in the regulation of innate and acquired immunity, which is dependent on their secretion of regulatory molecules, such as cytokines like interleukin-12.20 There is significant evidence from other disease models that T-cell and B-cell immune responses are influenced by macrophages.19

A technique for the investigation of macrophage functions is to eliminate macrophages selectively through the injection of liposomes containing dichloromethylene diphosphonate (Cl2MDP-LIP). After phagocytosis and disruption of the phospholipid bilayers, the drug is released into the cytoplasm of the cell and causes apoptotic cell death of the macrophages.19,21,22 It has been demonstrated that other cell populations, including Langerhans' cells, are not affected by treatment with Cl2MDP-LIP.16,21,23

Under normal conditions, macrophages are not found in the cornea. However, immediately after corneal injury, macrophage migration inhibitory factor (MIF) is up-regulated.24 After infection of the cornea with HSV-1, macrophages have also been found in the limbus region and the central cornea of mice.15 In previous studies it has been shown15,16 that macrophage depletion obtained by subconjunctival administration of Cl2MDP-LIP leads to delayed virus clearance from the HSV-1-infected eye. It has been further demonstrated that macrophage depletion improves the course of stromal keratitis in the later stage of the disease.15 The present study was undertaken to characterize further the effect of topical macrophage depletion on the course of HSK with respect to T-cell related immune responses.

Materials and methods

Animals

Female BALB/c mice 6–8 weeks of age were used for all studies. The animals were maintained according to the guidelines of the protocols approved by the Institutional Animal Care and Use Committee. All animals were treated according to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

HSV-1 infection

The HSV-1 KOS strain was obtained from Dr David Knipe (Harvard Medical School, Boston, MA) and was grown in Vero cells (American Type Culture Collection, ATCC, CCL 81, Rockville, MD) as previously described. For examination of the virus titre the supernatants were titrated on Vero cells.7,15 The technique of corneal HSV-1 infection has been described elsewhere.7,15

Preparation of Cl2MDP liposomes

Cl2MDP was donated by Roche Diagnostics GmbH, Mannheim, Germany. Preparation of liposomes containing Cl2MDP-LIP was performed as described previously.22 For in vivo depletion of conjunctival macrophages, mice were injected subconjunctivally with 50 µl of the liposome suspension, containing approximately 0·25 mg of clodronate on days 7 and 2 before infection, using a 30-gauge needle. Liposomes were injected at two or three separate sites close to the limbus to achieve an equal distribution.15

Histology

Specimens for light microscopy were fixed in Mc-Dowell solution (4% formaldehyde, 1% glutaraldehyde, 0·13% sucrose, 0·07 m sodium hydroxide, 0·08 m sodium phosphate, pH 7·2), rinsed in cacodylate buffer, dehydrated with ethanol, and embedded in paraffin. Five-µm sections were stained with standard staining procedures with haematoxylin–eosin as described previously.15

Immunohistochemistry

Tissue were taken and immediately snap-frozen in liquid nitrogen. Cryostat sections were prepared with the avidin–biotin–immunoperoxidase technique as described previously15,23 using the following antibodies: anti F4/80 (Serotec, Oxford, UK; clone Cl:A3-1) and anti-CD205 (Serotec, clone NLDC-145).

Flow cytometry analysis

Lymph nodes and spleens of five animals of each group were analysed. Cell suspensions were prepared and staining procedure was made as described previously.25 Antibodies used for these studies were obtained from Pharmingen (Heidelberg, Germany): anti CD3e (clone 145-2C11), anti CD4/L3T4 (clone RM4-5), anti CD8/Ly-2 (clone 53-6.7), anti-CD19 (clone 1D3) and anti F4/80 (Serotec; clone Cl:A3-1). The samples were then analysed with a FACScan Flow Analyzer (Becton Dickinson, San Jose, CA), counting 104 cells in each sample.

Delayed-type hypersensitivity reaction (DTH)

DTH responsiveness was determinated using the footpad swelling assay as described previously.26 Fifty µl of UV-inactivated virus solution was inoculated in the right hind footpad using a 30-gauge needle, and 50 µl of RPMI in the left hind footpad was used as control. Footpad swelling was measured after 24 hr with a micrometer. Results were expressed as specific footpad swelling in mm.

Cytokine quantitation

To investigate the effect of macrophage depletion on cytokine production within the cornea, corneas were excised from the Cl2MDP-LIP-and PBS-treated eyes after removing the limbal tissue. Samples were stored at −80° until assayed. The corneas were thawed, minced, sonicated for 30 s, and clarified by centrifugation at 10 000 g for 10 min The tissue homogenates were assayed for IFN-γ, IL-2 and IL-4 with the use of commercially available enzyme-linked immunosorbent assay (ELISA) kits (Pharmingen).

Lymphocytes were harvested from the cell suspensions of the regional lymph nodes or the spleen by Percoll gradient centrifugation. After centrifugation for 30 min at 300 g, the 45/60% fraction was harvested.27 One-ml aliquots containing 5×106 cells were added to each well of a 24-well plate, together with 100 µl UV-inactivated HSV-1 (2×107 plaque-forming units (PFU) HSV-1). After 24 hr incubation at 37° in 5% CO2, cell supernatants were harvested and were also analysed for the levels of IFN-γ, IL-2, IL-4, and IL-10 (Pharmingen).

IL-6 levels in supernatants from regional lymph node lymphocytes were determined by a methylthiazole tetrazolium (MTT) reduction assay using the IL-6-dependent B-cell hybridoma 7TD1.27,28 7TD1 hybridoma cells were maintained in tissue culture with recombinant murine IL-6. One unit of IL-6 was defined as the amount of IL-6 required to stimulate 50% maximal proliferation. Preincubation of lymphocyte supernatants with neutralizing antiserum against murine IL-6 completely inhibited their IL-6 activity.

Proliferation assay with 3H-thymidine

The isolated submandibular lymph nodes cell were resuspended at a concentration of 1×106 cells/ml in RPMI-1640 supplemented with 10% fetal calf serum (FCS), 5×10−4 m mercaptoethanol and 5 mm HEPES. A 100-µl aliquot containing 1×105 cells was immediately added to each well of a 96-well microtitre flat-bottom plate. UV-inactivated virus solution at a final concentration of 2×107 PFU was added to each well in triplicate, and this was followed by an incubation at 37° in 5% CO2 for 3 days. One µCi of tritiated thymidine was added to each well, the cells were incubated for 12 hr at 37°, and the amount of incorporated tritiated thymidine was measured in a beta plate reader. Spontaneous count was determined with 10% FCS, which served as an irrelevant protein control. 5 µg/ml of concanavalin A (Canavalia ensiformis, Sigma, St Louis, MO) were used as a positive control.29

Antibody titres against HSV-1

Equal volumes of serial 1 : 2 serum dilutions with RPMI-1640 were added to tubes each containing 102 PFU of HSV-1 (KOS strain). The serum-virus mixtures were incubated at 37° for 30 min before aliquots of 0·2 ml were placed in a well with a confluently grown Vero-cell monolayer (done in triplicate) of 24-well plates (Falcon 3047, Becton Dickinson, Heidelberg, Germany). Controls were incubated with only virus. After an incubation time of 1 hr at room temperature, the monolayers were overlaid with 1 ml of 0·6% RPMI/agarose medium and were incubated for 2–3 days at 37°. Cells were then fixed in 37% formalin and the agarose was removed. Plaques were counted after staining with 2% crystal violet. Neutralizing antibodies were counted in that dilution that reduced the mean PFU value by 50% in comparison to the controls.

For detection of anti-HSV-1 immunoglobulin isotypes, UV-inactivated HSV-1 (2×107 PFU/well in 0·1 m carbonate-buffer; pH 9·5) was adsorbed onto 96-well microtitre plates (Nunc, Roskilde, Denmark). The plates were blocked for 1 hr with PBS, 0·05% Tween-20, and 10% bovine serum albumin (BSA); 100 µl of serial serum dilutions was then added. The plates were incubated at 37° for 1 hr, and this was followed by a washing step. For the determination of serum-immunoglobulin, antimurine immunoglobulin–horseradish peroxidase (HRP; whole immunoglobulin G (IgG)-fraction, IgG2a and IgG1; Serotec) was added. This was followed by the addition of 3,3′,5,5′-tetramethylbenzidine (TMB) substrate solution. In each step, plates were washed three times with the washing buffer (PBS and 0·05% Tween-20). The plates were read on a Dynatech MRX plate reader with OD at 450 nm. The ELISA titres were determined as the inverse of the highest serum dilution showing the same OD value as sera of naive mice.30

RNA isolation, cDNA synthesis and semiquantitative polymerase chain reaction

The mRNA was isolated from each excised cornea by acid guanidinium thiocyanate/phenol/chloroform extraction. cDNA strands were made to cellular mRNA by using the superscript (Gibco, Grand Island, NY) reverse transcriptase (RT) according to the manufacturer's specifications by adding the total cellular mRNA from one cornea and oligo-dt 18 primer (New England Biolabs). The reverse transcription was performed at 37° for 1 hr. After this step, eight specimens were pooled, heated to 95° for 5 min, and then set on ice.7

A neutral DNA fragment (provided in the polymerase chain reaction (PCR) MIMIC™ Construction Kit from Clontech, Heidelberg, Germany) was used for generation of a non-homologous internal standard in competitive PCR amplification. The yield of PCR mimic fragment was calculated by spectrophotometry (260 nm) and by visual comparison of the electrophoretic bands from ΦX174/HaeIII (Clontech) digest. The MIMIC DNA fragment was then diluted to 100 amol/µl. Serial 1 : 10 dilutions of the fragment were made and 1 µl of the dilution served as an internal standard for amplification (Clontech).

PCR reactions were prepared in a volume of 50 µl containing 5 µl PCR buffer II (Perkin Elmer, Applied Biosystems, Foster City, CA), 4 µl MgCl2, 200 µm of each deoxynucleoside triphosphate (dNTP), 0·5 µm of each primer, 32·5 µl distilled water and 0·4 µl amplitaq gold DNA polymerase (Perkin Elmer). RT-PCR was carried out for 30 (β-actin) or 40 (IFN-γ and IL-4) cycles with denaturation at 95° for 30 s, annealing at 60° for 45 s, and extension at 72° for 120 s. Hot-start PCR was performed to avoid undesirable priming. The primers for IFN-γ and IL-4 and beta-actin (Tables 1 and 2) were obtained from Clontech.

Table 1. Primer sequences used for the amplification.
Product Primer sequence (5′–3′) Size
IFN-γ sense Biotin-TGCATCTTGGCTTTGCAGCTCTTCCTCATGGC 365 bp
antisense TGGACCTGTGGGTTGTTGACCTCAAACTTGGC
IL-4 sense Biotin-CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG 358 bp
antisense CAGTGATGTGGACTTGGACTCATTCATGGTGC
β-actin sense Biotin-GTGGGCCGCTCTAGGCACCAA 540 bp
antisense CTCTTTGATGTCACGCACGATTTC
Open in a new tab
Table 2. Primer sequence used for construction of standard DNA.
Product Primer sequence (5′–3′) Size
IFN-γ sense TGCATCTTGGCTTTGCAGCTCTTCCTCATGGCCGCAAGTGAAATCTCCTCCG 618 bp
antisense TGGACCTGTGGGTTGTTGACCTCAAACTTGGCTTGAGCCATGGGGAGCTTT
IL-4 sense CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCGCGCAAGTGAAATCTCCTCCG 618 bp
antisense CAGTGATGTGGACTTGGACTCATTCATGGTGCTTGAGTCCATGGGGAGCTTT
β-actin sense GTGGGCCGCTCTAGGCACCAACGCAAGTGAAATCTCCTCCG 599 bp
antisense CTCTTTGATGTCACGCACGATTTCTTGAGTCCATGGGGAGCTTT
Open in a new tab

Enzyme-linked oligonucleotide sorbent assay (ELOSA)

The ELOSA technique was performed as a specific recognition step by hybridization of the amplified DNA fragments with a probe.31–33 In the first step, the PCR-amplified, biotin-labelled DNA fragments were immobilized in a streptavidin-coated microwell. The double-stranded DNA was then denatured by sodium hydroxide to obtain two single strands. Afterwards, the probe was hybridized to the complementary single strand. The hybrids of DNA/probe (digoxigenin) were detected using an anti-digoxigenin-horseradish peroxidase antibody (Boehringer Mannheim, Mannheim, Germany). TMB (Boehringer Mannheim) substrate solution was then added, and the color reaction was analysed with a Dynatech MRX plate reader at OD 450 nm.

Probe selection

Probes were selected with the aid of a primer selection software (OLIGO 4.0). The cytokine probes were complementary to the cytokine cDNA sequences or to the respective MIMIC DNA fragment (Table 3).

Table 3. Probes for the semiquantification of amplimers.
Target Probe sequence (5′–3′) Size
IFN-γ Digoxigenin-TGTCTTTCAAGACTTCAAAGAGTCTGAGG 29
IL-4 Digoxigenin-AAAATATGCGAAGCACCTTGGAAGCCCTAC 30
β-actin Digoxigenin-GGGTGTTGAAGGTCTCAAACATGATCTGGG 30
DNA-fragment Digoxigenin-TGCGATAAAACTTGGAATCTGTAGGGCTAG 30
Open in a new tab

Statistical analysis

The significance of differences was analysed by Student's t-test. Keratitis incidences between the experimental groups were compared with Fisher's protected least significant difference test. P < 0·05 was regarded as significant.

Results

Course of herpes keratitis

As shown recently, the depletion of macrophages by treatment of Cl2MDP-LIP profoundly altered the course of herpes keratitis in BALB/c mice. Depletion of conjunctival macrophages reduced the incidence of stromal keratitis (HSK) from 78·6% in the PBS-treated control group to 42·9% in the Cl2MDP-LIP-treated group, and the keratitis was less severe.15 By day 14 after infection, typical histological signs of severe stromal keratitis were found in the PBS-treated control mice (n = 5). The eyes of these animals showed ulceration, epithelial necrosis, epithelial edema, stromal oedema, heavy inflammatory cell infiltration, and marked fibrovascular tissue. In Cl2MDP-LIP-treated mice (n = 5) the inflammation and damage of the corneal tissue were less severe (Fig. 1).

Figure 1.

Figure 1

Open in a new tab

Photomicrographs of the corneal sections after HSV-1 infection on day 14 post infection. Cornea sections from 8-week-old-female BALB/c mice treated with PBS (a) or Cl2MDP-LIP (b) before infection were stained with hematoxylin and eosin. Original magnification: ×250. Corneas from PBS-treated mice showed more infiltrating leucocytes, necrosis and oedema on day 14 after corneal HSV-1 infection compared to Cl2MDP-LIP-treated animals.

Influence of Cl2MDP-LIP treatment on other cell populations

Flow cytometric analysis of cell populations obtained from the regional lymph node or spleen on day 0, 7 and 14 post infection showed, that there were no significant changes in the percentages of the diverse cell populations (CD3, CD4, CD8, CD19, F4/80).

The immunohistochemical studies of the eye specimens obtained at the same time points showed, that F4/80 positive cell population were significantly decreased15 while the CD205 positive cell population (dendritic cells) was unaffected (data not shown).

Lymphocytes separated from the regional lymph node, enriched by gradient centrifugation, were cocultured with PBS or Cl2MDP-LIP in the presence of UV-HSV-1 or concanavalin A. The levels of IFN-γ, IL-2 and IL-4, as analysed by ELISA in supernatants after 24 hr, did not differ significantly between the groups (data not shown). Furthermore these cells did not show significant differences with respect to their proliferating response after cocultivation with UV-HSV-1 or concanavalin A.

Level of the Th1 and Th2 cytokines in the HSV-1 infected cornea by ELISA

A set of experiments was done to elucidate the T-cell infiltration and Th1/Th2 ratio in corneal tissue after topical macrophage depletion. The Th1 and Th2 cytokine levels in corneal tissues of PBS-treated control mice and Cl2MDP-LIP-treated mice were analysed on days 5 and 10 post infection by ELISA during the development of disease (n = 6–8 each). Th1 and Th2 cytokines were only found in traces at day 5 post infection and the levels did not differ between both experimental groups (data not shown). On day 10 the concentrations of both Th1 (IFN-γ, IL-2) and Th2 (IL-4) cytokines were lower in Cl2MDP-LIP-treated mice than in the PBS-treated control group. In consequence, we did not detect a shift between the Th1 and Th2 cytokines in the cornea (Fig. 2).

Figure 2.

Figure 2

Open in a new tab

Depletion of conjunctival macrophages results in decreased concentrations of Th1 and Th2 cytokines in corneas from BALB/c mice after corneal HSV-1 infection on day 10 post infection. Corneas were excised from eight to six mice in each group. The production of protein cytokine levels (IFN-γ, IL-2 and IL-4) was determined by ELISA for each cornea. *P < 0·05 compared with PBS-treated control group.

Level of the Th1 and Th2 cytokines in the HSV-1 infected cornea by RT–PCR

As an additional support for the notion that Th1 and Th2 responses are down-regulated in the cornea by the depletion of conjunctival macrophages, mRNA levels of typical cytokines were determined by the semiquantitative RT–PCR technique. Total mRNA was extracted from eight corneas on days 5 and 10 from Cl2MDP-LIP-treated and PBS-treated control mice after HSV-1 infection. β-Actin served as a control for equal amounts of mRNA. The results show that IFN-γ- and IL-4-mRNA levels on day 10 postinfection were both lower in the corneas of Cl2MDP-LIP-treated animals than in the control mice (Fig. 3).

Figure 3.

Figure 3

Open in a new tab

Semiquantitation of cytokine mRNAs by competitive RT–PCR. Representative reactions of IFN-γ, IL-4 and β-actin using a competitive standard. A constant amount of cDNA from mouse corneas (‘target’) was coamplified with varying concentrations of the competitor standard (‘construct’) (lanes 1–5=101−10−5 amol). A specific recognition step by hybridization of the amplified DNA fragments with a probe was performed using the ELOSA technique. Target bands were detected at higher concentrations of constructs in the control group as compared to the Cl2MDP-LIP group, indicating a higher concentration of cytokine mRNA. The results show, that both, IFN-γ and IL-4 mRNA, have been decreased in the Cl2MDP-LIP treated mice compared to the control mice.

DTH

The DTH response is substantially driven by CD4 positive T cells. This test was performed to determine whether subconjunctival Cl2MDP-LIP treatment would be able to impair systemic CD4 effector function. Mice were infected via topical infection on the cornea with 105 PFU HSV-1 (KOS). On day 14, the animals responded strongly to the viral antigen in the DTH test. The results show (Fig. 4) that the DTH response was significantly decreased on day 14 post infection in the macrophage-depleted group than in the PBS-treated control group of HSV-1 infected mice (n = 14 each group). The mean footpad swelling of the PBS-treated control group has been 1·1 mm as compared to 0·58 mm in the Cl2MDP-LIP treated group.

Figure 4.

Figure 4

Open in a new tab

Effect of macrophage depletion on DTH response to HSV-1 antigen. PBS or Cl2MDP-LIP was administered subconjunctivally on days 7 and 2 before corneal infection with HSV-1. Footpad swelling was measured 24 hr after HSV-1-antigen challenge. The DTH response on day 14 post infection was significantly reduced in Cl2MDP-LIP-treated mice compared to PBS-treated mice (P < 0·05).

Cytokines in regional lymph node lymphocytes

We were interested in investigating whether conjunctival macrophage depletion had an influence on the secretion of typical T-cell cytokines in the regional lymph nodes. Therefore, we examined the effect of conjunctival macrophage depletion on the Th1 and Th2 phenotypic cytokine production of lymphocytes obtained from the regional lymph nodes in the cell culture supernatants after preincubation with HSV-antigen (n = 8, pooled samples). As shown in Fig. 5, the mean production of IFN-γ on day 14 post infection has been higher in the control group than in the Cl2MDP-LIP treated mice. The levels of IL-2 were decreased at the days 10 and 14 post infection in the Cl2MDP-LIP mice in comparison to the control group.

Figure 5.

Figure 5

Open in a new tab

Levels of IFN-γ and IL-2 production from lymph nodes in mice treated with PBS or Cl2MDP-LIP. Each group of mice (n = 8) was treated on days 7 and 2 before infection. On days 5, 10 and 14 the mice were killed and lymph node cells were isolated. Cells were stimulated with UV-inactivated HSV-1 (108 PFU/ml) for 24 hr. Samples were assayed in triplicate, and the experiment was repeated twice. The bars represent the mean of released cytokine concentration and the SD. *Statistically significant compared with the PBS-treated control mice at P < 0·05, using paired Student's t-test. **The treated group was significantly (P < 0·01) different from the control group.

In contrast, IL-4 and IL-10 production was unaffected by the subconjunctival Cl2MDP-LIP treatment. The levels of IL-6 were also not influenced, as detected by bioassay (data not shown).

To exclude the possibility, that the treatment of mice leads to a generalized reduction in the T-cell responsiveness, we also analysed the experimental groups at the various time points for cytokine production following cocultivation with concanavalin A. The results showed that there were no significant differences between these groups.

HSV-1-specific proliferation of lymphocytes from the regional lymph nodes and spleen

One important macrophage function is the processing and presentation of antigens to CD4 positive helper T lymphocytes, which results in antigen-specific proliferation.34 Thus, we determined the HSV-1-specific proliferative response of lymph node cells obtained on days 5 or 14 after corneal HSV-1 infection from PBS- and Cl2MDP-LIP-treated mice. The results (n = 5 pooled samples) indicate that HSV-specific T-cell proliferation is impaired after depletion of conjunctival macrophages on days 5 and 14 post infection (Fig. 6). In contrast, a maximum of stimulation was observed by cocultivation with concanavalin A; there were, however, no differences between the experimental groups in this respect (data not shown).

Figure 6.

Figure 6

Open in a new tab

Th cell proliferation levels after in vitro stimulation with UV-inactivated HSV-1. On days 5, 10 and 14 five mice were killed, and lymph node and spleen cells were isolated. Cells were then stimulated with 108 PFU/ml HSV-1-antigen and with 5 µg/ml concanavalin A as a positive control. After 3 days of stimulation, cells were harvested, and counts per minute were determined. Samples were assayed in triplicate. This was repeated at least three times. *Statistically significant compared with the control at P < 0·05.

Antibody titre against HSV-1

To determine whether depletion of conjunctival macrophages might influence humoral immune responses against HSV-1-specific antigen, serum samples, obtained on different time points (days 5, 10, 14 and 28, each n = 8) after HSV-1 infection, were tested for the presence of HSV-1 neutralizing antibodies. As shown in Fig. 7, the titres of HSV-1-neutralizing antibodies profoundly increased after HSV-1 infection in mice that were depleted of conjunctival macrophages. Because macrophages are known to modify the Th1/Th2 ratio, the levels of IgG2a and IgG1 were measured. On day 10 the benchmark of the mean serum dilution was 1 : 1024 for IgG2a and 1 : 32 for IgG1. By day 14 the benchmark of the dilutions was 1 : 2048 for IgG2a and 1 : 256 for IgG1. For every test we used a laboratory standard as a control. The results showed, however, that the IgG2a/IgG1-ratio was not significantly influenced in the macrophage depleted mice (Table 4).

Figure 7.

Figure 7

Open in a new tab

Effect of macrophage depletion on induction of humoral immune response to HSV-1. Serum from PBS (n = 8) and macrophage-depleted (n = 8) mice was tested on days 5, 10, and 14 after corneal infection for neutralizing antibodies directed against HSV-1. *Statistically significant compared with the control at P < 0·05.

Table 4. Depletion of conjunctival macrophages.

PBS Cl2MDP-LIP
IgG2a (µg/ml) IgG1 (µg/ml) ratio IgG2a (µg/ml) IgG1 (µg/ml) ratio
d 10 post infection 10·76±2·12 0·25±0·11 42·5 8·62±1·05 0·187±0·11 46·08
d 14 post infection 28·87±11·61 2·94±2·29 11·81 28·86±9·07 3·13±1·88 10·71
Open in a new tab

Depletion of conjunctival macrophages did not alter the IgG2a/IgG1-ratio after corneal HSV-1 infection. Serum from PBS (n=8) and macrophage-depleted (n=8) mice were tested on days 5 (data not shown), 10 and 14 after corneal infection for anti-HSV-1 antibodies in a direct ELISA, using detection antibodies against IgG2a and IgG1.

Discussion

HSK is a T-cell mediated disease that is common in humans and can be induced experimentally in mice. HSK is characterized by elevated levels of T lymphocyte cytokines in the HSV-1 infected cornea. Neutralization of the T-cell cytokines IFN-γ or IL-2 has been reported to suppress HSK development.1 There is profound evidence that macrophage-derived mechanisms are of major importance for clearing the virus from the infected eye15,16 and for development of the immunologically driven stromal keratitis.15,25 However, the role of conjunctival macrophages on the development of the T-cell-immune response in this disease has not yet been elucidated.

The data in this study show that the typical Th1 and Th2 cytokine concentrations were reduced in corneas from macrophage-depleted animals. This is also supported by the RT–PCR method used. Only traces of IL-10 were found in the cornea specimens, and IL-10 was not affected by macrophage depletion (data not shown). Although it is tempting to speculate that macrophage depletion will induce a shift in the T-cell response from a Th1-cell-dominated population in the Th2 direction, this was not the case in the cornea. Our observations suggest that macrophage depletion impairs both the Th1 and Th2 response in the HSV-1-infected cornea, finally resulting in a down-regulation of the vision-threatening immune-mediated HSK.

In accordance with our findings, a reduction in corneal allograft rejection and IL-1β, IL-2RA, IL-2, IL-4, IL-6, IFN-γ, tumour necrosis factor-β (TNF-β), monocyte chemoattractant protein-1 and macrophage inflammatory protein-2 (MIP-2) mRNA in the corneas after conjunctival macrophage depletion was also determined in another study.35 Because IL-2 is not produced by macrophages, our data suggest that macrophages in the conjunctiva and corneal limbus up-regulate IL-2 secretion of T cells in the cornea and T-cell proliferation. Furthermore, IFN-γ secretion is up-regulated, and this may result in increased major histocompatibility complex expression, B-7, TNF-α receptor and CD40 molecule expression in other cells, including antigen-presenting cells (APC), finally inducing a positive feedback loop of the corneal inflammation. Depletion of the macrophages may also alter the secretion of diverse chemokines in the cornea that support the development of HSK. Indeed, mice with a disrupted gene for MIP-1α displayed minimal T-cell and PMN infiltration of the cornea and HSK after corneal HSV-1 infection.36 Interestingly, viral clearance from the eye was not hampered.

The next issue was to investigate whether this effect of macrophages on T-cell response was just local or whether it was also systemic. DTH-positive T-cells play a dual role after corneal HSV-1 infection: they protect the body against virus, but they are also involved in the development of blinding stromal keratitis. Because DTH response is induced by APC and regulatory cytokines, we wondered what influence macrophages might have. Our data show that macrophage-depleted animals show a reduced DTH response on day 14 after HSV infection compared to PBS-treated control mice. It is possible that antigen-specific T cells migrate to the regional lymph nodes, which are located in the submandibular region or elsewhere in the body where they exert their antigen-specific response. One might also speculate that subconjunctival Cl2MDP-LIP treatment depleted the macrophage population in the regional lymph nodes or in the spleen. However, our flow cytometric analysis using F4/80- and CD11b-specific antibodies excluded this possibility. Depletion of the macrophages from the submandibular lymph nodes was only found after subcutaneous Cl2MDP-LIP treatment.25,37

Our data reveal that conjunctival macrophage depletion decreases the secretion of characteristic Th1 cytokines in the regional lymph nodes. Compared to the control group, the IL-2 and IFN-γ levels were both decreased in the cell supernatants obtained from animals with subconjunctival macrophage depletion. This effect may be induced by the diverse cytokines, which are produced by activated macrophages. In this respect, the IL-12 may be of major importance. IL-12 is produced by antigen-presenting cells and induces differentiation of activated T cells to the Th1 cell type.38

We found that in comparison to the control group, HSV-specific proliferation of T cells from the regional lymph nodes was reduced in animals with depleted conjunctival macrophages. It is very likely that macrophage depletion results in decreased antigen presentation and reduced production of related cytokines, with a loss of T-cell activation or a reduction in the effect of growth factors liberated by macrophages on T-cell function.

Injection of antigen into the anterior chamber of the eye results in the induction of anterior-chamber-associated immune deviation (ACAID), in which DTH cells are selectively suppressed while serum anti-HSV antibodies are present. Following presentation of particulate antigens (e.g. HSV antigens) in the eye, soluble signals are released by T cells directly into the blood, then home to the spleen where T cells are activated that down-regulate the DTH response.39,40 This is supported by the observation that the injection of HSV into the anterior chamber at the time of corneal infection prevents the development of HSK, and this is associated with a decrease of DTH.41 At this point, we can only speculate that macrophages in the conjunctiva and regional lymph nodes accelerate DTH by their antigen-presenting function and appear to be important for local, terminal activation of CD4-positive DTH cells. They also participate in the immediate defence response to infections of the ocular surface.

In the next step we investigated whether depletion of the macrophages also affects the humoral immune response directed against HSV-1. The results showed that the neutralizing antibody titres are increased by conjunctival macrophage depletion. We can only speculate about the underlying mechanisms. The cytokine profile did not show any increase of the Th2 cytokines, which are known to support the humoral immune response.42 The increased humoral immune response may therefore be the result of the fact that macrophage depletion impairs the clearance of the HSV-1 from the infected eye.15,16 As a consequence, more HSV-1 antigen was available for other cells such as B cells, and this may result in the increased humoral immune response. Another possibility is that this results from competition for the antigen by macrophages and other APC, such as B cells.43 After depletion of macrophages, more antigen would be available for B cells. Our observation is in accordance with a previous study.44 This study showed that macrophage depletion before immunization with mouse hepatitis virus strain A59 (MHV-A59) resulted in increased virus-specific cellular and humoral response. Interestingly, depletion of macrophages in the regional lymph nodes using our HSK animal model resulted in a decreased neutralizing antibody production (unpublished data), while virus clearance of the eye was unaffected.25 However, a decrease in antibody production after conjunctival macrophage depletion has been shown by others in an animal model of corneal graft transplantation.45

It is well known that HSV-1-neutralizing antibodies attack the virus and are important in preventing recurrent HSV replication. The humoral immune response is also important with respect to the development of immune-mediated stromal keratitis. Corneal infections with HSV-1 are less likely to proceed to stromal keratitis if anti-HSV antibodies are administered systemically; pretreatment of mice with anti-HSV antibodies protects against stromal disease.11–13

It has been shown recently that the titres of IgG2a and IgG1 have an indicator function in the relation of Th1 to Th2. While IgG2a is induced by IFN-γ, IgG1 is induced by IL-4.46 However, the depletion of conjunctival macrophages did not result in a shift between the ratio of IgG2a and IgG1 against HSV-1.

In summary, the data available so far suggest that conjunctival macrophages play no role in the innate immune response16 but they do play a major role in the acquired immune response after corneal HSV-1 infection. The regulatory function of conjunctival macrophages with respect to the dichotomy of the Th1 to Th2 cell responses in this animal model is less important.

Acknowledgments

Supported by the Deutsche Forschungsgemeinschaft (He 1877/7-1) (He 1877/12-1), Ernst and Berta Grimmke-Foundation and IFORES grant.

References

  • 1.Hendricks RL, Tumpey TM, Finnegan A. IFN-gamma and IL-2 are protective in the skin but pathologic in the cornea of HSV-1-infected mice. J Immunol. 1992;149:3023–8. [PubMed] [Google Scholar]
  • 2.Niemialtowski MG, Rouse BT. Phenotypic and functional studies on ocular T cells during herpetic infections of the eye. J Immunol. 1992;148:1864–70. [PubMed] [Google Scholar]
  • 3.Niemialtowski MG, Rouse BT. Predominance of Th1 cells in ocular tissue during herpetic stromal keratitis. J Immunol. 1992;149:3035–9. [PubMed] [Google Scholar]
  • 4.Heiligenhaus A, Berra A, Foster CS. CD4+ Vβ8+ T cells mediate herpes stromal keratitis. Curr Eye Res. 1994;13:711–6. doi: 10.3109/02713689409047004. [DOI] [PubMed] [Google Scholar]
  • 5.Tang Q, Chen W, Hendricks RL. Proinflammatory functions of IL-2 in herpes simplex virus corneal infection. J Immunol. 1997;258:1275–83. [PubMed] [Google Scholar]
  • 6.Babu JS, Kanangat S, Rouse BT. T cell cytokine mRNA expression during the course of the immunopathologic ocular disease herpetic stromal keratitis. J Immunol. 1995;154:4822–9. [PubMed] [Google Scholar]
  • 7.Heiligenhaus A, Bauer D, Zheng M, Mrzyk S, Steuhl KP. CD4+ T-cell type 1 and type 2 cytokines in the HSV-1 infected cornea. Graefe's Arch Clin Exp Ophthalmol. 1999;237:399–406. doi: 10.1007/s004170050251. [DOI] [PubMed] [Google Scholar]
  • 8.Tumpey TM, Elner VM, Chen SH, Oakes JE, Lausch RN. Interleukin-10 treatment can suppress stromal keratitis induced by herpes simplex virus type 1. J Immunol. 1994;153:2258–65. [PubMed] [Google Scholar]
  • 9.Tumpey TM, Chen SH, Oakes JE, Lausch RN. Neutrophil-mediated suppression of virus replication after herpes simplex virus type 1 infection of the murine cornea. J Virol. 1996;70:898–904. doi: 10.1128/jvi.70.2.898-904.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Thomas J, Gangappa S, Kanangat S, Rouse BT. On the essential involvement of neutrophils in the immunopathologic disease herpetic stromal keratitis. J Immuno. 1997;158:1383–91. [PubMed] [Google Scholar]
  • 11.Lausch RN, Kleinschrodt WR, Monteiro C, Kayes SG, Oakes JE. Resolution of HSV cornea infection in the absence of delayed-type hypersensitivity. Invest Ophthalmol Vis Sci. 1985;26:1509–15. [PubMed] [Google Scholar]
  • 12.Inoue Y, Oh JO, Minasi P. Protective effect of anti-glycoprotein D antibody on herpetic chorioretinitis in newborn rabbits. Curr Eye Res. 1991;10:159. doi: 10.3109/02713689109020373. [DOI] [PubMed] [Google Scholar]
  • 13.Staats HF, Lausch RN. Cytokine expression in vivo during murine herpetic keratitis: effect of protective antibody therapy. J Immunol. 1993;151:277–83. [PubMed] [Google Scholar]
  • 14.Van Klink F, Taylor WM, Alizadeh H, Jager MJ, Van Rooijen N, Niederkorn JY. The role of macrophages in Acanthamoeba keratitis. Invest Ophthalmol Vis Sci. 1996;37:1271–81. [PubMed] [Google Scholar]
  • 15.Bauer D, Mrzyk S, van Rooijen N, Steuhl KP, Heiligenhaus A. Macrophage-depletion influences the course of murine HSV-1 keratitis. Curr Eye Res. 2000;20:45–53. [PubMed] [Google Scholar]
  • 16.Cheng H, Tumpey TM, Staats HF, van Rooijen N, Oakes JE, Lausch RN. Role of macrophages in restricting herpes simplex virus type 1 growth after ocular infection. Invest Ophthalmol Vis Sci. 2000;41:1402–9. [PubMed] [Google Scholar]
  • 17.Hayashi K, Kurata T, Morishima T, Nassery T. Analysis of the inhibitory effect of peritoneal macrophages on the spread of herpes simplex virus. Infect Immun. 1980;28:350–8. doi: 10.1128/iai.28.2.350-358.1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Sit MF, Tenney DJ, Rothstein JL, Morahan PS. Effect of macrophage activation on resistance of mouse peritoneal macrophages to infection with herpes simplex virus type 1 and 2. J General Virol. 1988;69:1999–2010. doi: 10.1099/0022-1317-69-8-1999. [DOI] [PubMed] [Google Scholar]
  • 19.Van Rooijen N, Sanders A. Elimination, blocking, and activation of macrophages: three of a kind? J Leukoc Biol. 1997;62:702–9. doi: 10.1002/jlb.62.6.702. [DOI] [PubMed] [Google Scholar]
  • 20.Paludan SR. Interleukin-4 and interferon-γ: the quintessence of a mutual antagonistic relationship. Scand J Immunol. 1998;48:459–68. doi: 10.1046/j.1365-3083.1998.00435.x. [DOI] [PubMed] [Google Scholar]
  • 21.Qian Q, Jutila MA, van Rooijen N, Cutler JE. Elimination of mouse splenic macrophages correlates with increased susceptibility to experimental disseminated candidiasis. J Immunol. 1994;152:5000–8. [PubMed] [Google Scholar]
  • 22.Van Rooijen N, Sanders A. Liposome-mediated depletion of macrophages: mechanism of action, preparation of liposomes and applications. J Immunol Meth. 1994;174:83–93. doi: 10.1016/0022-1759(94)90012-4. [DOI] [PubMed] [Google Scholar]
  • 23.Claassen I, van Rooijen N, Claassen E. A new method for removal of mononuclear phagocytes from heterogenous populations in vitro, using the liposome-mediated macrophage ‘suicide’ technique. J Immunol Meth. 1990;134:153–61. doi: 10.1016/0022-1759(90)90376-7. [DOI] [PubMed] [Google Scholar]
  • 24.Matsuda A, Tagawa Y, Yatsuda H, Nishihira J. Expression of macrophage migration inhibitory factor in corneal wound healing in rats. Invest Ophthalmol Vis Sci. 1997;38:1555–62. [PubMed] [Google Scholar]
  • 25.Bauer D, Mrzyk S, van Rooijen N, Steuhl KP, Heiligenhaus A. Incidence and severity of herpetic stromal keratitis: impaired by the depletion of lymph node macrophages. Exp Eye Res. 2001;72:261–9. doi: 10.1006/exer.2000.0947. [DOI] [PubMed] [Google Scholar]
  • 26.Heiligenhaus A, Berra A, Dutt JE, Zhao TZ, Wells PA, Foster CS. T-cell-induced prevention of HSV-1 keratitis by immunization with the synthetic peptide of glycoprotein D. Ophthalmologe. 1994;91:608–16. [PubMed] [Google Scholar]
  • 27.Steinmuller C, Steinhoff G, Bauer D, et al. Analysis of leukocyte activation during acute rejection of pulmonary allografts in noninfected and cytomegalovirus-infected rats. J Leukoc Biol. 1997;61:40–9. doi: 10.1002/jlb.61.1.40. [DOI] [PubMed] [Google Scholar]
  • 28.Van Snick J, Cayphas S, Fink A, Uyttenhove C, Coulie P, Simpson R. Purification and NH2-terminal amino acid sequence of a new T cell derived lymphokine with growth factor activity for B-cell. Proc Natl Acad Sci USA. 1986;83:9679–83. doi: 10.1073/pnas.83.24.9679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Jayaraman S, Heiligenhaus A, Rodriguez A, Soukiasian S, Dorf ME, Foster CS. Exacerbation of murine herpes simplex virus-mediated stromal keratitis by Th2 type T cells. J Immunol. 1993;151:5777–89. [PubMed] [Google Scholar]
  • 30.Rouse BT. Role of adaptive immune defense mechanisms in Herpes simplex resistance. In: Rouse BT, Lopez C, editors. Immunobiology of HSV Infection. Boca Raton, Fl: CRC Press; 1983. [Google Scholar]
  • 31.Adler K, Buzby P, Bobrow M, Erickson T. Rapid DNA detection using fluoresscein-antifluorescein-based (FAF) ELOSA. Dupont Biotechn Update. 1992;7:13–5. [Google Scholar]
  • 32.Köhler TH, Laßner D, Rost AK, Thamm B, Pustowait B, Remke H. Berlin: Springer; 1995. Quantitation of mRNA by Polymerase Chain ReactionNonradioactive PCR Methods. [Google Scholar]
  • 33.Clontech. 1996. Methods and Applications Book 3: Quantitative RT–PCR. [Google Scholar]
  • 34.Sin JI, Kim JJ, Arnold RL, Shroff KE, et al. IL-12 gene as a DNA vaccine adjuvant in a herpes mouse model: IL-12 enhances Th1-type CD4+ T cell-mediated protective immunity against herpes simplex virus-2 challenge. J Immunol. 1999;162:2912–21. [PubMed] [Google Scholar]
  • 35.Torres PF, Slegers TP, Peek R, van Rooijen N, van der Gaag R, Kijlstra A, de Vos AF. Changes in cytokine mRNA levels in experimental corneal allografts after local clodronate-liposome treatment. Invest Ophthalmol Vis Sci. 1999;40:3194–201. [PubMed] [Google Scholar]
  • 36.Tumpey TM, Cheng H, Cook DN, Smithies O, Oakes JE, Lausch RN. Absence of macrophage inflammatory protein-1a prevents the development of blinding herpes stromal keratitis. J Virol. 1998;72:3705–10. doi: 10.1128/jvi.72.5.3705-3710.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Delemarre FG, Kors N, van Rooijen N. Elimination of spleen and of lymph node macrophages and its difference in the effect on the immune response to particulate antigens. Immunobiology. 1990;182:70–8. doi: 10.1016/S0171-2985(11)80584-X. [DOI] [PubMed] [Google Scholar]
  • 38.Heinzel FP, Schoenhaut DS, Rerko RM, Rosser LE, Gately MK. Recombinant interleukin 12 cures mice infected with Leishmania major. J Exp Med. 1993;177:1797–802. doi: 10.1084/jem.177.5.1505. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Ferguson TA, Herndon JM. The immune response and the eye: the ACAID inducing signal is dependent on the nature of the antigen. Invest Ophthalmol Vis Sci. 1994;35:3085–93. [PubMed] [Google Scholar]
  • 40.Streilein JW, Dana R, Ksander BR. Immunity causing blindness: five different path to herpes stromal keratitis. Immunol Today. 1997;18:443–9. doi: 10.1016/s0167-5699(97)01114-6. [DOI] [PubMed] [Google Scholar]
  • 41.Ksander BR, Hendricks RL. Cell-mediated immune tolerance to HSV-1 antigens associated with reduced susceptibility to HSV-1 corneal lesions. Invest Ophthalmol Vis Sci. 1987;28:1986–93. [PubMed] [Google Scholar]
  • 42.Janeway CA, Travers P. Immunologie. 2. Heidelberg: Spektrum, Akademischer Verlag; 1997. [Google Scholar]
  • 43.Van Rooijen N. Macrophages as accessory cells in the ‘in vivo’ humoral immune response: from processing of particulate antigens to regulation of suppression. Sem Immunol. 1992;4:237–45. [PubMed] [Google Scholar]
  • 44.Wijburg OLC, Heemskerk MHM, Boog CJP, van Rooijen N. Role of spleen macrophages in innate and acquired immune response against mouse hepatitis virus strain A59. Immunology. 1997;92:252–8. doi: 10.1046/j.1365-2567.1997.00340.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Slegers TP, Torres PF, Broersma L, van Rooijen N, van Rij G, van der Gaag R. Effect of macrophage depletion on immune effector mechanism during corneal allograft rejection in rats. Invest Ophthalmol Vis Sci. 2000;41:2239–47. [PubMed] [Google Scholar]
  • 46.Snapper CM, Mond JJ. Towards a comprehensive view of immunoglobulin class switching. Immunol Today. 1993;15:15–7. doi: 10.1016/0167-5699(93)90318-F. [DOI] [PubMed] [Google Scholar]

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES