Abstract
In healthy humans, antibody repertoires change during ontogeny and senescence. The dynamics of antibody repertoires among adults over a longer period of time in one and the same individual has, however, not been extensively studied. In this study we analysed peripheral blood samples from five healthy adults, taken over a period of 10 weeks and once 9 years later. A competitive, quantitative polymerase chain reaction (PCR) was developed to investigate short and long-term variations in VH gene family repertoires. Serum antibody levels to common self and non-self antigens were determined in samples taken at the same time-points as the cell samples to analyse possible correlations between molecular and serological expression profiles. We found a high degree of stability in the VH gene family repertoire over time as well as between individuals with a Caucasian background. A specific change in the usage of primarily the VH3 and VH5 gene families was observed in one individual at one time-point. The deviating pattern resembled the VH gene family utilization pattern observed in naturally activated B lymphocytes. The fluctuations in VH3 and VH5 gene family expression correlated with the presence of rheumatoid factor in serum. We discuss the possible influence of polyclonal, transient stimulation of B cells on VH gene repertoires, as measured in circulating B cells.
Introduction
While the potential B-cell repertoire of a human is very large, only a fraction is actually expressed in the adult individual at one time-point. Three main mechanisms influence the process shaping the peripheral repertoire of B cells. First, the potential diversity in lymphocyte repertoires is created largely by a well-defined, developmentally regulated process in the bone marrow through recombination of the genes coding for the variable region of the heavy (VH) and the light (VL) chains1 with insertion of templated and non-templated nucleotides at the junctions.2 Second, several selection processes take place based on the antigen-binding part of the antibody molecule expressed on the cell surface.3,4 This way autoreactive clones are deleted in the bone marrow,5 excluded from access to survival signals in the peripheral organs, or induced into an anergic state.5,6 Third, antigen-driven responses during life induce the proliferation of specific clones, introduce somatic diversification by mutation and generate a memory pool of lymphocytes.7,8 Together, these processes result in alterations of the antibody repertoire during B-cell development as well as during ontogeny and senescence.9
At a serum level, the immunoglobulin M (IgM), as well as the immunoglobulin G (IgG), reactivity pattern differentiates until 1–2 years of age, after which it is relatively stable. Reactivity patterns change from expressing a high degree of homogeneity among neonates to being more diverse in children, young adults and elderly individuals. Self-reactive repertoires are more conserved between individuals and in time than antibacterial repertoires.10–16 At a molecular level, evidence has accumulated that expression of the VH gene family is not random, nor a simple reflection of genomic complexity.17,18 The genes coding for the VH region are divided into seven families, based on nucleotide sequence homology,14,15 and are located on chromosome 14q32.33.16 Restricted VH gene family usage has been shown early in fetal development,19,20 in malignant B cells,21 in CD5+ B1 B cells22 and in autoantibody repertoires.23 Adult peripheral repertoires show a VH gene family utilization pattern that correlates approximately with their genomic complexity, with the VH3 gene family most frequently used.17,18,24 However, some of the smaller gene families are over-represented, while only a few members of the VH3 family are preferentially used.25,26
Most studies concerning VH gene family repertoires in healthy adults are based on samples obtained from one or more persons at one time-point. The reported deviation of one individual at one time-point from the normally observed repertoire in the work of Huang et al.,27 which could not be reproduced in samples from the same individual taken 1 year later,28 raises the question of how stable the repertoire is during the lifetime of a healthy individual, and to what extent it is influenced by fluctuations in the environment or health state of the individual at the time of sampling. The lack of information on this subject makes it hard to assess the significance of restricted or deviating VH gene repertoires reported in ontogeny, senescence or autoimmune disease. Therefore, we developed a DNA-based competitive polymerase chain reaction (PCR) to quantify VH gene family usage in peripheral blood lymphocytes (PBL) at consecutive time-points. We also performed enzyme-linked immunosorbent assay (ELISA)-based determinations of common serum antibody reactivities to evaluate possible correlations between VH gene family utilization and serological status.
Materials and methods
Donor samples
Peripheral blood samples from five healthy individuals (two male, three female, all of Caucasian origin) were obtained during a 10-week period at 1-week intervals, and once ≈ 9 years after the first sample was taken. The ages of the individuals at the time the first sample was taken varied between 32 and 48 years. From four of the individuals three time-points were analysed: week 1, week 9 or 10, and 9 years. From one individual, called ‘B’, all 11 time-points were analysed.
Serum, isolation of mononuclear cells and DNA preparation
Whole blood was allowed to clot and, after centrifugation (1000 g, 10 min), the serum thus obtained was aliquoted and frozen at −20° until required for analysis. Mononuclear cells were isolated from heparinized blood on a Lymphoprep gradient (Nycomed™; Pharma AS, Oslo, Norway), washed twice in RPMI (Gibco-BRL, Life Technologies, Ltd, Paisley, UK) without supplements, frozen in fetal calf serum (FCS) with 10% dimethylsulphoxide (DMSO) and stored in liquid nitrogen. For preparation of genomic DNA, the cells were thawed, washed in RPMI and lysed in digestion buffer [100 mm NaCl, 10 mm Tris–HCl (pH 8·0), 0·5% sodium dodecyl sulphate (SDS) and 0·1 mg/ml proteinase K] for 12 hr at 37°. After extraction with saturated (6 m) NaCl, the DNA was precipitated with ethanol and dissolved in 1× TE (10 mm Tris–HCl, pH 7·6, 1 mm EDTA, pH 8·0).
Competitor constructs and PCR primers
A quantitative PCR technique was developed based upon competition for reagents between a target sequence and an engineered competitor sequence. Although originally designed for colorimetric quantification,29,30 in this study the two competitive fragments were distinguished by a size difference of 20–30 bp and quantified by densitometry. The constructs containing a competitive sequence were made by PCR amplification of the genomic target gene followed by cloning of the fragment into a vector plasmid. The cloning procedure is illustrated in Fig. 1. A small intron (the LacO sequence, 23 bp) was incorporated into the fragment during amplification, by adding this sequence to one of the primers. Thus, the genomic target gene and the competitive fragment contained the same primer sequences as well as an intervening sequence with >90% similarity, and were therefore expected to amplify with equal efficiencies.31 Six vector plasmids containing a competing sequence, one for each of the main VH families (VH7 was detected by the VH1-directed primers), were constructed by running two separate amplifications, using the primers shown in Table 1. The two products from the first and the second PCR were cloned together in a two-step process into a pSp72 vector (Promega, Madison, WI) and control-sequenced.
Figure 1.
Construction of the competitor templates. VH FR3=framework region 3 of the VH genes (residues 66–92; see ref. 51). LacO=Lac operon sequence, 23 additional nucleotides introducing a length difference.52 Black bars above the sequence represent the forward primers, bars below the sequence represent the reverse primers (sequences are given in Tables 1 and 2). (a) Chromosomal DNA and the primers used for cloning the competitor template. (b) The competitor template and the position of the primers used for the quantitative polymerase chain reaction (PCR).
Table 1. Sequences and restriction sites for the oligonucleotides used in constructing the competitor templates.
| Target region | Restriction site | Nucleotide sequence |
|---|---|---|
| Forward primers, product ‘A’ | ||
| ″VH1 leader region | EcoRI | ACTGGACCTGGAGGGTCTT |
| ″VH2 leader region | EcoRI | TTCTCCACAGGGGTCTTATC |
| ″VH3 leader region | EcoRI | ATGGAGTTTGGGCTGAGCTG |
| ″VH4 leader region | EcoRI | ATGAAACACCTGTGGTTCTTC |
| ″VH5 leader region | EcoRI | TGGGGTCAACCGCCATCCT |
| ″VH6 leader region | EcoRI | TGTCTGTCTCCTTCCTCATC |
| Reverse primers, product ‘A’ | ||
| ″VH FR3 (cons. seq.) | BamHI | TSTCTCGCACAGTAATACAYG |
| ″VH FR3 (VH2) | Sal1 | TSTCTCGCACAGTAATACAYG |
| ″VH FR3 (VH6) | BamHI | TCTCTCTCACAGTAATACACAG |
| Forward primers, product ‘B’ | ||
| ″VH FR3+LacO seq. | BamHI | AATTGTTATCCGCTCACACAATTCCRTGTATTACTGTGCGAGA |
| ″VH FR3 (VH2)+LacO seq. | Sal1 | AATTGTTATCCGCTCACACAATTCCRTGTATTACTGTGCGAGA |
| ″VH FR3 (VH6)+LacO seq. | BamHI | AATTGTTATCCGCTCACACAATTGCTGTGTATTACTGTGAGAGA |
| Reverse primer, product ‘B’ | ||
| ″JH (cons. seq.) | HindIII | TYACCTGAGGAGACRGTGA |
All sequences are given from 5′ to 3′. Product ‘A’ and ‘B’ refer to those shown in Fig. 1.
Cons. seq., consensus sequence for the seven different VH families; FR3, framework region 3 of the VH heavy genes (residues 66–92; ref. 51); LacO seq., 23 additional nucleotides introducing a length difference,52 shown in italics; leader region, leader region of the VH gene.
Competitive PCR and quantification
A 160-ng sample of genomic DNA was co-amplified together with different concentrations of the competitor template in a 10-µl reaction volume with 0·3 µm of a VH family [framework region 1 (FRI)]-specific oligonucleotide primer and a 0·3-µm mix of the JH1-6 oligonucleotides (see Table 2). Taq polymerase (1 U) was used in the supplier buffer together with 175 µm of each dNTP (Perkin-Elmer Biosystems, Stockholm, Sweden). For each of the six different competitor templates at least five different concentrations of competitor were run per person per time-point. The two products were quantified by means of densitometry (CCD Camera, software DIANA II and Tina 2·0 g; Fujifilm Sverige AB, Stockholm, Sweden), and the data were plotted as log10(competitor concentration) against log10[ratio(target ÷ competitor)]. The number of target DNA gene copies was then calculated by extrapolating from the intersection of the curves, where the amounts of target and competitor are equal [log10(ratio[target ÷ competitor])=0]. Data were corrected for the difference in length between the genomic and the competitor templates. Each individual data point is the result of one experiment, unless stated otherwise.
Table 2. Sequences for the oligonucleotides used as primers for competitive polymerase chain reaction (PCR).
| Target region | Nucleotide sequence |
|---|---|
| VH1 FR1 | TGG TGC AGT CTG GGG CTG A |
| VH2 FR1 | GAA ACC CAC ACA GAC CCT CA |
| VH3 FR1 | AGG TGC AGC TGG TGG AGT C |
| VH4 FR1 | ACC CTG TCC CTC ACC TGC |
| VH5 FR1 | GTC TCT GAG GAT CTC CTG TA |
| VH6 FR1 | CTC TCA CTC ACC TGT GCC A |
| JH1,4,5 | TGA CCT GAG GAG ACG GTG A |
| JH2 | TGA CCT GAG GAG ACA GTG A |
| JH3 | CTT ACC TGA AGA GAC GGT GA |
| JH6 | TTA CCT GAG GAG ACG GTG A |
All sequences are given from 5′ to 3′.
FR1, framework region 1 one of the VH gene (residues 1–30; see ref. 51)
Antigens and ELISA reactions
Microtitre plates (96-well) were coated with the relevant antigen, 50 µg/ml in phosphate-buffered saline (PBS), by incubation for 2 hr at room temperature or at +4° overnight. The antigens used were purified Fc fragments, double-stranded (ds)DNA, thyroid hormone receptor (THR), thyroglobulin (TG), cytomegalovirus (CMV), herpes simplex virus (HSV), pneumococcal polysaccharides (PPS) 3 and 6, tetanus toxin (TT) and teichon acid. All antigens were obtained from the Swedish Institute for Infectious Disease Control (SMI, Solna, Sweden), apart from the Fc fragments which were purified from commercial Endobulin (IgG content at least 99·5%) (Immuno Sweden AB, Solna, Sweden) by repeated affinity chromatography with anti-κ and -λ antibodies, following papain digestion and separation on a protein G column. After saturation with 1% gelatin in PBS or 0·5% bovine serum albumin (BSA) in PBS (200 µl/well) for 30 min at room temperature, the plates were washed three times in PBS. Serum was serially diluted in PBS containing 1% gelatin. After incubation (2 hr at room temperature or 4° overnight) and washing, the plates were incubated with the relevant conjugates: αΗIg, αΗIgG or αΗIgM, labelled with peroxidase (Dakopatts AB, Älvsjö, Sweden). After washing, the substrate ortho-phenyldiamine (OPD) in buffer solution (0·049 m citric acid, 0·11 m Na2HPO4, pH 5·0) was added. The reactions were stopped with 10% SDS and the plates read at 450 nm in a microplate reader (Bio-Tek Instruments Inc., Winooski, Vermont). The ELISA reactions were performed directly after the initial 10-week period. A serum sample for the 9-year time-point was not taken.
Data analysis and statistics
The relative values for VH gene family usage were calculated by dividing the value obtained for the usage of one VH gene family by the sum of the values for all VH gene families, multiplied by 100. Competitor starting concentrations were determined in pmol and transformed to number of template copies before quantification and analysis. For multiparameter correlations of serum antibody levels and VH gene family usage, the linear Pearson correlation was used.
Results
Competitive quantitative PCR for VH gene family analysis
VH gene family usage at a DNA level was analysed using a competitive, quantitative PCR. A protocol involving competitive amplification of a target sequence together with various known concentrations of a cloned version, was adapted from Lundeberg et al.29 As shown in Fig. 2, the distribution of VH gene family utilization is the same using absolute values (number of template molecules) and relative values (% of total VH gene family utilization): VH3>VH4>VH1>VH5>VH2/VH6. Single experiments were run several times, using a new template aliquot as well as new dilutions of primers and competitor, obtaining very similar results (data not shown). Interassay variation, measured as coefficient of variation (CV) was defined as follows and varied between 10 and 60%:
Figure 2.
VH gene family utilization in five healthy individuals. Data shown represent the distribution of the mean values for VH gene family expression measured at three to 11 different time-points for each individual. The whiskers include the minimal and maximal mean values, whereas the boxes include 25–75% percentile values. The squares indicate medium values. (a) Mean absolute values of VH gene family utilization in number of template molecules. (b) Mean relative values of VH gene family utilization, as percentage of total VH gene family utilization in each sample.
The magnitude of the CV correlated negatively to the magnitude of family utilization, such that the CV varied between 10 and 20% between different individuals and different time-points for the VH gene family most frequently used (VH3).
VH gene family usage in healthy individuals
Peripheral blood samples were taken from five healthy individuals at three time-points: week 1, week 9 or 10, and 9 years after the first sample. For four of the five individuals the VH gene family repertoire at the different time-points is shown in Fig. 3. Ranges for VH gene family utilization are given in Table 3, for each individual as well as for the compiled data.
Figure 3.
Relative VH gene family utilization in peripheral blood lymphocytes (PBL) from four healthy individuals at three different time-points. VH gene family utilization is shown as percentage of total VH gene family utilization. To facilitate comparison between the different time-points, the different VH gene families are connected with lines. Circles indicate the first time-point (week 1), squares indicate the second time-point (week 9 or 10), whereas the triangles indicate samples taken 9 years after the first sample.
Table 3. Ranges and mean values of VH gene family utilization.
| VH1 | VH2 | VH3 | VH4 | VH5 | VH6 | |
|---|---|---|---|---|---|---|
| Ranges | ||||||
| ″Within individuals | ||||||
| ″″B (n = 11) | 1·9–16·1 | 0·35–1·4 | 25·4–88·9 | 1·2–26·0 | 1·0–34·7 | ND–2·6 |
| ″″A (n = 3) | 0·9–9·1 | 0·3–2·2 | 67·1–79·6 | 10·5–14·6 | 2·7–10·7 | 0·2–4·2 |
| ″″C (n = 3) | 2·3–9·7 | 0·2–0·6 | 71·0–91·7 | 1·0–15·6 | 0·2–6·1 | 0·1–1·3 |
| ″″H (n = 3) | 3·3–6·2 | 0·2–1·7 | 67·0–76·9 | 13·5–19·3 | 2·8–3·8 | ND–8·7 |
| ″″L (n = 3) | 8·2–24·0 | 0·7–2·1 | 59·3–82·4 | 2·7–18·2 | 2·0–3·1 | 1·7–1·9 |
| ″All individuals (mean values) | 4·6–16·3 | 0·3–1·6 | 60·7–81·9 | 7·8–16·0 | 2·6–10·7 | 0·4–3·7 |
| ″All values | 0·9–24·0 | 0·2–2·2 | 25·4–91·7 | 1·0–26·0 | 0·2–34·7 | ND–8·7 |
| Mean values (±SD) | ||||||
| ″Within individuals | ||||||
| ″″B (n = 11) | 11·1 (±4·1) | 0·7 (±0·3) | 60·7 (±21·5) | 16·0 (±8·7) | 10·7 (±11·8) | 0·8 (±0·9) |
| ″″A (n = 3) | 4·6 (±4·2) | 1·3 (±1·0) | 74·1 (±6·4) | 12·4 (±2·1) | 5·6 (±4·4) | 2·0 (±2·1) |
| ″″C (n = 3) | 7·2 (±5·0) | 0·3 (±0·3) | 81·9 (±12·3) | 7·8 (±8·5) | 3·2 (±1·6) | 0·4 (±0·7) |
| ″″H (n = 3) | 4·9 (±1·4) | 0·7 (±0·9) | 71·9 (±4·9) | 15·6 (±3·2) | 3·2 (±0·5) | 3·7 (±4·5) |
| ″″L (n = 3) | 16·3 (±7·9) | 1·6 (±0·7) | 67·2 (±13·1) | 10·4 (±7·8) | 2·6 (±0·5) | 1·8 (±0·1) |
| ″All individuals (mean values) | 8·8 (±4·4) | 0·9 (±0·5) | 71·1 (±7·9) | 12·4 (±3·5) | 4·9 (±3·4) | 1·8 (±0·3) |
| ″All values | 9·7 (±5·5) | 0·8 (±0·6) | 67·0 (±17·9) | 13·9 (±7·6) | 7·2 (±9·1) | 1·4 (±1·9) |
ND, non-determinable.
Kinetics of VH gene usage in one healthy subject during 10 consecutive weeks
Compared to the mean values of week 1 and 9 years, one of the five individuals (‘B’) – not presented in Fig. 3– showed a marked decrease in VH3 gene family usage at week 10 (from 84·7 to 27·5%), in combination with a rise in VH4 (from 5·7 to 25·5%) and VH5 (from 4·1 to 30·9%). From this individual, samples taken during 10 consecutive weeks were analysed and the results are shown in Fig. 4. Figure 4(a) shows patterns of VH gene family utilization, comparable to that presented in Fig. 3 for the other individuals. Figure 4(b) shows the values for all VH families over time. Apart from the data obtained at week 10, all other time-points analysed showed a VH gene family usage similar to week 1 and 9 years, as well as to the data obtained from the other individuals. To exclude the possibility of an artefact, the PCR for the sample from week 10 was run twice more, once preparing new DNA from another aliquot of frozen cells, and once using a different aliquot of primers; almost identical results were obtained: 24·5%, 27·5% and 30·1%, respectively, for VH3 gene family usage (Fig. 4b).
Figure 4.
Relative VH gene family utilization in peripheral blood lymphocytes (PBL) from one healthy individual at 10 consecutive weeks and once 9 years later. VH gene family utilization is shown as percentage of total VH gene family utilization. (a) Patterns of VH gene family utilization. Circles indicate the time-points week 1 to week 9. The diamond indicates one time-point (week 10) in which the repertoire deviates from the mean. Dotted lines indicate values obtained with repeated polymerase chain reaction (PCR) amplifications for the same time-point sample. (b) VH gene family utilization over time, given in weeks (w) or years (yr).
Correlations of VH gene usage with serum immunoglobulin levels towards foreign antigens and autoantigens
Serum samples obtained during a 10-week period, at the same time-points as the PBL, were analysed for concentrations of antibodies against common foreign antigens and autoantibodies. The anti-PPS6 antibody levels correlated positively with antibodies against DNA (IgG) in individual H and negatively in individuals B (IgG and IgM) and L (IgG only). There was also a positive correlation between anti-PPS6 and TG antibodies in individuals A (P < 0·005) and H (P < 0·05). Individuals A and H showed positive correlations between HSV and TG antibodies (P < 0·05), while there was a negative correlation between HSV and TG (IgG and IgM) antibodies in individual C (P < 0·05). In Fig. 5 the kinetics of serum autoantibody levels are shown for the 10-week period in individual B. A negative correlation was demonstrated between serum rheumatoid factor (RF) antibodies and VH3 gene family usage (r = − 0·84, P = 0·002), as well as a positive correlation between serum levels of RF antibodies and VH5 gene family usage (r = 0·64, P = 0·047). Moreover, a negative correlation was found between antibodies against THR of IgG class and VH6 gene usage (r = − 0·76, P = 0·011) and between THR-IgG and VH1 gene family usage (r = − 0·68, P = 0·028). With three time-points available on VH gene family usage for the other four individuals, no general correlations between serum antibodies and VH gene usage were found.
Figure 5.
Serum antibody levels against common autoantigens as measured by enzyme-linked immunosorbent assay (ELISA) in one healthy individual (B) at 10 consecutive weeks. ♦, RF; ▪, anti-DNA antibodies; ▴, anti-thyroglobulin (TG); •, anti-thyroid hormone receptor (THR) (IgG), where filled symbols indicate IgM antibodies, and open symbols IgG antibodies. (The level of anti-TG IgG antibodies at week 1 is >40 OD units.)
Discussion
Several methods have been established to determine VH gene usage, from copy DNA libraries and in situ hybridization, to PCR-based methods. The method used in the present study, a quantitative PCR based on competition for reagents between two DNA target sequences, allows for a rapid and highly reproducible analysis of VH gene family usage in samples from several individuals at more than one time-point. Differences in amplification efficiency between a plasmid and a genomic target (as indicated in ref. 29) should be similar for the different VH gene families, and the method was therefore designed to be semiquantitative, comparing the relative frequencies of VH gene family utilization in a given sample. The magnitude of variation between the different assays correlated negatively to the level of utilization of the VH gene family, such that the CV was very large (up to 70%) for families that are utilized on a level close to the detection limit of the method (20–50 copies), such as VH2 and VH6. Therefore, the values should always be considered in relation to the utilization of the other VH families. This implies that a nested PCR approach is preferable for absolute quantification of single genomic targets present at very low levels. By using the nested approach, sensitivity can be increased to detection of 10 template copies,32 while reducing the variations to <20%.33 A deviating pattern of VH gene family utilization, which was observed in one single sample, could be demonstrated repeatedly in aliquots of the same sample using different sets of primers and correlated well with a published case report.27 This shows that the stable pattern we generally found was not introduced by the primers used for amplification, nor by any other part of the method, but rather indicates the genetic control of VH gene family utilization, as discussed below.
Recently, Khosaka and co-workers suggested a strict genetic control of the VH gene family repertoire in peripheral blood, based on their studies in monozygotic twins, concordant and discordant for rheumatoid arthritis (RA).34 The observed VH gene repertoire in our study is very similar to that reported by Kohsaka and co-workers for IgG expressing PBL (99% correlation), as well as to VH gene family usage in the available repertoire – i.e. the small resting lymphocytes – in PBL (93–98% correlation), as determined by in situ hybridization.18,35 Data from a more recent, larger study on healthy individuals, in which reverse transcription (RT)–PCR on µ-transcripts was used, showed 95% correlation with our results.36 Together, present and previously published data indicate a very strictly controlled VH gene repertoire in circulating small lymphocytes.
As one of the individuals (‘B’) showed a marked decrease in VH3 gene family usage in the sample from week 10 as compared to week 1 and 9 years, eight additional weekly samples (week 2 until week 9) were analysed for this individual. All these samples showed a ‘normal’ VH gene family utilization pattern, as described above. The VH gene utilization pattern observed in the week-10 sample appeared to be similar (67% correlation) to the pattern observed by Huang and co-workers in one of two samples (Am-1), taken at a 6-month interval from one individual.27,28 As mutational rates in the IgM cDNA of this sample were higher than observed in the sample showing a ‘normal’ VH gene expression pattern, the authors hypothesized that the skewing of the repertoire reflected a recent exposure to antigen.28 Interestingly, a fluctuation in the utilization of mainly the VH3 gene family – in connection with changes in the utilization of the VH1 and VH4 gene families – has been described during the early phase of human immunodeficiency virus (HIV) infection.36–38 In our sample the observed decrease in VH3 was associated with an increase in VH5 gene usage. This deviation in the pattern of VH gene family usage resembles not only the case study mentioned above, but also the VH gene family repertoire observed in actual repertoires in PBL (activated B cells and plasma cells),18,39,40 indicating a (transient) activation of peripheral B cells in the week-10 sample for individual B in this study and in sample Am-1 in the study of Huang and co-workers. The fact that deviations can occur in the repertoire of recirculating B cells is neither surprising nor new. However, the fact that the pattern of deviation is similar in two completely independent cases, using different methods, and moreover resembles the repertoire observed in activated peripheral B cells, may indicate a possible underlying genetic or cellular mechanism.
To further investigate antibody specificities in actual repertoires, serum samples taken at the same time-points as the PBL samples were analysed for concentrations of antibodies against common foreign antigens and autoantibodies. As the PCR method used distinguishes the antibodies based on a nucleotide sequence conserved within the VH families, it is expected to measure mainly framework contributions to antibody specificities. Fine-tuned antibody specificities, determined by the complementarity-determining region 3 (CDR3) regions of the heavy and the light chain will not be distinguished, with the possible exception of a massively expanded clone with a CDR3 region specific for the challenging antigen. Some common foreign and autoantigens, however, are known to be recognized by the framework region of antibodies, for example superantigens and RF. A significant, negative correlation was shown for individual B between RF in serum and VH3 gene family usage in the periphery, as well as a positive correlation between RF and VH5 gene usage. This is in agreement with the notion that most peripheral cells are newly generated and that activated cells disappear from the periphery to become antibody-producing cells. The VH gene families normally used in anti-immunoglobulin antibodies (RF) are mainly VH3, sporadically VH4 and VH1, but not VH5.41–45 After infection or vaccination, serum RF levels are shown to be transiently increased.46,47 Activation of RF-expressing B lymphocytes in the absence of T-cell help has been shown to lead to peripheral deletion of the RF-expressing clones within 2–3 days.48 General T-cell-independent activation can be caused by polyclonal activators. In mice, as well as in humans, staphylococcal protein A selectively stimulates B cells that express VH families belonging to the VHIII clan, to which the human VH3 gene is assigned.49,50 Together, existing data indicate that infection with a pathogen expressing a VH3 family-restricted polyclonal stimulator, might be able to cause the temporal skewing of the repertoire and the correlation with RF in serum.
In summary, we have found that the VH gene family repertoire is remarkably stable over time, as well as similar among individuals with a Caucasian background. We describe a ‘normal’ stable VH family repertoire, which is genetically controlled, only partly reflects genomic complexity of the VH gene families18,34 and is probably expressed by small resting B lymphocytes. In addition, we propose the existence of an ‘activated’ repertoire, characterized by a low VH3 and a high VH5 expression as compared to the normal VH gene repertoire. This form of repertoire skewing is present in naturally activated,18 as well as in transiently activated, peripheral B-lymphocyte repertoires (this study and refs 27 and 28).
Acknowledgments
We thank Sari Feld for excellent technical assistance and Dr Joakim Lundeberg for reagents and advice on the competitive PCR technique. This study was supported by grants from the Swedish Medical Research Council (K2000 06X-11599 05 A) and the Karolinska Institute.
Abbreviations
- CV
coefficient of variation
- FR
framework region
- PPS
pneumococcal polysaccharide
- RA
rheumatoid arthritis
- RF
rheumatoid factor
- THR
thyroid hormone receptor
- TG
thyroglobulin
- TT
tetanus toxoid
References
- 1.Yancopoulos GD, Alt FW. Regulation of the assembly and expression of variable-region genes. Annu Rev Immunol. 1986;4:339. doi: 10.1146/annurev.iy.04.040186.002011. [DOI] [PubMed] [Google Scholar]
- 2.Alt FW, Blackwell TK, Yancopoulos GD. Development of the primary antibody repertoire. Science. 1987;238:1079. doi: 10.1126/science.3317825. [DOI] [PubMed] [Google Scholar]
- 3.Grandien A, Modigliani Y, Freitas A, Andersson J, Coutinho A. Positive and negative selection of antibody repertoires during B-cell differentiation. Immunol Rev. 1994;137:53. doi: 10.1111/j.1600-065x.1994.tb00659.x. [DOI] [PubMed] [Google Scholar]
- 4.Tarlinton D. B-cell differentiation in the bone marrow and the periphery. Immunol Rev. 1994;137:203. doi: 10.1111/j.1600-065x.1994.tb00666.x. [DOI] [PubMed] [Google Scholar]
- 5.Nemazee D, Russell D, Arnold B, Haemmerling G, Allison J, Miller JF, Morahan G, Buerki K. Clonal deletion of autospecific B lymphocytes. Immunol Rev. 1991;122:117. doi: 10.1111/j.1600-065x.1991.tb00600.x. [DOI] [PubMed] [Google Scholar]
- 6.Cyster JG, Goodnow CC. Antigen-induced exclusion from follicles and anergy are separate and complementary processes that influence peripheral B cell fate. Immunity. 1995;3:691. doi: 10.1016/1074-7613(95)90059-4. [DOI] [PubMed] [Google Scholar]
- 7.McHeyzer-Williams MG. Immune response decisions at the single cell level. Semin Immunol. 1997;9:219. doi: 10.1006/smim.1997.0079. [DOI] [PubMed] [Google Scholar]
- 8.Healy JI, Goodnow CC. Positive versus negative signaling by lymphocyte antigen receptors. Annu Rev Immunol. 1998;16:645. doi: 10.1146/annurev.immunol.16.1.645. [DOI] [PubMed] [Google Scholar]
- 9.van Dijk-Hard I, Soderstrom I, Feld S, Holmberg D, Lundkvist I. Age-related impaired affinity maturation and differential D-JH gene usage in human VH6-expressing B lymphocytes from healthy individuals. Eur J Immunol. 1997;27:1381. doi: 10.1002/eji.1830270613. [DOI] [PubMed] [Google Scholar]
- 10.Mouthon L, Nobrega A, Nicolas N, Kaveri SV, Barreau C, Coutinho A, Kazatchkine MD. Invariance and restriction toward a limited set of self-antigens characterize neonatal IgM antibody repertoires and prevail in autoreactive repertoires of healthy adults. Proc Natl Acad Sci USA. 1995;92:3839. doi: 10.1073/pnas.92.9.3839. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Mouthon L, Haury M, Lacroix-Desmazes S, Barreau C, Coutinho A, Kazatchkine MD. Analysis of the normal human IgG antibody repertoire. Evidence that IgG autoantibodies of healthy adults recognize a limited and conserved set of protein antigens in homologous tissues. J Immunol. 1995;154:5769. [PubMed] [Google Scholar]
- 12.Mouthon L, Lacroix-Desmazes S, Nobrega A, Barreau C, Coutinho A, Kazatchkine MD. The self-reactive antibody repertoire of normal human serum IgM is acquired in early childhood and remains conserved throughout life. Scand J Immunol. 1996;44:243. doi: 10.1046/j.1365-3083.1996.d01-306.x. [DOI] [PubMed] [Google Scholar]
- 13.Lacroix-Desmazes S, Mouthon L, Kaveri SV, Kazatchkine MD, Weksler ME. Stability of natural self-reactive antibody repertoires during aging. J Clin Immunol. 1999;19:26. doi: 10.1023/a:1020510401233. [DOI] [PubMed] [Google Scholar]
- 14.Tomlinson IM, Walter G, Marks JS, Llewelyn MB, Winter F. The repertoire of human germline VH sequences reveals about fifty groups of VH Segments with different hypervariable loops. J Mol Biol. 1992;227:776. doi: 10.1016/0022-2836(92)90223-7. [DOI] [PubMed] [Google Scholar]
- 15.Berman JE, Mellis SJ, Pollock R, et al. Content and organization of the human Ig VH locus: definition of three new VH families and linkage to the Ig CH locus. EMBO J. 1988;7:727. doi: 10.1002/j.1460-2075.1988.tb02869.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Croce CM, Shander M, Martinis J, Cicurel L, D'Ancona GG, Dolby TW, Koprowski H. Chromosomal location of the genes for human immunoglobulin heavy chains. Proc Natl Acad Sci USA. 1979;76:3416. doi: 10.1073/pnas.76.7.3416. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Huang SC, Jiang R, Glas AM, Milner EC. Non-stochastic utilization of Ig V region genes in unselected human peripheral B cells. Mol Immunol. 1996;33:553. doi: 10.1016/0161-5890(95)00162-x. [DOI] [PubMed] [Google Scholar]
- 18.Davidkova G, Pettersson S, Holmberg D, Lundkvist I. Selective usage of VH genes in adult human B lymphocyte repertoires. Scand J Immunol. 1997;45:62. doi: 10.1046/j.1365-3083.1997.d01-376.x. [DOI] [PubMed] [Google Scholar]
- 19.Cuisinier AM, Fumoux F, Moinier D, et al. Rapid expansion of human immunoglobulin repertoire (VH, V kappa, V lambda) expressed in early fetal bone marrow. New Biologist. 1990;2:689. [PubMed] [Google Scholar]
- 20.Schroeder HW, Jr, Wang JY. Preferential utilization of conserved immunoglobulin heavy chain variable gene segments during human fetal life. Proc Natl Acad Sci USA. 1990;87:6146. doi: 10.1073/pnas.87.16.6146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Kipps TJ, Tomhave E, Pratt LF, Duffy S, Chen PP, Carson DA. Developmentally restricted immunoglobulin heavy chain variable region gene expressed at high frequency in chronic lymphocytic leukemia. Proc Natl Acad Sci USA. 1989;86:5913. doi: 10.1073/pnas.86.15.5913. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Casali P, Notkins AL. Probing the human B-cell repertoire with EBV. Polyreactive antibodies and CD5+ B lymphocytes. Annu Rev Immunol. 1989;7:513. doi: 10.1146/annurev.iy.07.040189.002501. [DOI] [PubMed] [Google Scholar]
- 23.Pascual V, Andris J, Capra JD. Heavy chain variable region gene utilization in human antibodies. Int Rev Immunol. 1990;5:231. doi: 10.3109/08830189009056731. [DOI] [PubMed] [Google Scholar]
- 24.Tonnelle C, Cuisinier AM, Gauthier L, Guelpa Fonlupt V, Milili M, Schiff C, Fougereau M. Fetal versus adult preB or B cells: the human VH repertoire. Ann NY Acad Sci. 1995;764:231. doi: 10.1111/j.1749-6632.1995.tb55833.x. [DOI] [PubMed] [Google Scholar]
- 25.Schroeder HW, Jr, Ippolito GC, Shiokawa S. Regulation of the antibody repertoire through control of HCDR3 diversity. Vaccine. 1998;16:1383. doi: 10.1016/s0264-410x(98)00096-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Raaphorst FM, Timmers E, Kenter MJ, van Tol MJ, Vossen JM, Schuurman RK. Restricted utilization of germ-line VH3 genes and short diverse third complementarity-determining regions (CDR3) in human fetal B lymphocyte immunoglobulin heavy chain rearrangement. Eur J Immunol. 1992;22:247. doi: 10.1002/eji.1830220136. [DOI] [PubMed] [Google Scholar]
- 27.Huang C, Stewart AK, Schwartz RS, Stollar BD. Immunoglobulin heavy chain gene expression in peripheral blood B lymphocytes. J Clin Invest. 1992;89:1331. doi: 10.1172/JCI115719. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Huang C, Stollar BD. A majority of Ig H chain cDNA of normal human adult blood lymphocytes resembles cDNA for fetal Ig and natural autoantibodies. J Immunol. 1993;151:5290. [PubMed] [Google Scholar]
- 29.Lundeberg J, Wahlberg J, Uhlen M. Rapid colorimetric quantification of PCR-amplified DNA. Biotechniques. 1991;10:68. [PubMed] [Google Scholar]
- 30.Wahlberg J, Lundeberg J, Hultman T, Uhlen M. General colorimetric method for DNA diagnostics allowing direct solid-phase genomic sequencing of the positive samples. Proc Natl Acad Sci USA. 1990;87:6569. doi: 10.1073/pnas.87.17.6569. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Siebert PD, Larrick JW. Competitive PCR. Nature. 1992;359:557. doi: 10.1038/359557a0. [DOI] [PubMed] [Google Scholar]
- 32.Lundeberg J, Wahlberg J, Holmberg M, Pettersson U, Uhlen M. Rapid colorimetric detection of in vitro amplified DNA sequences. DNA Cell Biol. 1990;9:287. doi: 10.1089/dna.1990.9.287. [DOI] [PubMed] [Google Scholar]
- 33.Yun Z, Lundeberg J, Johansson B, Hedrum A, Weiland O, Uhlen M, Sonnerborg A. Colorimetric detection of competitive PCR products for quantification of hepatitis C viremia. J Virol Methods. 1994;47:1. doi: 10.1016/0166-0934(94)90061-2. [DOI] [PubMed] [Google Scholar]
- 34.Kohsaka H, Carson DA, Rassenti LZ, Ollier WE, Chen PP, Kipps TJ, Miyasaka N. The human immunoglobulin V(H) gene repertoire is genetically controlled and unaltered by chronic autoimmune stimulation. J Clin Invest. 1996;98:2794. doi: 10.1172/JCI119106. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Zouali M, Theze J. Probing VH gene-family utilization in human peripheral B cells by in situ hybridization. J Immunol. 1991;146:2855. [PubMed] [Google Scholar]
- 36.Bessudo A, Rassenti L, Havlir D, Richman D, Feigal E, Kipps TJ. Aberrant and unstable expression of immunoglobulin genes in persons infected with human immunodeficiency virus. Blood. 1998;92:1317. [PubMed] [Google Scholar]
- 37.David D, Demaison C, Bani L, Zouali M, Theze J. Selective variations in vivo of VH3 and VH1 gene family expression in peripheral B cell IgM, IgD and IgG during HIV infection. Eur J Immunol. 1995;25:1524. doi: 10.1002/eji.1830250608. [DOI] [PubMed] [Google Scholar]
- 38.Berberian L, Valles-Ayoub Y, Sun N, Martinez-Maza O, Braun J. A VH clonal deficit in human immunodeficiency virus-positive individuals reflects a B-cell maturational arrest. Blood. 1991;78:175. [PubMed] [Google Scholar]
- 39.Hillorn V, Soderstrom I, Feld S, Cilio C, Forsgren S, Hagg E, Lundkvist I, Holmberg D. Aberrant V (H) gene utilization in patients with established insulin dependent diabetes mellitus. J Autoimmun. 1997;10:157. doi: 10.1006/jaut.1996.0117. [DOI] [PubMed] [Google Scholar]
- 40.van Dijk-Hard I, Feld S, Holmberg D, Lundkvist I. Increased utilization of the VH6 gene family in patients with autoimmune idiopathic thrombocytopenic purpura. J Autoimmun. 1999;12:57. doi: 10.1006/jaut.1998.0257. [DOI] [PubMed] [Google Scholar]
- 41.Krenn V, Konig A, Hensel F, et al. Molecular analysis of rheumatoid factor (RF)-negative B cell hybridomas from rheumatoid synovial tissue: evidence for an antigen-induced stimulation with selection of high mutated IgVH and low mutated IgVL/lambda genes. Clin Exp Immunol. 1999;115:168. doi: 10.1046/j.1365-2249.1999.00767.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Melero J, Aguilera I, Mageed RA, Jefferis R, Tarrago D, Nunez-Roldan A, Sanchez B. The frequent expansion of a subpopulation of B cells that express RF-associated cross-reactive idiotypes: evidence from analysis of a panel autoreactive monoclonal antibodies. Scand J Immunol. 1998;48:152. doi: 10.1046/j.1365-3083.1998.00373.x. [DOI] [PubMed] [Google Scholar]
- 43.Borretzen M, Natvig JB, Thompson KM. Heterogeneous RF structures between and within healthy individuals are not related to HLA DRB1*0401. Mol Immunol. 1997;34:929. doi: 10.1016/s0161-5890(97)00087-4. [DOI] [PubMed] [Google Scholar]
- 44.Ermel RW, Kenny TP, Wong A, Chen PP, Malyj W, Robbins DL. Analysis of the molecular basis of synovial rheumatoid factors in rheumatoid arthritis. Clin Immunol Immunopathol. 1997;84:307. doi: 10.1006/clin.1997.4399. [DOI] [PubMed] [Google Scholar]
- 45.Borretzen M, Chapman C, Natvig JB, Thompson KM. Differences in mutational patterns between rheumatoid factors in health and disease are related to variable heavy chain family and germ-line gene usage. Eur J Immunol. 1997;27:735. doi: 10.1002/eji.1830270323. [DOI] [PubMed] [Google Scholar]
- 46.Welch MJ, Fong S, Vaughan J, Carson D. Increased frequency of rheumatoid factor precursor B lymphocytes after immunization of normal adults with tetanus toxoid. Clin Exp Immunol. 1983;51:299. [PMC free article] [PubMed] [Google Scholar]
- 47.Carson DA, Bayer AS, Eisenberg RA, Lawrance S, Theofilopoulos A. IgG rheumatoid factor in subacute bacterial endocarditis: relationship to IgM rheumatoid factor and circulating immune complexes. Clin Exp Immunol. 1978;31:100. [PMC free article] [PubMed] [Google Scholar]
- 48.Tighe H, Warnatz K, Brinson D, Corr M, Weigle WO, Baird SM, Carson DA. Peripheral deletion of rheumatoid factor B cells after abortive activation by IgG. Proc Natl Acad Sci USA. 1997;94:646. doi: 10.1073/pnas.94.2.646. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Silverman GJ. B cell superantigens: possible roles in immunodeficiency and autoimmunity. Semin Immunol. 1998;10:43. doi: 10.1006/smim.1997.0104. [DOI] [PubMed] [Google Scholar]
- 50.Zhang M, Majid A, Bardwell P, Vee C, Davidson A. Rheumatoid factor specificity of a VH3-encoded antibody is dependent on the heavy chain CDR3 region and is independent of protein A binding. J Immunol. 1998;161:2284. [PubMed] [Google Scholar]
- 51.Kabat EA, Wu TT, Perry HM, Gottesman DS, Foeller C. Bethseda, MD: NIH; 1991. Sequences of Proteins of Immunological Interest; pp. 91–3242. [Google Scholar]
- 52.Lundeberg J. Royal Institute of Technology, Stockholm, Sweden: Department of Biochemistry and Biotechnology; 1993. DIANA, a DNA-Diagnostic Method for Detection and Analysis of Viruses, Bacteria and Parasites. [Google Scholar]





