Skip to main content
Immunology logoLink to Immunology
. 2003 Nov;110(3):341–347. doi: 10.1046/j.1365-2567.2003.01739.x

Toll-like receptor-9 induced by physical trauma mediates release of cytokines following exposure to CpG motif in mouse skin

Ling Liu *, Xiaohui Zhou *, Jianying Shi †, Xin Xie *, Zhenghong Yuan *
PMCID: PMC1783050  PMID: 14632662

Abstract

The skin plays a crucial role in defence against microbial infection via the innate immune system, but the exact cellular mechanisms of this defence are not well understood. Toll-like receptors (TLRs), a newly recognized 10-member family of vertebrate pattern recognition receptors (PRRs), have been identified as crucial mediators of innate immune recognition. Although both TLR2 and TLR4 have been detected in normal human skin, little is known about the expression and function of TLR9, a CpG motif receptor, in skin. In this study, reverse transcription–polymerase chain reaction and in situ hybridization analysis were used to identify TLR9 mRNA expression in mouse skin. Results showed that TLR9 mRNA was not detected in normal mouse skin, but its presence in skin could be induced by intradermal injection of either normal saline, or the bacteria-based CpG motif in a time- and volume-dependent manner. Furthermore, intradermal injection of CpG motif induced increased expression of mRNAs for proinflammatory cytokines such as interleukin (IL)-1, IL-6, IL-12 and tumour necrosis factor α. This suggests that TLR9, while not present basally in skin, can be induced by physical trauma and then mediate responses to CpG motif. In conclusion, TLR9 is involved in the innate immune response in skin and that it may have a role in secondary inflammation following physical trauma such as epidermal damage or microbial infection. This role of TLR9 may help explain the previously identified enhancement of DNA immunization by CpG ODN.

Introduction

As the first line of the innate immune system, skin plays an active role in defence against microbial infection. It not only provides a physical barrier against microbial pathogens, but also secretes cytokines, chemokines and antimicrobial peptides to mediate innate and acquired immune responses.1,2

Innate immune cells such as antigen-processing cells (APCs) possess germline-encoded pattern recognition receptors (PRRs) that are activated by recognition of pathogen-associated molecular patterns (PAMPs).3,4 The Toll-like receptors (TLRs) represent a newly recognized 10-member family of vertebrate PRRs that have been identified as crucial mediators of innate immune recognition.5–7 Among them, TLR4 has been identified as the receptor for lipopolysaccharide (LPS)8,9 and TLR2 appears to mediate responses to lipoproteins10,11 and peptidoglycans from Gram-positive bacteria and mycobacteria.12,13 TLR9 is specific for unmethylated CpG oligodeoxynucleotides (CpG motifs) that are present in bacterial DNA.14,15 Previous studies have shown that both bacterial CpG motifs and synthetic oligodeoxynucleotides (ODNs) act as PAMPs to activate TLR9-positive cells, which then rapidly activate murine B cells, macrophages and dendritic cells (DCs) through the Toll/interleukin (IL)-1-receptor signalling pathway. This subsequently leads to the secretion of large amounts of proinflammatory cytokines such as IL-1, IL-6, tumour necrosis factor-α (TNF-α) and IL-12, a T helper type 1 (Th-1)-polarizing cytokine, and up-regulation of costimulatory molecules.16–18 Thus, interactions between CpG DNA and TLR9 effectively bridge innate and acquired immunities.19–21 As a vaccine adjuvant, CpG DNA is at least as effective as the gold standard complete Freund's adjuvant (CFA), but with higher Th1 activity and lower toxicity.

Recent researches have shown that in normal human skin, epidermal keratinocytes express both TLR2 and TLR4, and play active role in antimicrobial infection;22,23 however, much less is known about the expression and function of TLR9 in skin. In this study, semiquantitative reverse transcriptase–polymerase chain reaction (RT–PCR) analysis and in situ hybridization was used to investigate expression of TLR9 mRNA in normal mouse skin, and to examine whether intradermal injection of CpG ODN or CpG motif-containing plasmids could induce TLR9 expression and/or expression of proinflammatory cytokines. Although there was no TLR9 mRNA expression detected in normal mouse skin, similar induction was observed 6–9 hr after intradermal injection of normal saline (NS), CpG ODN and CpG motif-containing plasmids in a volume-dependent manner. Furthermore, both CpG ODN and CpG motif-containing plasmids significantly promoted the expression of proinflammatory cytokine mRNAs such as IL-1, IL-6, IL-12 and TNF-α. These results suggest that TLR9 expression in skin may be involved in inflammation occurring secondary to physical trauma such as epidermal damage or microbial infection, and may explain CpG ODN enhancement of DNA immunization.

Materials and methods

Animals

Female BALB/c mice were purchased from BK Co. (Shanghai, China) and housed in the Shanghai Medical Center of Fudan University with free access to food and water. All animal experiments were carried out in accordance with the National Institute of Health guide for the care and use of laboratory animals.

Plasmids and reagents

Sodium Chloride injection (normal saline; NS) was purchased from Chanzheng Fumin Co., Ltd (Shanghai, China). The plasmid pYQF-2CpG/s was cloned using standard methods and contains the pcDNA3·1 CMV promoter, the BGH poly A and the kanamycin resistance gene from pVR1012. In addition, it contains CpG motifs (AACGTT) at the SacII and SphI sites, and the HBV surface protein encoding gene in the multiple-cloning site. DNA plasmids were extracted from transformed Escherichia coli by alkaline sodium dodecyl sulphate (SDS) lysis and were column purified (Qiagen Plasmid Maxi Kit) using the standard protocol. The plasmids were then dissolved in NS and stored at −20°. The phosphorothioate-modified CpG oligonucleotide (CpG ODN) 1668 (5′ TCCATGACGTTCCTGATGCT 3′), which contains an immunostimulatory sequence and phosphorothioate-modified GpC ODN 1668gc (5′ TCCATGAGCTTCCTGATGCT 3′) as negative control ODN were synthesized by SBS Gentech Co., LTD (Shanghai, China) and dissolved in NS.

Animal treatment protocol

For the study of TLR9 mRNA distribution, untreated mice were killed. Ears, gastrocnemius and spleens were removed for RNA isolation and RT–PCR assay. To determine the effect of CpG ODN or pYQF-2CpG/s on TLR9 mRNA expression, mice were anaesthetized and their ears were intradermally injected with 25 µg pYQF-2CpG/s, CpG ODN or GpC ODN in a volume of 20 µl. Controls included injection of 0, 5, 10, 15 and 20 µl NS as well as examination of untreated mice. At 3, 6, 9, 12 and 24 hr after injection, mice were killed and ears were removed for RNA isolation.

Qualitative and semiquantitative RT–PCR analysis of TLR9 expression

Total RNA from skin, muscle and spleen were extracted with TRIzol reagent (Gibco BRL, Carlsbad, CA) following the manufacturer's instructions. Reverse transcription (RT) was performed with random hexamers (Promega, Madison, WI) for priming and 200 U of SuperScriptTMII (Gibco). The desired cDNA fragment was amplified in a final volume of 30 µl containing 2·5 mm MgCl2, 1 U Taq polymerase (TakaRa), and 1 µm of each primer. Amplification consisted of an initial denaturation step of 94° for 3 min, followed by 35 cycles of 94° for 1 min, 55–60° for 1 min, 72° for 1 min and a final elongation step of 72° for 7 min (GeneAmp PCR system 9700, Perkin-Elmer). The oligonucleotide primers used for PCR were as follows: TLR9, 5′-CCGCAAGACTCTATTTGTGCTGG (sense) and 5′-TGTCCCTAGTCAGGGCTGTACTCAG (antisense), IL-1β, 5′-GAGCTTCAGGCAGGCAGTATC (sense) and 5′-GTATAGATTCTTTCCTTTGAGGC (antisense), IL-6, 5′-TGAGAAAAGAGTTGTGCAATGGC (sense) and 5′-GAATGTCCACAAACTGATATGCTT (antisense), IL-12p40, 5′-TGCTGGTGTCTCCACTCATGGC (sense) and 5′-TTTCAGTGGACCAAATTCCATT (antisense), TNF-α, 5′-TCCCCAAAGGGATGAGAAGTTC (sense) and 5′-TCATACCAGGGTTTGAGCTCAG (antisense), and hypoxanthineguanine phosphoribosyl transferase (HPRT), 5′-GTTGGATACAGGCCAGACTTTGTTG (sense) and 5′-GATTCAACTTGCGCTCATCTTAGGC (antisense). All PCR products were separated on 1·5% agarose gel, visualized with ethidium bromide and imaged on a Gel Image Freezer System (Kodak EDAS 290; Kodak, Rochester, NY). RT–PCR fragments were purified and sequenced to confirm the identity of the DNA bands. To semiquantitatively analyse TLR9 and cytokine mRNA levels, the band area for individual RT–PCR products was measured using the molecular analysis software in the Gel Image Freezer System. The relative mRNA amounts were estimated as the ratio of the area of the experimental band to the area of the HPRT band.

Digoxigenin (Dig)-labelled oligonucleotide probes

An oligonucleotide probe (gacgctggcgcagtcgcacatagcgggagcggtgggcatccggac) antisense to mouse TLR9 mRNA was synthesized and Dig-UTP labelled at the 3′-terminal (Boehringer Mannheim, Mannheim, Germany). An oligonucleotide probe (gtccggatgcccaccgctcccgctatgtgcgact gcgccagcgtc) sense to mouse TLR9 mRNA was labelled as above for negative control purposes.

In situ hybridization and haematoxylin and eosin staining

Slices (10 µm) from ears injected with 20 µl NS for 6 hr or untreated were fixed in a 4% phosphate-buffered saline (PBS)-buffered paraformaldehyde solution for 30 min, permeated in 0·3% Triton-X-100 in PBS, postfixed in a 4% PBS-buffered paraformaldehyde solution, and digested with 2 µg/ml proteinase K for 30 min at 37°. Following prehybridization for 30 min at room temperature in 4× SSC (sodium saline citrate; 0·15 m NaCl, 0·015 m sodium citrate, pH 7·4) containing 50% formamide, hybridization was performed at 37° for 16 hr in hybridization solution containing 10 mm Tris–HCl, pH 7·4, 50% formamide, 4× SSC, 10% dextran sulfate, 125 µg/ml salmon sperm DNA, 250 µg/ml yeast tRNA, 0·02% SDS, and 100 nm Dig-labelled oligonucleotide probe. Following hybridization, the slices were incubated with anti-Dig (Fab), conjugated with alkaline phosphatase (Boehringer Mannheim) and developed at 25° in a p-nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyphosphate-containing buffer (Boehringer Mannheim) for 16–20 hr. The Leica Q500 IW image processing system was used to capture the hybridization images. Slices (4 µm) from ears of 20 µl NS-treated for 6 hr or untreated were stained with haematoxylin and eosin (H&E). Photos were taken under 50 and 200× magnifications.

Statistical analysis

All quantitative data were presented as mean ± standard error of three independent experiments. Statistical significance was assessed using an unpaired Student's t-test.

Results

Distribution of TLR9 mRNA

RT–PCR was used to ascertain whether TLR9 mRNA is distributed in normal skin and other tissues. Figure 1 depicts the PCR products corresponding to TLR9 expression as compared to that of the internal control, HPRT. Expression of TLR9 mRNA was not detected in normal skin and muscle, but relatively strong expression was detected in normal spleen.

Figure 1.

Figure 1

Distribution of TLR9 mRNA. Total RNA from skin, muscle and spleen was extracted and TLR9 mRNA expression was analyzed by RT–PCR. In normal skin, TLR9 mRNA was not detected in skin and muscle, but was strongly detected in spleen.

Changes of TLR9 mRNA expression after intradermal injection

To determine whether inflammatory processes such as bacterial infection could induce TLR9 gene expression in normal skin, we used semiquantitative RT–PCR to investigate TLR9 mRNA levels in skin following intradermal injection of CpG ODN or CpG motif-containing plasmids resolved in NS, which mimicked inflammation after bacterial infection. TLR9 mRNA was detected 6 (Fig. 2) and 9 hr (data not shown) after injection of 20 µl pYQF-2CpG/s and CpG ODN. Unexpectedly, skin that received 20 µl NS injection expressed TLR9 mRNA at levels comparable to those of the CpG ODN and plasmid groups. These results suggest that CpG motif can not specifically induce the expression of TLR9 mRNA in skin. It is possible that the physical trauma caused by the volume of injection takes part in this reaction.

Figure 2.

Figure 2

Changes of TLR9 mRNA expression after intradermal injection. Mouse ears were intradermally injected with 20 µl NS, plasmid pYQF-2CpG/s, CpG ODN or left untreated as control. Six hr later, total RNA was prepared and TLR9 gene expression was examined by semiquantitative RT–PCR. TLR9 mRNA signal was expressed as the ratio of TLR9 and HPRT band areas. Results are presented as mean ± standard error of three independent experiments.

Time- and volume-dependent expression of TLR9 mRNA in skin

To address whether TLR9 mRNA induction in skin is time and volume dependent, we examined TLR9 mRNA expression following intradermal NS injections that varied by duration and volume (Fig. 3). TLR9 mRNA expression was observed at 6 and 9 hr and disappeared at 12 hr after intradermal injection of 20 µl NS (Fig. 3a). Furthermore, TLR9 mRNA was detected after treatment for 6 hr with 15 µl or 20 µl NS, but not after treatment with 0, 5 or 10 µl NS. The minimal volume that could induce TLR9 mRNA expression was 15 µl (Fig. 3b). When the volume was increased to 20 µl, the TLR9 mRNA level increased correspondingly (Fig. 3c). Detection of TLR9 mRNA expression after varied intradermal injections of CpG ODN and pYQF-2CpG/s yielded similar results (data not shown).

Figure 3.

Figure 3

Changes of TLR9 mRNA expression following variation of injection volume and duration. Ears were intradermally injected with 20 µl NS at different time points or with different amount of NS for 6 or 9 hr. (a) TLR9 mRNA was detected at 6 and 9 hr, but not at 12 hr after intradermal injection of 20 µl NS. (b) TLR9 mRNA was detected after treatment for 6 hr with 15 µl or 20 µl NS, but not after treatment with 0, 5 or 10 µl NS. (c) Represents the statistical results of TLR9 mRNA expression after intradermal injection of 15 µl or 20 µl NS for 6 and 9 hr. The data are presented as mean ± standard error of three independent experiments. *P < 0·05, as compared to the data of 15 µl injection.

Detection of TLR9 transcripts in skin by in situ hybridization

To complement the RT–PCR-based mRNA expression profiles, we further detected TLR9 transcripts in skin by in situ hybridization. Digoxigenin-labelled sense and antisense probes of mouse TLR9 mRNA were hybridized to slides of 20 µl NS-treated or untreated ears and detected using an antidigoxigenin antibody. As shown in Fig. 4(a), the antisense probe hybridized within clusters of cells (arrows) immediately adjacent to the epithelial cells in treated (Fig. 4a, ii), but not untreated (Fig. 4a, i) ears. The negative control sense probe yielded no hybridization signals (Fig. 4a, iii, iv). To characterize these TLR9 mRNA positive cells induced by physical trauma, mice ear slices were further stained with H&E. We found that considerable inflammatory cells including PBMCs infiltrated after intradermal injection of NS for 6 hr (Fig. 4b, iii, iv). No inflammatory cells were detected in ears untreated (Fig. 4b, i, ii). Several types of PBMCs, including murine B cells, macrophages and dendritic cells (DCs), express TLR9.17,24,25 We speculate that TLR9 positive cells induced by physical trauma may come from peripheral blood.

Figure 4.

Figure 4

Figure 4

In situ hybridization of TLR9 mRNA. (a) TLR9 sense (iii, iv) or antisense (i, ii) digoxigenin-labelled probes were hybridized to ear sections from mice treated with 20 µl NS for 6 hr (ii, iv) or untreated (i, iii), and detected using an antidigoxigenin antibody. The antisense probe hybridized within a cluster of cells (arrows) immediately adjacent to the epithelial cells in 20 µl NS-treated (ii), but not untreated (i) ears. The sense probe showed no hybridization (iii, iv). SBG, sebaceous glands; CA, cartilage. (magnification was 25×). (b) Mice ear sections were prepared as above and were stained with H&E. Representative results from untreated groups (i, ii) and from NS-treated groups (iii, iv). Arrowheads: a cluster of inflammatory cells including neutrophils and moncytes/macrophages. Magnifications were 50× (i, iii) and 200× (ii, iv).

Intradermal injection of CpG motif induces proinflammatory cytokine mRNAs

Previous studies have shown that bacterial CpG motifs act as PAMPs to activate TLR9-positive cells, leading to the secretion of large amounts of the proinflammatory cytokines, IL-1, IL-6, IL-12 and TNF-α.16–18 To address whether transiently expressed TLR9-positive cells induced by physical trauma could then mediate responses to CpG motif, and induce expression and release of proinflammatory cytokines in skin, mouse ears were intradermally injected with 20 µl NS, GpC ODN, CpG ODN or plasmid pYQF-2CpG/s, and expression of cytokines was determined. As shown in Fig. 5, there was little cytokine induction in the first 3 hr postinjection. At 6 and 9 hr after injection, IL-1β, IL-6 and TNF-α mRNAs were obviously induced in ears treated with CpG ODN and the CpG motif-containing plasmid (P < 0·05) compared with NS-treated and GpC ODN-treated ears. Twenty-four hr later, IL-1β, IL-6 and TNF-α mRNAs were decreased but still remained at a mild level in four groups. Unlike other cytokines, IL-12p40 mRNA was transiently detected in all four groups within 24 hr postinjection, and was significantly higher in the CpG ODN and plasmid groups compared with the NS and GpC group at 6–12 hr after injection (P < 0·05).

Figure 5.

Figure 5

Intradermal injection of CpG motif enhances proinflammatory cytokine mRNA expression. Mice ears were intradermally injected with 20 µl NS, GpC ODN, CpG ODN or CpG motif-containing plasmids and tested after the indicated time period. Cytokine expression was analyzed by semiquantitative PT-PCR; the mRNA signal for each cytokine was expressed as the ratio of cytokine and HPRT band areas. Results are presented as mean ± standard error of three independent experiments.

Discussion

Our finding that TLR9 mRNA was not detected in normal mouse skin is consistent with a similar finding in human skin.26 However, the results that skin expression of TLR9 mRNA could be induced by intradermal injection of either normal saline (NS), or the bacteria-based CpG motif in a time- and volume-dependent manner, was out of our expectation. These data indicate that certain volume of injection lead to physical trauma rather than CpG motif that plays a role in the induction of TLR9 in skin. This TLR9 mRNA could come from two possible sources: activation of TLR9 expression in epidermal keratinocytes, or recruitment of TLR9 mRNA-positive cells from PBMCs. Following the exposure of normal human keratinocytes to ODN, several genes of the acute phase proteins were induced, but the transcription of TLR9 remained unchanged.1 The time- and volume-dependence of TLR9 induction by physical trauma may support the latter hypothesis, as does the observation that several types of PBMCs, including murine B cells, macrophages and dendritic cells (DCs), express TLR9.17,24,25 Intradermal injection of increased volumes created increased physical trauma, which might promote inflammatory cytokine or chemokine reactions, subsequently recruiting TLR9-positive PBMC cells. It is possible that these TLR9-positive PBMCs are recruited from peripheral blood together with TLR2- and TLR4-positive keratinocytes22,23 to play important roles in the skin immune defence system.

It has been shown that TLR9-positive cells can recognize and be activated by the CpG motif, leading to secretion of the Th1-type proinflammatory cytokines IL-1, IL-6, IL-12 and TNF-α.16–18 In accordance with the transient expression of TLR9 mRNA, the expression of IL-1, IL-6, IL-12 and TNF-α mRNA was markedly enhanced 6–9 hr after intradermal injection of 20 µl CpG motif, as compared to little or no cytokine induction in the NS and GpC group. This suggests that local inflammation results in transient recruitment of TLR9-positive cells and subsequent TLR9 activation by the CpG motif, leading to the release of Th1-type cytokines in mouse skin. This may provide an important mechanism for defence against bacterial infection.

IL-12 is a powerful signal for the generation of Th1 responses.27 It has been shown that APCs expressing endogenous TLR9 synergistically stimulated with CpG ODN and CD40L are capable to induce large amounts of IL-12 and drive naive T cells toward Th1 in an IL-12-dependent manner.21,28 Here, IL-12 mRNA expression showed kinetics different from those of IL-1, IL-6 and TNF-α. IL-12p40 mRNA transiently increased in all four groups, though less so in the NS and GpC groups, and declined to undetectable levels within 24 hr. As intradermal injection of CpG ODN can trigger the Th1 immune response29,30 it is possible that even without CD40L costimulation, CpG ODN may be capable of stimulating TLR9-positive cells to transiently express mild amounts of IL-12 in skin. The local activation of TLR9 positive cells to produce IL-12 may change the condition of skin and contribute to the Th1 cell-mediated immune response. In general, it is possible that all of the above results will have a broad, clinical application.

DNA vaccines are an attractive approach to eliciting both humoral and T-cell based responses for protection against viral, bacterial and parasitic infections.31 Gene gun application of DNA vaccines typically induces a Th2-type reaction, whereas needle inoculations, including intradermal and intramuscular injections, usually trigger a Th1-type response.32,33 As Th1 immunity characterized by strong CMI (cell-mediated immune) and moderate humoral immunity plays a vital role in host defence against viral and intracellular bacterial infections as well as tumours, various strategies including using CpG motifs have been undertaken in gene gun application to overcome this bias. The effect of CpG ODN on modulation of gene-gun induced immune responses is debatable, but there does not seem to be a simple relationship between CpG motifs and the Th1-type of the induced immune response. While Hochreiter et al. found that intradermal injection of 50 µg of CpG 3 or 9 days before gene gun immunization didn't significantly change the Th2-type response,34 Schirmbeck et al. reported that 2 hr after plasmid DNA bombardment, intradermal injection of 50 µg of CpG ODN at the same site shifted HBsAg immunity from Th2 to Th1.35 Our results may help explain this difference. Several days after intradermal injection of 50 µg CpG, TLR9-positive cells have migrated away from the injection site, and thus are unavailable for CpG motif recognition. However, when the treatments are fairly concurrent, the TLR9-positive cells recruited by intradermal injection of CpG motifs are available at the site of gene gun immunization. There, they may interact with the CpG ODN to release Th1-polarizing cytokines, which may help to shift gene gun immunization to a Th1 response. Taken together, we suggest that conditioning the skin at the site of DNA inoculation within a short time window (6–9 hr) before or after gene gun immunization may modulate the polarization of the elicited response.

In conclusion, TLR9, while not present basally in skin is induced by physical trauma and could mediate release of cytokines following exposure to CpG motif. This work may help clarify the mechanisms of defence against bacterial infection in skin and may explain the enhancement of CpG ODN on gene-gun mediated immunization. Further work is clearly required to determine the cell types of these TLR9 positive cells and delineate the effect of these released cytokines on the development of immune responses.

Acknowledgments

We thank Prof. Lan Ma, Prof. Jinsheng Zhang and Yan Jiang for helpful discussion and technical help. This work was supported by the State Key Basic Research Program (Grant No: G1999054105) and High Technology Project (Grant No:2001AA215011) from the Ministry of Science and Technology of China.

Abbreviations

TLR

Toll-like receptor

ODN

oligodeoxynucleotide

DC

dendritic cell

PRR

pattern recognition receptor

PAMP

pathogen-associated molecular pattern

APC

antigen-processing cell

PBMC

peripheral blood mononuclear cell.

References

  • 1.Mirmohammadsadegh A, Maschke J, Basner-Tschakarjan E, Bar A, Hengge UR. Induction of acute phase response genes in keratinocytes following exposure to oligodeoxynucleotides. J Mol Med. 2002;80:377–83. doi: 10.1007/s00109-002-0329-3. [DOI] [PubMed] [Google Scholar]
  • 2.Ali RS, Falconer A, Ikram M, Bissett CE, Cerio R, Quinn AG. Expression of the peptide antibiotics human beta defensin-1 and human beta defensin-2 in normal human skin. J Invest Dermatol. 2001;117:106–11. doi: 10.1046/j.0022-202x.2001.01401.x. [DOI] [PubMed] [Google Scholar]
  • 3.Medzhitov R, Janeway CA., Jr Innate immunity: impact on the adaptive immune response. Curr Opin Immunol. 1997;9:4–9. doi: 10.1016/s0952-7915(97)80152-5. [DOI] [PubMed] [Google Scholar]
  • 4.Medzhitov R, Janeway CA., Jr Innate immunity: the virtues of a nonclonal system of recognition. Cell. 1997;91:295–8. doi: 10.1016/s0092-8674(00)80412-2. [DOI] [PubMed] [Google Scholar]
  • 5.Du X, Poltorak A, Wei Y, Beutler B. Three novel mammalian toll-like receptors. gene structure, expression, and evolution. Eur Cytokine Netw. 2000;11:362–71. [PubMed] [Google Scholar]
  • 6.Chuang T, Ulevitch RJ. Cloning and characterization of sub-family of human toll-like receptors: hTLR7, hTLR8 and hTLR9. Eur Cytokine Netw. 2000;11:372–8. [PubMed] [Google Scholar]
  • 7.Hemmi H, Kaisho T, Takeuchi O, et al. Small anti-viral compounds activate immune cells via the TLR7 MyD88-dependent signaling pathway. Nat Immunol. 2002;3:196–200. doi: 10.1038/ni758. [DOI] [PubMed] [Google Scholar]
  • 8.Chow JC, Young DW, Golenbock DT, Christ WJ, Gusovsky F. Toll-like receptor-4 mediates lipopolysaccharide-induced signal transduction. J Biol Chem. 1999;274:10689–92. doi: 10.1074/jbc.274.16.10689. [DOI] [PubMed] [Google Scholar]
  • 9.Hoshino K, Takeuchi O, Kawai T, Sanjo H, Ogawa T, Takeda Y, Takeda K, Akira S. Toll-like receptor 4 (TLR4) -deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the LPS gene product. J Immunol. 1999;162:3749–52. [PubMed] [Google Scholar]
  • 10.Aliprantis AO, Yang RB, Mark MR, et al. Cell activation and apoptosis by bacterial lipoproteins through toll-like receptor-2. Science. 1999;285:736–9. doi: 10.1126/science.285.5428.736. [DOI] [PubMed] [Google Scholar]
  • 11.Brightbill HD, Libraty DH, Krutzik SR, et al. Host defense mechanisms triggered by microbial lipoproteins through toll-like receptors. Science. 1999;285:732–6. doi: 10.1126/science.285.5428.732. [DOI] [PubMed] [Google Scholar]
  • 12.Takeuchi O, Hoshino K, Kawai T, Sanjo H, Takada H, Ogawa T, Takeda K, Akira S. Differential roles of TLR2 and TLR4 in recognition of gram-negative and gram-positive bacterial cell wall components. Immunity. 1999;11:443–51. doi: 10.1016/s1074-7613(00)80119-3. [DOI] [PubMed] [Google Scholar]
  • 13.Underhill DM, Ozinsky A, Smith KD, Aderem A. Toll-like receptor-2 mediates mycobacteria-induced proinflammatory signaling in macrophages. Proc Natl Acad Sci U S A. 1999;96:14459–63. doi: 10.1073/pnas.96.25.14459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Krieg AM, Hartmann G, Yi AK. Mechanism of action of CpG DNA. Curr Top Microbiol Immunol. 2000;247:1–21. doi: 10.1007/978-3-642-59672-8_1. [DOI] [PubMed] [Google Scholar]
  • 15.Hemmi H, Takeuchi O, Kawai T, et al. A Toll-like receptor recognizes bacterial DNA. Nature. 2000;408:740–5. doi: 10.1038/35047123. [DOI] [PubMed] [Google Scholar]
  • 16.Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, Koretzky GA, Klinman DM. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature. 1995;374:546–9. doi: 10.1038/374546a0. [DOI] [PubMed] [Google Scholar]
  • 17.Stacey KJ, Sweet MJ, Hume DA. Macrophages ingest and are activated by bacterial DNA. J Immunol. 1996;157:2116–22. [PubMed] [Google Scholar]
  • 18.Sparwasser T, Koch ES, Vabulas RM, Heeg K, Lipford GB, Ellwart JW, Wagner H. Bacterial DNA and immunostimulatory CpG oligonucleotides trigger maturation and activation of murine dendritic cells. Eur J Immunol. 1998;28:2045–54. doi: 10.1002/(SICI)1521-4141(199806)28:06<2045::AID-IMMU2045>3.0.CO;2-8. [DOI] [PubMed] [Google Scholar]
  • 19.Krug A, Towarowski A, Britsch S, et al. Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12. Eur J Immunol. 2001;31:3026–37. doi: 10.1002/1521-4141(2001010)31:10<3026::aid-immu3026>3.0.co;2-h. [DOI] [PubMed] [Google Scholar]
  • 20.Means TK, Golenbock DT, Fenton MJ. The biology of Toll-like receptors. Cytokine Growth Factor Rev. 2000;11:219–32. doi: 10.1016/s1359-6101(00)00006-x. [DOI] [PubMed] [Google Scholar]
  • 21.Wagner H. Interactions between bacterial CpG-DNA and TLR9 bridge innate and adaptive immunity. Curr Opin Microbiol. 2002;5:62–9. doi: 10.1016/s1369-5274(02)00287-4. [DOI] [PubMed] [Google Scholar]
  • 22.Kawai K, Shimura H, Minagawa M, Ito A, Tomiyama K, Ito M. Expression of functional Toll-like receptor 2 on human epidermal keratinocytes. J Dermatol Sci. 2002;30:185–94. doi: 10.1016/s0923-1811(02)00105-6. [DOI] [PubMed] [Google Scholar]
  • 23.Song PI, Park YM, Abraham T, Harten B, Zivony A, Neparidze N, Armstrong CA, Ansel JC. Human keratinocytes express functional CD14 and toll-like receptor 4. J Invest Dermatol. 2002;119:424–32. doi: 10.1046/j.1523-1747.2002.01847.x. [DOI] [PubMed] [Google Scholar]
  • 24.An H, Yu Y, Zhang M, et al. Involvement of ERK, p38 and NF-kappaB signal transduction in regulation of TLR2, TLR4 and TLR9 gene expression induced by lipopolysaccharide in mouse dendritic cells. Immunology. 2002;106:38–45. doi: 10.1046/j.1365-2567.2002.01401.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Renshaw M, Rockwell J, Engleman C, Gewirtz A, Katz J, Sambhara S. Cutting edge. impaired Toll-like receptor expression and function in aging. J Immunol. 2002;169:4697–701. doi: 10.4049/jimmunol.169.9.4697. [DOI] [PubMed] [Google Scholar]
  • 26.Curry JL, Qin JZ, Bonish B, Carrick R, Bacon P, Panella J, Robinson J, Nickoloff BJ. Innate immune-related receptors in normal and psoriatic skin. Arch Pathol Lab Med. 2003;127:178–86. doi: 10.5858/2003-127-178-IIRRIN. [DOI] [PubMed] [Google Scholar]
  • 27.Trinchieri G, Wysocka M, D'Andrea A, Rengaraju M, Aste-Amezaga M, Kubin M, Valiante NM, Chehimi J. Natural killer cell stimulatory factor (NKSF) or interleukin-12 is a key regulator of immune response and inflammation. Prog Growth Factor Res. 1992;4:355–68. doi: 10.1016/0955-2235(92)90016-b. [DOI] [PubMed] [Google Scholar]
  • 28.Sparwasser T, Vabulas RM, Villmow B, Lipford GB, Wagner H. Bacterial CpG-DNA activates dendritic cells in vivo: T helper cell-independent cytotoxic T cell responses to soluble proteins. Eur J Immunol. 2000;30:3591–7. doi: 10.1002/1521-4141(200012)30:12<3591::AID-IMMU3591>3.0.CO;2-J. [DOI] [PubMed] [Google Scholar]
  • 29.Sato Y, Roman M, Tighe H, et al. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science. 1996;273:352–4. doi: 10.1126/science.273.5273.352. [DOI] [PubMed] [Google Scholar]
  • 30.Kobayashi H, Horner AA, Takabayashi K, Nguyen MD, Huang E, Cinman N, Raz E. Immunostimulatory DNA pre-priming: a novel approach for prolonged Th1-biased immunity. Cell Immunol. 1999;198:69–75. doi: 10.1006/cimm.1999.1572. [DOI] [PubMed] [Google Scholar]
  • 31.Donnelly JJ, Ulmer JB, Shiver JW, Liu MA. DNA vaccines. Annu Rev Immunol. 1997;15:617–48. doi: 10.1146/annurev.immunol.15.1.617. [DOI] [PubMed] [Google Scholar]
  • 32.Feltquate DM, Heaney S, Webster RG, Robinson HL. Different T helper cell types and antibody isotypes generated by saline and gene gun DNA immunization. J Immunol. 1997;158:2278–84. [PubMed] [Google Scholar]
  • 33.Weiss R, Scheiblhofer S, Freund J, Ferreira F, Livey I, Thalhamer J. Gene gun bombardment with gold particles displays a particular Th2-promoting signal that over-rules the Th1-inducing effect of immunostimulatory CpG motifs in DNA vaccines. Vaccine. 2002;20:3148–54. doi: 10.1016/s0264-410x(02)00250-5. [DOI] [PubMed] [Google Scholar]
  • 34.Hochreiter R, Hartl A, Freund J, Valenta R, Ferreira F, Thalhamer J. The influence of CpG motifs on a protein or DNA-based Th2-type immune response against major pollen allergens Bet v 1a, Phl p 2 and Escherichia coli-derived beta-galactosidase. Int Arch Allergy Immunol. 2001;124:406–10. doi: 10.1159/000053772. [DOI] [PubMed] [Google Scholar]
  • 35.Schirmbeck R, Reimann J. Modulation of gene-gun-mediated Th2 immunity to hepatitis B surface antigen by bacterial CpG motifs or IL-12. Intervirology. 2001;44:115–23. doi: 10.1159/000050038. [DOI] [PubMed] [Google Scholar]

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES