Constitutive activation of Lck and Fyn tyrosine kinases in large granular lymphocytes infected with the γ-herpesvirus agents of malignant catarrhal fever

S Swa; H Wright; J Thomson; H Reid; D Haig

doi:10.1046/j.1365-2567.2001.01154.x

. 2001 Jan;102(1):44–52. doi: 10.1046/j.1365-2567.2001.01154.x

Constitutive activation of Lck and Fyn tyrosine kinases in large granular lymphocytes infected with the γ-herpesvirus agents of malignant catarrhal fever

S Swa ¹, H Wright ¹, J Thomson ¹, H Reid ¹, D Haig ¹

PMCID: PMC1783148 PMID: 11168636

Abstract

Large granular lymphocytes (LGL) with a T or natural killer (NK) lymphoblast morphology and indiscriminate (non-major histocompatibility complex-linked) cytotoxicity for a variety of target cells can be derived in culture from the tissues of animals infected with either alcelaphine herpesvirus-1 (AlHV-1) or ovine herpesvirus-2 (OvHV-2). In this study, LGL survival in the absence of exogenous interleukin-2 was inhibited by the protein kinase inhibitor genestein, but not the p70 s6 kinase inhibitor rapamycin. Constitutive activation of the src kinases Lck and Fyn was demonstrated in a bovine LGL line infected with OvHV-2 and in two rabbit LGL lines infected with AlHV-1. The p44 erk1 and p42 erk2 mitogen-activated protein kinases (MAPK) were also constitutively activated in the LGLs but not control T cells. Lck and Fyn kinase activity in the LGLs did not increase after mitogen (concanavalin A or concanavalin A plus phorbol ester) stimulation of the cells, in contrast to control T cells. Control T cells, but not the LGLs, proliferated after mitogen stimulation. An analysis of tyrosine phosphorylated proteins in the cells indicated that the LGLs exhibited some similarities and differences to activated control T cells. The results demonstrate that the activated phenotype of the LGLs, associated with malignant catarrhal fever virus infection and in the absence of exogenous interleukin-2, involves constitutively activated Lck and Fyn kinases. These are normally crucial for the initial activation of T cells via several cell-surface receptors (e.g. the T-cell receptor and CD2). The inability of the LGLs to proliferate in response to mitogen may be due to an inability of Lck and Fyn to become further activated after mitogen stimulation.

Introduction

Malignant catarrhal fever (MCF) is a fatal lymphoproliferative disease of farmed and wild ungulates.¹^–³ The known causative agents are two γ-herpesviruses, alcelaphine herpesvirus-1 (AlHV-1) and ovine herpesvirus-2 (OvHV-2). AlHV-1 infects and replicates in blue wildebeest (Connochaetes taurinus), causing no apparent disease. In contrast, when MCF-susceptible species become infected they develop MCF, which is usually fatal. OvHV-2 infects and replicates in sheep, which do not become diseased. However, a proportion of cattle, deer, or other susceptible species that are in the vicinity of infected sheep can become infected and develop MCF which again is normally fatal. Rabbits develop MCF after experimental infection with AlHV-1 or OvHV-2 that is characteristic of the disease in ungulates.¹^,³^,⁴

MCF is characterized by degenerative changes in multiple tissues, associated with the infiltration of large numbers of lymphocytes and hyperplasia of lymphoid organs. In OvHV-2-infected cattle or rabbits, submandibular and mesenteric (MLN) lymph nodes, appendix and spleen become enlarged. This is followed by invasion of non-lymphoid tissue by lymphocytes and tissue necrosis in both lymphoid and non-lymphoid tissues.¹^,³^,⁴ In AlHV-1-infected animals, the pathology is generally similar except that popliteal lymph nodes are larger and MLN are smaller than in OvHV-2-induced disease. The current hypothesis is that MCF is caused by the auto-destruction of tissues by indiscriminately cytotoxic lymphocytes, produced as a consequence of MCF virus infection.

Large granular lymphocytes (LGL) containing viral transcripts can be derived from MCF virus-infected animal lymph node, spleen, corneal and other affected tissues and grown in culture.¹^–⁴ The LGL can transmit MCF when injected into rabbits or other susceptible species. The LGL are normally grown in medium containing interleukin-2 (IL-2), but can also be grown in the absence of IL-2 and other exogenously added cytokines. The phenotype of the cultured cells from OvHV-2-infected cattle is generally characteristic of T cells or natural killer (NK) cells. CD4⁺ and CD8⁺ T cells as well as CD4⁻ CD8⁻ T cells have been grown in culture.³^,⁵^,⁶

Characteristics of OvHV-2 virus-infected bovine T cells in culture are: large granular lymphocyte morphology; the ability to survive or grow in culture in the absence of exogenous IL-2 (or other cytokines) for longer periods than non-infected cells; constitutive non-major histocompatibility complex (MHC) -associated cytotoxicity; T-cell or NK-cell surface alloantigen phenotype; lack of IL-2 mRNA and protein expression; and lack of mitogen-stimulated proliferation in culture.¹^,³^,⁶^,⁷ Rabbit AlHV-1-infected LGLs have some of the above properties but are not as well characterized.¹^,³ The viruses of MCF have several features in common with other T-cell-tropic γ-herpesviruses, particularly herpesvirus saimiri (HVS). HVS naturally infects squirrel monkeys without disease but causes a lymphoproliferative disease associated with lymphomas and leukaemias of T-cell origin following infection of disease-susceptible primates.⁸ HVS will infect human T cells in culture that can be cytotoxic and grow in the absence of exogenous IL-2.⁹

A common feature of HVS and Epstein–Barr virus (EBV) γ-herpesviruses is the presence of viral proteins that interfere with lymphocyte signal transduction molecules, particularly the non-receptor protein tyrosine kinases (NRPTK)¹⁰. In EBV, latent membrane protein-2A (LMP-2A) binds to and inhibits the activity of the B cell NRPTKs Lyn (a src kinase) and Syk¹¹ HVS-transformed monkey and human T cells contain stp and tip virus proteins.⁹^,¹²^,¹³ The tip protein is a membrane protein that binds to and alters the function of the NRPTK Lck (a src kinase).

By targeting NRPTKs, many viruses have evolved an effective mechanism for controlling the virus life cycle and pathogenicity by altering the signalling pathways of infected cells.¹⁰ The T-cell-associated src kinases Lck and Fyn are NRPTKs that are recruited to the T-cell receptor complex and other receptor structures (e.g. CD4, CD8 and CD2) within minutes of T-cell stimulation via these receptors. They link with a range of downstream signalling pathways including the ras/raf-1/erk MAPK pathway to control T-cell activation, proliferation and differentiation (reviewed in refs ¹⁴ and ¹⁵). Lck and Fyn are therefore candidate molecules for interference by the MCF viruses AlHV-1 and OvHV-2.

The genome sequence of AlHV-1 has recently been elucidated.¹⁶ However, an amino acid homology search of the virus open reading frames (ORFs) for putative binding factors for host signalling molecules has been unsuccessful.

The objective of this study was to determine whether the IL-2-independent growth of LGLs from MCF-affected animals was associated with protein kinase modulation in the LGLs compared to lymphocytes from uninfected control animals. In particular, we wished to compare the activation status of the src kinases Lck and Fyn in AlHV-1- and OvHV-2-infected LGLs, compared to uninfected T cells, grown in culture in the absence of exogenous IL-2.

Materials and methods

Viruses and cells

The fully virulent C500 strain of AlHV-1 was maintained by passage in rabbits.¹^,³^,⁵ The AlHV-1-infected LGL cell lines 1859 and 1860 were generated by injecting C500-infected rabbit lymphoid cells intravenously into two rabbits. Two days after a rise in rectal temperature above 40°, the rabbits were killed. MLN and spleen cells were harvested, single cell suspensions were prepared and cultured at 5 × 10⁶−10 × 10⁶ cells/ml in Iscove's modified Dulbecco's medium (IMDM) containing 10% fetal calf serum (FCS) and 200 U/ml IL-2 (Eurocetus, Amsterdam, the Netherlands) in 25-cm² flasks. Large granular lymphocytes developed after 1–3 weeks of splitting and refeeding the cells with IL-2 on an approximately weekly basis. After 8 weeks the phenotype of the cells had stabilized (Table 1). Virus genes and proteins were detected in the LGL using polymerase chain reaction (PCR) for the AlHV-1 P1 gene (ORF 50, an early viral R-transactivator gene¹⁶) and indirect immunofluorescence using serum antibody to AlHV-1 proteins from an infected rabbit, using techniques described previously.¹⁷^,¹⁸

Table 1.

Phenotype of the MCF virus-infected cell lines

Cells	Virus	Surface phenotype (%)^*	BLT-esterase (%)^†
1859	AlHV-1	CD5⁺(50%), CD4⁻, CD8⁺(50%), IgM⁻	> 80
1860	AlHV-1	CD5⁻, CD4⁻, CD8⁺ (45%), IgM⁻	> 75
BJ1035	OvHV-2	CD2⁺, CD4⁻, CD8⁻, CD21⁻	> 90

Open in a new tab

CD⁺ cells were > 98% positive unless shown otherwise in parentheses.

^†

BLT-esterase⁺ cells detected by cytochemistry (result shown based on two separate analyses). Control T cells (rabbit and bovine) were < 5% BLT-esterase⁺, except for one rabbit CD8⁺ (95% positive) T-cell line that was 22% BLT-esterase⁺.

For the P1 DNA PCR, a guanidinium isothiocyanate extract of cells was analysed using the following primers: 5′ TTCTATTGTCCACTGCCTCATCTC; and 3′ TGACTGTGGTTCACTTGCTTCCAG. PCR amplification was performed using the Expand® long template PCR (Boehringer Mannheim, Mannheim, Germany). Amplified product (503 bp) was analysed on agarose gels stained with ethidium bromide and visualized under UV light.

For IL-2-independent growth, 1859 and 1860 LGL were washed in medium and cultured in 24-well tissue culture plates at 10⁶/ml. For this study, the rabbit LGL were taken from culture between 48 and 96 hr after deprivation of exogenous IL-2, when cell viability was > 70%.

Control rabbit or bovine cells were peripheral blood mononuclear cells (PBMC) derived from blood after centrifugation over lymphoprep (Nyegard, Oslo, Norway). T-cell blasts were also used. These were derived from 2 × 10⁶/ml PBMC stimulated with 5 µg/ml concanavalin A (Con A) for 3 days. Then, 2 × 10⁵ lymphoblasts/ml medium were expanded for 1–4 weeks in 200 U/ml IL-2. The cells were split and refed with the IL-2 and fresh medium every 3–5 days. The control cells were negative for AlHV-1 or OvHV-2 viruses, using the tests described above and below. For IL-2-independent growth, 10⁶ rabbit or bovine T-cell blasts were cultured in IMDM. The cells did not survive at > 70% viability at 10⁶/ml (or less) for more than 30 hr and during this time the majority of viable lymphoblasts reverted to a ‘resting’ medium/large lymphocyte morphology.

The BJ1035 LGL cell line was derived from a cow naturally infected with OvHV-2 in 1994.⁶ The T cells were routinely passaged in IMDM containing 200 U/ml IL-2. BJ1035 was also maintained for 12 weeks in IMDM without exogenous IL-2. The cells were replenished with medium and readjusted to 10⁶/ml approximately every week. The cells exhibited a doubling time of 7–8 days under these conditions. The presence of OvHV-2 DNA in the cells was detected by PCR as described previously.¹⁹ OvHV-2 virus proteins were detected within the cells using antibodies from the serum of a convalescent cow and an indirect immunofluorescence technique.

Antibodies

Murine monoclonal antibodies (mAb): anti-rabbit CD4 (clone KEN-4); anti-rabbit CD8α (clone 12C6); anti-rabbit CD5 (clone KEN-5); anti-rabbit immunoglobulin M (IgM; clone NRBM) were purchased from Serotec (Slough, UK). The mAbs to bovine antigens: anti-bovine CD4 (clone CC8); anti-bovine CD8 (clone CC63); anti-bovine CD2 (clone CC42); anti-bovine CD21 (clone CC21) were gifts from the Institute for Animal Health, Compton, Berkshire, UK. The murine anti-phosphotyrosine mAb (clone 4G10) was obtained from Upstate Biotechnology (Lake Placid, NY). The murine anti-Lck (clone 3A5), anti-Fyn (clone 15), and anti-phosphorylated (activated) erk1 (clone sc-7383) mAbs and the rabbit anti-erk1 antibody (sc-94) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Isotype-matched control murine mAbs to Border Disease virus antigens were a gift from G. Entrican (Moredun Research Institute). The AlHV-1 and OvHV-2 antibodies were obtained from the serum of an AlHV-1-infected rabbit and a cow that survived OvHV-2 infection, respectively. The antibodies recognize uncharacterized virus antigen(s) located in the nuclei and perinuclear areas of infected cells. They do not react with uninfected cells.

Cell phenotype analysis

Cell-surface antigens were detected by indirect immunofluorescence and fluorescence-activated cell scan (FACscan) analysis (Becton Dickinson, Mountain View, CA) using standard procedures.

Cytotoxic cell BLT-esterase activity was detected in the LGL and control cells using the tryptase-specific substrate N-α-benzyloxy-carbonyl-l-lysine thiobenzyl ester (BLT, Sigma, Poole, UK) as described previously.²⁰ BLT-esterase is expressed by activated cytotoxic cells.²⁰^,²¹

Treatment of LGL cells by genestein and rapamycin

Virus-infected LGLs in IL-2-deficient IMDM were added to wells of a 96-well tissue culture plate at 10⁵ cells/well (100 µl/well). The protein kinase inhibitor genestein (TCS, Botolph Claydon, Buckingham, UK) was added to the wells to give final concentrations of 1 µm, 10 µm and 100 µm. The 1035 LGL line was also treated with the p70 s6 kinase inhibitor rapamycin (TCS, UK) at 0·1 nm, 1 nm, 10 nm and 100 nm. Cell growth was measured as the numbers of viable cells (determined by nigrosine exclusion) per ml on day 3 of culture.

Cell activation and lysate production

Antibodies that cross-link the T-cell receptor and activate rabbit and bovine T cells are not available. Instead, the T-cell-stimulating mitogen Con A (ICN, Thame, UK) with and without the phorbol ester 12-O-Tetradecanoylphorbol 13-acetate (TPA; Sigma) was used in this study. For T-cell proliferation, different concentrations of Con A (± TPA) were used to stimulate 100 µl aliquots of 2 × 10⁶ cells/ml IMDM (2·5% FCS) in the wells of 96-well plates. After 2 days of culture, the cells were incubated with 50 µl [³H]thymidine (0·5 µCi/well) for a further 18 hr. Cells were harvested onto membranes and [³H]thymidine incorporation measured in a β-scintillation counter (Tri-carb 2500 TR, Packard, Meriden, CT).

For cell stimulation, 10 µg/ml Con A was added (± 5 ng/ml TPA) to 5 × 10⁶ or 10⁷ PBMC or IL-2-deprived T cells or LGL in 1 ml serum-free medium at 37° in microfuge tubes for various periods of time. The doses of Con A and TPA used were determined by dose–response kinase-activation (phospho-transferase) experiments. Activation reactions were stopped by centrifugation of the cells at 10 000 g for 10 seconds in a microfuge at 4°. Supernatants were discarded and cells were lysed with ice-cold lysis buffer (1% Triton-X, 150 mm NaCl, 1 mm sodium vanadate, 1 mm sodium fluoride, 10 mm Tris–HCl pH 7·5) containing protease inhibitors (Complete®, Boehringer Mannheim). Then, 50 µl of lysis buffer was added to cells for subsequent analysis of tyrosine-phosphorylated proteins using the 4G10 antibody and Western blot. Prior to immuno-precipitation, 1 ml of lysis buffer was added to cells. Clarified lysates were obtained by centrifugation in a microfuge at 10 000 g for 20 min at 4°. Protein concentrations in the 50 µl lysates were within the 10–14 mg/ml range and in the 1 ml lysates were within the 1–2 mg/ml range as determined by bicinchoninic acid (BCA) assay (Pierce, Rockford, IL). For sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE), an equal volume of cell lysate from each cell preparation was added to the wells of the gels, the amount being expressed as cell-equivalents (i.e. the number of cells lysed to make the lysate).

Immunoprecipitation and Western blot analyses

Lysates were precleared with murine or rabbit IgG-agarose for 1 hr at 4° followed by centrifugation and removal of the agarose beads. Primary Lck, Fyn, or control mAb (final concentration 1 µg/ml) was added to lysates for 1–2 hr at 4°; 20 µl of protein-A/G-agarose (Santa Cruz) was added and lysates were incubated for 1 hr at 4°. Agarose immunoprecipitates were centrifuged and washed three times in lysis buffer. A 5-µl sample (of 25 µl total volume) was taken at this stage for Western blot analysis of immunoprecipitated Lck or Fyn kinases. For the phosphotransferase assay, the agarose complexes containing Lck and Fyn were washed twice more with kinase buffer (20 mm Tris–HCl pH 7·5, 10 mm MgCl₂, 5 mm MnCl₂).

For Western blot analysis, samples of lysate were boiled in reducing sample buffer (containing 2-mercaptoethenol) and proteins were separated by SDS–PAGE using 10% or 12% Proseive-50 gels (FMC, Rockland, WA) and a Mini-Protean II apparatus (Biorad, Hemel Hampstead, UK). Proteins were transferred to nitrocellulose membranes using a semi-dry transfer apparatus (Sigma). Membranes were blocked in 5% non-fat milk (Marvel) for 1 hr, and dilutions of primary antibodies were added in wash buffer (0·5% Tween-80 in phosphate-buffered saline) for 1 hr (or overnight at 4°). Membranes were washed (2 × 10 min) in wash buffer and the horseradish peroxidase-conjugated goat anti-mouse (or anti-rabbit) IgG second-stage antibody was added for 1–2 hr at room temperature. After a final wash, proteins were detected using the enhanced chemiluminescence (ECL) method (Amersham, Little Chalfont, UK). Control antibodies did not immunoprecipitate antigen from cell lysates.

In vitro phosphotransferase assay

The activation of immunoprecipitated Fyn and Lck kinases was assayed by kinase-mediated in vitro phosphotransferase of [³²γ]-ATP (Amersham) to the src kinase substrate acid-treated rabbit muscle enolase (Sigma). Twenty-five microlitres of kinase buffer containing 25 µm ATP (Sigma), 400 µg/ml acid-treated enolase, and 320 µCi/ml [³²γ]-ATP was added to the agarose immunocomplexes in microfuge tubes. The samples were incubated at 30° for 10 min in a water bath. Then, 6 µl of fourfold concentrated electrophoresis sample buffer (500 mm Tris–HCl pH 6·8, 8% SDS, 20% glycerol, 0·012% bromophenol blue, 8% β-mercaptoethanol) was added to the samples which were incubated for a further 20 min at room temperature. The samples were boiled for 5 min and fractions were separated by SDS–PAGE using 10% or 12% Proseive gels. The gels were fixed and stained with Coomassie blue (0·25% Coomassie blue in 45% methanol, 10% acetic acid), destained (40% methanol, 10% acetic acid), dried and exposed to X-ray film. Kinase activity was detected as a band of [³²γ]-ATP-phosphorylated enolase (molecular weight 48 000). In order to quantify the phosphorylation of enolase, the 48 000 MW enolase bands were excised from the gels and radioactivity was measured in a β-scintillation counter. Incorporation of [³²γ]-ATP into enolase was calculated for each sample as follows: [counts per minute (c.p.m.) enolase in the presence of kinase] − (c.p.m. enolase in control samples without immunoprecipitated kinase).

Mitogen-activated protein kinases (MAPK) activation analysis

Activated p42 and p44 MAPK is phosphorylated on tyrosine and threonine residues at positions 185 and 183, respectively, and was detected in cell lysates by Western blot using the p42/44 MAPK-phosphotyrosine-specific mAb sc-7383. Non-phosphorylated MAPK was detected using the erk1-specific antibody sc-94 that cross-reacts with erk2.

Results

Phenotype of MCF virus-infected cell lines

The LGL cell lines consisted of > 96% LGL, of which > 80% stained positive for either AlHV-1 (1859 and 1860) or OvHV-2 (1035) proteins by immunofluorescence. P1 mRNA was detected by reverse transcription (RT) -PCR in the rabbit AlHV-1⁺ LGL but not in control rabbit cells. OvHV-2 DNA was detected by PCR in the bovine 1035 LGL line, but not in control uninfected bovine T cells.

In the absence of exogenous IL-2 for at least 4 days in the cultures, the LGL survived or grew and maintained a lymphoblastoid appearance and constitutive expression of BLT-esterase, an activated cytotoxic cell tryptase (Table 1).

Table 1 shows the cell-surface phenotype of the MCF virus-infected LGL cell lines. The phenotype of approximately half of the cells of the AHV-1⁺ rabbit LGL could not be typed with the available antibodies. The LGL did not contain B cells (IgM⁻ or CD21⁻).

Control rabbit and bovine T cells (n = 12) derived from Con-A-stimulated blood mononuclear cells (MNC) were: CD5⁺ (> 90%) or CD2⁺ (> 90%) IgM⁻ (< 5%) or CD21⁻ (< 5%), CD4⁺ (range 8–90%) and/or CD8⁺ (range 4–95%).

Mitogen-stimulated MCF virus-infected LGL do not proliferate in culture

Table 2 shows that Con A or Con A plus TPA stimulated a proliferation signal ([³H]thymidine incorporation into dividing cells) in control rabbit or bovine T-cell blasts that had been deprived of exogenous IL-2 for approximately 30 hr. However, the AlHV-1-infected rabbit LGL (1859 and 1860) and the OvHV-2-infected bovine LGL line (1035) that had been deprived of IL-2 for approximately 48 hr and 4 days, respectively, did not respond to Con A or Con A/TPA stimulation with any significant increase in [³H]thymidine incorporation into the cells above that of unstimulated cells. [³H]Thymidine incorporation into unstimulated LGL cells but not into control uninfected T cells showed that at least a proportion of the LGL (but not the control T cells) were dividing in the absence of exogenous IL-2. Con A and Con A plus TPA stimulated cell aggregate formation in both control T cells and the LGL. This, along with a minor Con A dose-dependent effect on [³H]thymidine incorporation into LGL indicated that Con A was capable of stimulating a response in the LGL.

Table 2.

Mitogen-stimulated proliferation of LGL and control T cells

Stimulus	1859 LGL	1860 LGL	1035 LGL	Bovine T cells	Rabbit T cells
Medium control	2498 ± 131	1292 ± 22	1060 ± 21	132 ± 12	22 ± 1·2
Con A, 10 µg/ml	1349 ± 126	1648 ± 108	1368 ± 102	2734 ± 98	1030 ± 68
Con-A, 5 µg/ml	2467 ± 106	1825 ± 146	634 ± 5	4820 ± 246	4307 ± 249
Con A, 2·5 µg/ml	2044 ± 110	1342 ± 98	856 ± 41	3160 ± 148	2312 ± 168
Con A (5) + TPA^*	2264 ± 242	1924 ± 110	1403 ± 125	5204 ± 124	1489 ± 35
Con A (2·5) + TPA	2402 ± 114	1727 ± 232	893 ± 171	5796 ± 342	4704 ± 137
Con A (1·25) + TPA	2233 ± 102	1650 ± 78	1240 ± 39	4668 ± 236	3220 ± 49
TPA	1245 ± 68	1376 ± 116	1448 ± 71	896 ± 72	130 ± 9

Open in a new tab

Data are counts per minute ± SEM from replicate samples in the [³H]thymidine incorporation assay.

TPA used at 5 ng/ml alone or in combination with Con A used at the doses shown in parentheses (in µg/ml).

Tyrosine phosphorylated proteins in total cell lysates

Tyrosine phosphorylated proteins were detected in the cell lysates of control T cells deprived of IL-2 for 30 hr and MCF virus-infected LGL deprived of IL-2 for at least 48 hr, with and without Con A stimulation. This was to determine whether infection with virus was associated with any differences in tyrosine-phosphorylated protein expression between the LGL cell lines and control T cells. In particular proteins phosphorylated within 10 min of Con A stimulation were compared, as these are likely to reveal the NRPTKs.

The unstimulated rabbit AlHV-1-infected LGL cell lines 1859 and 1860 expressed phosphotyrosine proteins at MW of approximately 21 000, 30 000, 38 000, 42 000, 48 000, 56 000 and 59 000 (Fig. 1a) that were also seen in repeated 4G10 blots. Five minutes after Con A stimulation the intensity of some bands (e.g. p30, p38, p42) decreased while there was an increase in the intensity of a p50 band in the example shown (Fig. 1a), but not in repeated analyses of the same LGL. Control rabbit T cells expressed phosphoproteins with MW of approximately 38 000, 42 000, 55 000, 59 000, 70 000, 90 000 and 130 000 5 min after Con A stimulation (Fig. 1a).

Phosphotyrosine proteins in LGL and control cell lysates. 4G10 anti-phosphotyrosine Western blot of lysates from unstimulated (−) cells or cells stimulated for 5 (5) or 10 (10) min with 10 µg/ml Con A and subjected to SDS–PAGE. (a) Control rabbit T cells and the AHlV-1⁺ LGL 1859 and 1860. (b) Control bovine blood mononuclear cells, control bovine T cells and the OvHV-2⁺ LGL 1035.

Control stimulated bovine PBMNC or T-cell blasts and the unstimulated and stimulated bovine OvHV-2-infected cell line BJ1035 expressed phosphotyrosine proteins at approximately 21 000, 38 000, 48 000, 56 000, 59 000, 70 000 and 90 000 (Fig. 1b). Control, unstimulated T-cell blasts exhibited low level expression of phosphotyrosine proteins compared to stimulated cells. Unstimulated PBMC did not express any detectable phosphotyrosine proteins. BJ1035 cells, when compared to unstimulated cells after stimulation with Con A showed an increase in 48 000, 61 000, 70 000 and 90 000 protein staining with 4G10, whereas 56 000 and 59 000 protein expression was not visibly altered.

Genestein inhibits the IL-2-independent growth of LGLs

Table 3 shows that exogenous IL-2-independent survival/growth of the OvHV2⁺ bovine LGL line 1035 and the AlHV-1⁺ rabbit LGL line 1859 was inhibited in a dose-dependent way by the protein kinase inhibitor genestein. The 1035 LGL cell growth was not inhibited by rapamycin. The rapamycin experiment was not performed on the rabbit LGLs as they died during the course of these studies and could not be resurrected from frozen stock.

Table 3.

Inhibition of LGL growth by genestein but not rapamycin

Inhibitor	1035 LGL (cells/ml) × 10⁶	1859 LGL (cells/ml) × 10⁶
Genestein
Medium control	1·43 ± 0·23	1·13 ± 0·12
1 µm	1·33 ± 0·28	0·93 ± 0·10
10 µm	0·90 ± 0·20	0·50 ± 0·09^*
100 µm	0·48 ± 0·12^*	0·26 ± 0·10^*
Rapamycin
Medium control	1·30 ± 0·12	nd
0·1 nm	1·14 ± 0·14	nd
1 nm	1·23 ± 0·09	nd
10 nm	1·10 ± 0·22	nd
100 nm	1·20 ± 0·14	nd

Open in a new tab

Viable cell counts (mean ±SEM for triplicate wells) performed after 3 days of culture. All cells set up at 10⁶/ml on day 0. nd, not determined.

P < 0·01 compared with medium control values.

Fyn and Lck kinases are constitutively active in the MCF virus-infected cell lines

Figure 2 shows that Con A stimulated an increase in Fyn activity in control cells whereas in the LGLs, Fyn was activated in the absence of Con A and did not increase in activity after Con A stimulation. In control cells, the degree of activation was low or not detectable in ‘rested’ unstimulated cells, but was high in cells stimulated for 5 min with Con A. Fyn kinase activity had declined by 30 min compared to 5 min after stimulation (Fig. 2a, d). In contrast, the Fyn kinases in the 1859, 1860 and 1035 cells were approximately equally activated in both the unstimulated and Con-A-stimulated cells (Fig. 2a,d).

Fyn kinase activation in the LGL lines and control T cells. (a) Autoradiograph of SDS–PAGE gel showing enolase phosphorylation by Fyn kinase immuno-precipitated from LGL and control rabbit (ra) and bovine (bo) T cells either unstimulated (0) or stimulated with Con A (10 µg/ml) for 5 min (5) or 30 min (30). (b) Coomassie blue stain, control for protein loading in each lane (showing enolase band). (c) Western blot (anti-Fyn) control for immunoprecipitated Fyn loading. (d) Quantification of enolase phosphorylation by β-scintillation counts per minute (c.p.m.) of enolase bands cut out of the SDS–PAGE gels. C, control T cells; 59, 1859 LGL; 60, 1860 LGL; 35, 1035 LGL; unstimulated (0) or stimulated for 5 or 30 min with Con A. Lysates from 8 × 10⁶ cell equivalents were loaded in each of the lanes of the gels. Note that a comparison of the intensity of Fyn-mediated enolase phosphorylation between control and LGL cells, and between LGL cell lines may not be possible as different exposure times were often used in the development of the autoradiographs. Furthermore, β-scintillation analysis of the enolase bands cut from the gels of the different cell types did not always take place at the same relative time following the gel run.

Figure 2(b,c) shows that for each of the cell types, there was an equal loading of enolase and an approximately equal loading of immunoprecipitated Fyn in the gels.

Figure 3 shows that Lck kinase activated and phosphorylated enolase when Lck was immunoprecipitated from: control rabbit blood mononuclear cells after Con A stimulation; control rabbit or bovine T cells particularly after Con A stimulation; AlHV-1-infected 1859 and 1860 LGLs and the OvHV-2-infected 1035 LGL cells either before or after Con A stimulation (Fig. 3a,d). In contrast to the control cells, the LGL exhibited Lck activation in the absence of Con A that did not increase after Con A stimulation of the cells (Fig. 3a,d). Figure 3(b,c) show that for each of the cell types, there was an equal loading of enolase (except for 1859 and 1860 cells in Fig. 3(b) where the quality of the stained gel was poor on two occasions and is not shown) and an approximately equal loading of immunoprecipitated Fyn in the gels.

Lck kinase activation in the LGL lines and control T cells. (a) Autoradiograph of SDS–PAGE gel showing enolase phosphorylation by Lck kinase immunoprecipitated from the LGL and control bovine (bo) and rabbit (ra) T cells either unstimulated (0) or stimulated with Con A (10 µg/ml) for 5 min (5) or 30 min (30). (b) Coomassie blue stain, control for protein loading in each lane (showing enolase band). (c) Western blot (anti-Lck antibody) control for immunoprecipitated Lck loading. (d) Quantification of enolase phosphorylation by β-scintillation c.p.m. of enolase bands cut out of the SDS–PAGE gels. TC, control T cells, 59, 1859; 60, 1860; and 35, 1035 LGL, unstimulated (0) or stimulated for 5 min and 30 min with Con A. Lysates from 8 × 10⁶ rabbit control and all of the LGL cell equivalents were loaded in each of the lanes of the gels. Lysates from 4 × 10⁶ bovine control cell equivalents were loaded in each of the lanes of the appropriate gel. Note that a comparison of the intensity of Lck-mediated enolase phosphorylation between control and LGL cells, and between LGL cell lines may not be possible as different exposure times were often used in the development of the autoradiographs. Furthermore, β-scintillation analysis of the enolase bands cut from the gels of the different cell types did not always take place at the same relative time following the gel run.

In all experiments, enolase was not phosphorylated in control samples containing enolase and [³²γ]-ATP without the immunoprecipitated kinases, as detected after autoradiography of the SDS–PAGE gels [e.g. Fig 3(a) compared to Fig. 3(b)], or by β-scintillation assay of the excised enolase bands. The inclusion of TPA with ConA as a stimulus for the cells generated similar results (data not shown) to those shown using ConA only.

P42/44 MAPK are constitutively activated in the LGLs

To determine whether activated Lck or Fyn was associated with the activation of downstream signalling pathways, LGL and control cell lysates were analysed for p42/44 MAPK activation (phosphorylation). Figure 4(a,b) shows that the LGL cell lines constitutively expressed phosphorylated MAPK that did not increase in signal intensity after Con A stimulation of the cells for 10 min. The control Con-A-stimulated, IL-2-deprived rabbit and bovine T cells expressed phosphorylated MAPK, whereas the unstimulated cells expressed little or no detectable phosphorylated MAPK.

Activation of p42/44 MAPK in the LGL lines and control T cells. (a) Anti-phosphorylated p42/44 MAPK (erk1 and erk2) Western blot of whole cell lysates (1·5 × 10⁶ cell equivalents/lane) of LGL cell lines and control rabbit and bovine T cells either unstimulated (−) or stimulated with Con A for 10 min (+). It is not clear whether p42 or p44 or both forms of MAPK have been phosphorylated. (b) Anti-p42/44 MAPK Western blot of the cell lysates described in (a). Note that both p42 and p44 forms of MAPK have been detected.

Discussion

The infiltration of lymphoid and non-lymphoid tissues by large lymphoblastoid cells and tissue necrosis are characteristic features of MCF. The LGL isolated from the tissues of animals with MCF exhibit an activated phenotype in culture. They are large lymphoblasts that can grow in the absence of exogenous cytokines and are indiscriminately cytotoxic, killing various target cells in a non-MHC-dependent manner.¹^,⁶^,⁷^,²²

A mechanism for the constitutive activation of the LGL is provided by this study in which the src kinases Lck and Fyn were constitutively activated in the LGL in cultures lacking exogenous IL-2, to the extent that further activation by the mitogen Con A was not possible. The OvHV-2⁺ bovine LGL line was the same in this respect as the two AlHV-1⁺ rabbit LGL lines. The survival or growth of the LGL with a lymphoblast morphology and activated cytotoxic phenotype (BLT-esterase⁺ – demonstrated in this study for the first time) in the absence of exogenous IL-2 suggests that, at least in the OvHV-2⁺ LGL where IL-2 is not produced, IL-2 is not essential for the maintenance of an activated LGL phenotype. The activation characteristics of the LGL are associated with infection of the cells with MCF viruses, although no viral proteins have so far been identified that interact with T-cell (or any other cell) proteins. Control (uninfected) T lymphoblasts in culture do not survive in the absence of exogenous IL-2 and do not develop a LGL cytotoxic cell phenotype characteristic of MCF virus-infected cells. PBMC and T-cell blasts were appropriate controls in these experiments as they contain the principal cell types that express Lck and Fyn kinases in uninfected animals. Furthermore, the LGLs are most similar to these normal cell types in spite of a phenotype altered by infection. An issue that needs to be resolved is whether the LGL are T cells or NK cells. Lck and Fyn are active in the early stage of NK-cell activation, for example via Fcγ receptors.²³ However, Lck-deficient, Fyn-deficient and ZAP-70-deficient mice do not exhibit defects in natural killing despite defects in T-cell function.²⁴ The conclusions of the present study are not affected, but there will be a need in future studies to define whether the LGL are T cells or NK cells.

The inhibition of 1035 LGL growth/survival in the absence of IL-2 by genestein but not rapamycin (albeit in only one LGL line studied) suggests that IL-2R-dependent signalling may not be involved in IL-2-independent LGL growth. Rapamycin inhibits biochemical events required for the progression of IL-2-stimulated T cells from G₁ to S phase of the cell cycle.²⁵ Furthermore, in a recent study, IL-2-independent growth of HVS-transformed T cells was associated with constitutive activation of the protein kinases Lck and ZAP-70 but not of JAK/STAT kinases associated with interleukin signalling.²⁶

Lck and Fyn are src kinases involved in the initiation of T-cell activation via the T-cell receptor (TCR) or other structures such as CD2, CD4, CD8 and the IL-2 receptor.¹⁴^,¹⁵ They are the first known signalling molecules to be recruited to the TCR after antigen or other external stimulation of the TCR. The kinases become activated by phosphorylation of activation motifs and phosphorylate immunoreceptor tyrosine-base activation motifs (ITAMs) on TCR CD3 and ζ chains. This in turn initiates a series of signalling events that leads to T-cell gene transcription and expression of an activated T-cell phenotype. Lck and Fyn are enzymatically inactive in resting cells.¹⁵^,²⁷ The constitutive action of inhibitory kinases such as Csk and phosphatases such as CD45 ensure that the src kinases are only active for a short period of time while recruited to a relevant surface receptor, such as the TCR.²⁸

Given this background, it was interesting that in the LGL, Lck and Fyn were always activated regardless of Con A or Con A and TPA stimulation. In control cells this was not the case and in addition there was a predicted rapid up-regulation followed by a decline of kinase activity after Con A stimulation. In these experiments, it was not always possible to compare basal levels of the kinases in control cells versus the LGLs. However, basal levels in the control cells probably represent residual activated cells in an otherwise ‘rested’ population. This was supported by the lack of kinase activity in unstimulated PBMNCs in all cases. If Lck and Fyn were at or near maximum activation in the LGL, then this would explain why any further stimulation of the cells by mitogen did not occur. An alternative explanation of the refractile response of LGLs to the mitogen is that they did not express receptors for Con-A (mannose-rich structures such as the TCR), as they had an unusual phenotype compared to control T cells (Table 1). This was apparently not the case as the LGL and the control T cells aggregated in the presence of Con A (indicating Con-A-binding to the cells). Furthermore, there was a tendency for the LGL to exhibit a small dose-dependent response to Con A or Con A plus TPA (Table 2). A lack of responsiveness of OvHV-2⁺ bovine LGL to Con A had been reported previously.⁶ In this study the comparative lack of responsiveness of AlHV-1⁺ rabbit LGL compared to control rabbit T cells to Con A (or Con A plus TPA) is demonstrated for the first time.

Interference with src kinase function (activation or inhibition) in lymphocytes is a feature of other γ-herpesvirus infections.¹⁰^–¹² EBV LMP2A protein binds to and inhibits the src kinase Lyn in B cells, preventing B-cell activation and presumably preventing the re-activation of EBV from the latent state in the B cells.¹¹ HVS Tip binds to Lck and interferes with Lck function in infected T cells.¹² Interestingly, deletion of either Tip or Stp in HVS-infected T cells inhibits the exogenous IL-2-independent growth of the cells.⁹ With the full genome sequence of AlHV-1 C500 strain available,¹⁶ the next stage of this project is to determine which viral proteins (if any) are responsible for the unusual LGL phenotype. In LGLs treated with the tyrosine kinase inhibitor genestein, IL-2-independent growth of the cells was inhibited. The identity of the tyrosine kinases that have been inhibited by genestein in the LGL remains to be determined, but Lck and Fyn must be candidates.

A direct association of transient Lck and Fyn kinase activation and aspects of T-cell activation has been demonstrated in human and murine T cells.¹⁴^,¹⁵ However, an association of these kinases with the activation of cytotoxic cell effector function is less clear. Different downstream signalling pathways are engaged after Lck and Fyn activation in T cells that control different aspects of T-cell activation. Of particular interest is the ZAP-70 kinase, which is intimately linked with src kinase regulation of T-cell activation. In patients with ZAP-70 mutations, peripheral T cells do not synthesize IL-2 and are refractile to TCR stimulation.²⁹^,³⁰ Unfortunately there was no ZAP-70 antibody available to study this kinase in the LGL. However, the ras/raf/erk (p42/44 MAPK) signalling pathway is downstream of Lck and Fyn and known to be activated by these src kinases.³¹ In this study, p42/44 MAPK was constitutively activated along with Lck and Fyn in the LGL cell lines. Although p42/44 MAPK can be activated by a variety of mitogenic stimuli, including those generated by the TCR and cytokine receptors,³¹ it is likely that its activation in the LGLs was by Lck and/or Fyn.

The examination of tyrosine-phosphorylated proteins in LGL versus control T cells in general indicated both similarities and differences. Between 5 and 7 phosphotyrosine proteins were detected in the 20 000–100 000 MW range in the LGL and control cells within 3–5 min after mitogen stimulation. Those of ∼55 000–59 000 MW probably include Lck and Fyn. The 70 000 band might be ZAP-70. In mouse and man Lck is a doublet of 56 and 59 kDa in western blots and Fyn is a 59 000 MW protein. In this study, the dominant form of Lck (where discernible) was the 59 000 MW moiety and Fyn in all the bovine and rabbit cells was a 55 000 MW protein.

The present results are important as they demonstrate that the earliest signalling molecules in T-cell activation are constitutively active in MCF virus-infected LGL, and that they cannot be further activated by mitogen stimulation. This is important because it was also a possibility that signalling molecules downstream of Lck and Fyn were activated, bypassing the NRPTKs such that Lck and Fyn were not required for the observed activation state of the cells.

Acknowledgments

We are grateful to Ann Percival, Irene Pow, Alex Schock and David Deane (Moredun Research Institute – MRI) for Technical or other expert support for the work; to Maggie Harnett (Glasgow University) and Dirk Dobbelaire (University of Berne) for advice on signal transduction techniques; and to Chris Howard (Compton Laboratory of the IAH, England) for the bovine lymphocyte-specific monoclonal antibodies. The Scottish Executive Rural Affairs Department (SERAD) supported the work, by way of a MRI studentship for S. Swa.

REFERENCES

1.Reid HW, Buxton D. Malignant catarrhal fever and the gamma-herpesvirinae of Bovidae. In: Wittmann G, editor. Developments in Veterinary Virology: Herpesvirus Diseases of Cattle, Horses and Pigs. Dordrecht, the Netherlands: Kluwer Academic Publishing; 1989. pp. 116–38. [Google Scholar]
2.Metzler AE. The Malignant Catarrhal Fever Complex. Comp Immun Microbiol Infect Dis. 1991;14:107–24. doi: 10.1016/0147-9571(91)90125-w. [DOI] [PubMed] [Google Scholar]
3.Plowright W. Malignant catarrhal fever virus. In: Dinter Z, Morein B, editors. Virus Infections of Vertebrates. Vol. 3. Amsterdam: Elsevier; 1990. pp. 123–36. [Google Scholar]
4.Buxton D, Reid HW, Finlayson J, Pow I. Pathogenesis of sheep-associated malignant catarrhal fever in rabbits. Res Vet Sci. 1984;36:205–11. [PubMed] [Google Scholar]
5.Schock A, Reid HW. Characterisation of the lymphoproliferation in rabbits experimentally affected with malignant catarrhal fever. Vet Microbiol. 1996;53:1111–9. doi: 10.1016/s0378-1135(96)01239-4. [DOI] [PubMed] [Google Scholar]
6.Schock A, Collins RA, Reid HW. Phenotype, growth regulation and cytokine transcription in ovine herpesvirus-2-infected bovine T cell lines. Vet Immunol Immunopathol. 1998;66:67–81. doi: 10.1016/s0165-2427(98)00187-1. 10.1016/s0165-2427(98)00187-1. [DOI] [PubMed] [Google Scholar]
7.Burrells C, Reid HW. Phenotypic analysis of lymphoblastoid cell lines derived from cattle and deer affected with sheep-associated malignant catarrhal fever. Vet Immunol Immunopathol. 1991;29:151–61. doi: 10.1016/0165-2427(91)90060-p. [DOI] [PubMed] [Google Scholar]
8.Jung JU, Desrosiers RC. Herpesvirus saimiri and ateles. In: Webster R, Granoff A, editors. The Encyclopedia of Virology. London: Academic Press; 1994. pp. 614–23. [Google Scholar]
9.Medveczky MM, Geck P, Sullivan JL, Serbousek D, Djeu JY, Medveczky PG. IL-2 independent growth and cytotoxicity of herpesvirus saimiri-infected human CD8 cells and involvement of two open reading frame sequences of the virus. Virology. 1993;196:402–12. doi: 10.1006/viro.1993.1495. 10.1006/viro.1993.1495. [DOI] [PubMed] [Google Scholar]
10.Collette Y, Olive D. Non-receptor protein tyrosine kinases as immune targets of viruses. Immunol Today. 1997;18:393–400. doi: 10.1016/s0167-5699(97)01104-3. 10.1016/s0167-5699(97)01104-3. [DOI] [PubMed] [Google Scholar]
11.Miller CL, Burkhardt AL, Lee JH, Stealey B, Longnecker R, Bolen JB, Kieff E. Integral membrane protein 2 of Epstein-Barr virus regulates reactivation from latency through dominant negative effects on protein-tyrosine kinases. Immunity. 1995;2:155–66. doi: 10.1016/s1074-7613(95)80040-9. [DOI] [PubMed] [Google Scholar]
12.Biesinger B, Tsygankov AY, Fickenscher H, Emmrich F, Fleckenstein B, Bolen JB, Broker BM. The product of the Herpesvirus saimiri open reading frame 1 (tip) interacts with T cell-specific kinase p561ck in transformed cells. J Biol Chem. 1995;270:4729–34. doi: 10.1074/jbc.270.9.4729. [DOI] [PubMed] [Google Scholar]
13.Jung JU, Desrosiers RC. Association of the viral oncoprotein STP-C488 with cellular ras. Mol Cell Biol. 1995;15:6506–11. doi: 10.1128/mcb.15.12.6506. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Qian D, Weiss A. T cell antigen receptor signal transduction. Curr Opin Cell Biol. 1997;9:205–12. doi: 10.1016/s0955-0674(97)80064-6. [DOI] [PubMed] [Google Scholar]
15.Van Leeuwen JEM, Samelson LE. T cell antigen-receptor signal transduction. Curr Opin Immunol. 1999;11:242–8. doi: 10.1016/s0952-7915(99)80040-5. 10.1016/s0952-7915(99)80040-5. [DOI] [PubMed] [Google Scholar]
16.Ensser A, Pflantz R, Fleckenstein B. Primary structure of the alcelaphine herpesvirus 1 genome. J Virol. 1997;71:6517–25. doi: 10.1128/jvi.71.9.6517-6525.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Plowright W, Herniman KA, Jesset DM, Kalunda M, Rampton CS. Immunisation of cattle against the herpesvirus of malignant catarrhal fever: failure of inactivated culture vaccines with adjuvant. Res Vet Sci. 1975;19:159–66. [PubMed] [Google Scholar]
18.Reid HW, Pow I, Buxton D. Antibody to alcelaphine herpesvirus-1 (AHV-1) in hamsters experimentally infected with AHV-1 and the ‘sheep-associated’ agent of malignant catarrhal fever. Res Vet Sci. 1989;47:383–6. [PubMed] [Google Scholar]
19.Baxter SIF, Pow I, Bridgen A, Reid HW. PCR detection of the sheep-associated agent of malignant catarrhal fever. Arch Virol. 1993;132:145–59. doi: 10.1007/BF01309849. [DOI] [PubMed] [Google Scholar]
20.Haig DM, Hutchison G, Thomson J, Yirrell D, Reid HW. Cytotolytic activity and associated serine protease expression by skin and afferent lymph CD8 T cells during orf virus reinfection. J Gen Virol. 1996;77:953–60. doi: 10.1099/0022-1317-77-5-953. [DOI] [PubMed] [Google Scholar]
21.Griffiths GM, Mueller C. Expression of perforin and granzymes in vivo: potential diagnostic markers for activated cytotoxic cells. Immunol Today. 1991;12:415–9. doi: 10.1016/0167-5699(91)90145-J. [DOI] [PubMed] [Google Scholar]
22.Cook CG, Splitter CA. Lytic function of bovine lymphokine-activated killer cells from a normal and a malignant catarrhal fever virus-infected animal. Vet Immunol Immunopathol. 1988;19:105–18. doi: 10.1016/0165-2427(88)90002-5. [DOI] [PubMed] [Google Scholar]
23.Rabinowich H, Manciulea M, Metes D, Sulica A, Herberman RB, Corey SJ, Whiteside TL. Physical and functional association of Fc mu receptor on human natural killer cells with zeta- and Fc epsilon R1 gamma chains and with src family protein tyrosine kinases. J Immunol. 1996;157:1485–91. [PubMed] [Google Scholar]
24.Brumbaugh KM, Binstadt BA, Billadeau DD, Schoon RA, Ten Dick CJ, Leibson PJ. Functional role for syk tyrosine kinase in natural killer cell-mediated natural cytotoxicity. J Exp Med. 1997;186:1965–72. doi: 10.1084/jem.186.12.1965. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Abraham RT. mammalian target of rapamycin: immunosuppressive drugs uncover a novel pathway of cytokine receptor signalling. Curr Opin Immunol. 1998;10:330–6. doi: 10.1016/s0952-7915(98)80172-6. [DOI] [PubMed] [Google Scholar]
26.Noraz N, Saha K, Ottones F, Smith S, Taylor N. Cutting Edge: Constitutive activation of TCR signalling molecules in IL-2-independent herpesvirus saimiri-transformed T cells. J Immunol. 1998;160:2042–5. [PubMed] [Google Scholar]
27.Cloutier JF, Veillette A. Co-operative inhibition of T-cell antigen receptor signalling by a complex between a kinase and a phosphatase. J Exp Med. 1999;189:111–21. doi: 10.1084/jem.189.1.111. [DOI] [PMC free article] [PubMed] [Google Scholar]
28.Thomas ML. The regulation of antigen-receptor signalling by protein tyrosine phosphatases: a hole in the story. Curr Opin Immunol. 1999;11:270–6. doi: 10.1016/s0952-7915(99)80044-2. 10.1016/s0952-7915(99)80044-2. [DOI] [PubMed] [Google Scholar]
29.Arpaia E, Shahar M, Dadi H, Cohen A, Roifman CM. Defective T cell receptor signalling and CD8+ thymic selection in humans lacking Zap-70 kinase. Cell. 1994;76:947–58. doi: 10.1016/0092-8674(94)90368-9. [DOI] [PubMed] [Google Scholar]
30.Gelfand EW, Weinberg K, Mazer BD, Kadlecek TA, Weiss A. Absence of Zap-70 prevents signalling through the antigen receptor on peripheral blood T cells but not on thymocytes. J Exp Med. 1995;182:1057–65. doi: 10.1084/jem.182.4.1057. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Schwartz MA, Baron V. Interactions between mitogenic stimuli, or, a thousand and one connections. Curr Opin Immunol. 1999;11:197–202. doi: 10.1016/s0955-0674(99)80026-x. [DOI] [PubMed] [Google Scholar]

[b1] 1.Reid HW, Buxton D. Malignant catarrhal fever and the gamma-herpesvirinae of Bovidae. In: Wittmann G, editor. Developments in Veterinary Virology: Herpesvirus Diseases of Cattle, Horses and Pigs. Dordrecht, the Netherlands: Kluwer Academic Publishing; 1989. pp. 116–38. [Google Scholar]

[b2] 2.Metzler AE. The Malignant Catarrhal Fever Complex. Comp Immun Microbiol Infect Dis. 1991;14:107–24. doi: 10.1016/0147-9571(91)90125-w. [DOI] [PubMed] [Google Scholar]

[b3] 3.Plowright W. Malignant catarrhal fever virus. In: Dinter Z, Morein B, editors. Virus Infections of Vertebrates. Vol. 3. Amsterdam: Elsevier; 1990. pp. 123–36. [Google Scholar]

[b4] 4.Buxton D, Reid HW, Finlayson J, Pow I. Pathogenesis of sheep-associated malignant catarrhal fever in rabbits. Res Vet Sci. 1984;36:205–11. [PubMed] [Google Scholar]

[b5] 5.Schock A, Reid HW. Characterisation of the lymphoproliferation in rabbits experimentally affected with malignant catarrhal fever. Vet Microbiol. 1996;53:1111–9. doi: 10.1016/s0378-1135(96)01239-4. [DOI] [PubMed] [Google Scholar]

[b6] 6.Schock A, Collins RA, Reid HW. Phenotype, growth regulation and cytokine transcription in ovine herpesvirus-2-infected bovine T cell lines. Vet Immunol Immunopathol. 1998;66:67–81. doi: 10.1016/s0165-2427(98)00187-1. 10.1016/s0165-2427(98)00187-1. [DOI] [PubMed] [Google Scholar]

[b7] 7.Burrells C, Reid HW. Phenotypic analysis of lymphoblastoid cell lines derived from cattle and deer affected with sheep-associated malignant catarrhal fever. Vet Immunol Immunopathol. 1991;29:151–61. doi: 10.1016/0165-2427(91)90060-p. [DOI] [PubMed] [Google Scholar]

[b8] 8.Jung JU, Desrosiers RC. Herpesvirus saimiri and ateles. In: Webster R, Granoff A, editors. The Encyclopedia of Virology. London: Academic Press; 1994. pp. 614–23. [Google Scholar]

[b9] 9.Medveczky MM, Geck P, Sullivan JL, Serbousek D, Djeu JY, Medveczky PG. IL-2 independent growth and cytotoxicity of herpesvirus saimiri-infected human CD8 cells and involvement of two open reading frame sequences of the virus. Virology. 1993;196:402–12. doi: 10.1006/viro.1993.1495. 10.1006/viro.1993.1495. [DOI] [PubMed] [Google Scholar]

[b10] 10.Collette Y, Olive D. Non-receptor protein tyrosine kinases as immune targets of viruses. Immunol Today. 1997;18:393–400. doi: 10.1016/s0167-5699(97)01104-3. 10.1016/s0167-5699(97)01104-3. [DOI] [PubMed] [Google Scholar]

[b11] 11.Miller CL, Burkhardt AL, Lee JH, Stealey B, Longnecker R, Bolen JB, Kieff E. Integral membrane protein 2 of Epstein-Barr virus regulates reactivation from latency through dominant negative effects on protein-tyrosine kinases. Immunity. 1995;2:155–66. doi: 10.1016/s1074-7613(95)80040-9. [DOI] [PubMed] [Google Scholar]

[b12] 12.Biesinger B, Tsygankov AY, Fickenscher H, Emmrich F, Fleckenstein B, Bolen JB, Broker BM. The product of the Herpesvirus saimiri open reading frame 1 (tip) interacts with T cell-specific kinase p561ck in transformed cells. J Biol Chem. 1995;270:4729–34. doi: 10.1074/jbc.270.9.4729. [DOI] [PubMed] [Google Scholar]

[b13] 13.Jung JU, Desrosiers RC. Association of the viral oncoprotein STP-C488 with cellular ras. Mol Cell Biol. 1995;15:6506–11. doi: 10.1128/mcb.15.12.6506. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b14] 14.Qian D, Weiss A. T cell antigen receptor signal transduction. Curr Opin Cell Biol. 1997;9:205–12. doi: 10.1016/s0955-0674(97)80064-6. [DOI] [PubMed] [Google Scholar]

[b15] 15.Van Leeuwen JEM, Samelson LE. T cell antigen-receptor signal transduction. Curr Opin Immunol. 1999;11:242–8. doi: 10.1016/s0952-7915(99)80040-5. 10.1016/s0952-7915(99)80040-5. [DOI] [PubMed] [Google Scholar]

[b16] 16.Ensser A, Pflantz R, Fleckenstein B. Primary structure of the alcelaphine herpesvirus 1 genome. J Virol. 1997;71:6517–25. doi: 10.1128/jvi.71.9.6517-6525.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b17] 17.Plowright W, Herniman KA, Jesset DM, Kalunda M, Rampton CS. Immunisation of cattle against the herpesvirus of malignant catarrhal fever: failure of inactivated culture vaccines with adjuvant. Res Vet Sci. 1975;19:159–66. [PubMed] [Google Scholar]

[b18] 18.Reid HW, Pow I, Buxton D. Antibody to alcelaphine herpesvirus-1 (AHV-1) in hamsters experimentally infected with AHV-1 and the ‘sheep-associated’ agent of malignant catarrhal fever. Res Vet Sci. 1989;47:383–6. [PubMed] [Google Scholar]

[b19] 19.Baxter SIF, Pow I, Bridgen A, Reid HW. PCR detection of the sheep-associated agent of malignant catarrhal fever. Arch Virol. 1993;132:145–59. doi: 10.1007/BF01309849. [DOI] [PubMed] [Google Scholar]

[b20] 20.Haig DM, Hutchison G, Thomson J, Yirrell D, Reid HW. Cytotolytic activity and associated serine protease expression by skin and afferent lymph CD8 T cells during orf virus reinfection. J Gen Virol. 1996;77:953–60. doi: 10.1099/0022-1317-77-5-953. [DOI] [PubMed] [Google Scholar]

[b21] 21.Griffiths GM, Mueller C. Expression of perforin and granzymes in vivo: potential diagnostic markers for activated cytotoxic cells. Immunol Today. 1991;12:415–9. doi: 10.1016/0167-5699(91)90145-J. [DOI] [PubMed] [Google Scholar]

[b22] 22.Cook CG, Splitter CA. Lytic function of bovine lymphokine-activated killer cells from a normal and a malignant catarrhal fever virus-infected animal. Vet Immunol Immunopathol. 1988;19:105–18. doi: 10.1016/0165-2427(88)90002-5. [DOI] [PubMed] [Google Scholar]

[b23] 23.Rabinowich H, Manciulea M, Metes D, Sulica A, Herberman RB, Corey SJ, Whiteside TL. Physical and functional association of Fc mu receptor on human natural killer cells with zeta- and Fc epsilon R1 gamma chains and with src family protein tyrosine kinases. J Immunol. 1996;157:1485–91. [PubMed] [Google Scholar]

[b24] 24.Brumbaugh KM, Binstadt BA, Billadeau DD, Schoon RA, Ten Dick CJ, Leibson PJ. Functional role for syk tyrosine kinase in natural killer cell-mediated natural cytotoxicity. J Exp Med. 1997;186:1965–72. doi: 10.1084/jem.186.12.1965. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b25] 25.Abraham RT. mammalian target of rapamycin: immunosuppressive drugs uncover a novel pathway of cytokine receptor signalling. Curr Opin Immunol. 1998;10:330–6. doi: 10.1016/s0952-7915(98)80172-6. [DOI] [PubMed] [Google Scholar]

[b26] 26.Noraz N, Saha K, Ottones F, Smith S, Taylor N. Cutting Edge: Constitutive activation of TCR signalling molecules in IL-2-independent herpesvirus saimiri-transformed T cells. J Immunol. 1998;160:2042–5. [PubMed] [Google Scholar]

[b27] 27.Cloutier JF, Veillette A. Co-operative inhibition of T-cell antigen receptor signalling by a complex between a kinase and a phosphatase. J Exp Med. 1999;189:111–21. doi: 10.1084/jem.189.1.111. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b28] 28.Thomas ML. The regulation of antigen-receptor signalling by protein tyrosine phosphatases: a hole in the story. Curr Opin Immunol. 1999;11:270–6. doi: 10.1016/s0952-7915(99)80044-2. 10.1016/s0952-7915(99)80044-2. [DOI] [PubMed] [Google Scholar]

[b29] 29.Arpaia E, Shahar M, Dadi H, Cohen A, Roifman CM. Defective T cell receptor signalling and CD8+ thymic selection in humans lacking Zap-70 kinase. Cell. 1994;76:947–58. doi: 10.1016/0092-8674(94)90368-9. [DOI] [PubMed] [Google Scholar]

[b30] 30.Gelfand EW, Weinberg K, Mazer BD, Kadlecek TA, Weiss A. Absence of Zap-70 prevents signalling through the antigen receptor on peripheral blood T cells but not on thymocytes. J Exp Med. 1995;182:1057–65. doi: 10.1084/jem.182.4.1057. [DOI] [PMC free article] [PubMed] [Google Scholar]

[b31] 31.Schwartz MA, Baron V. Interactions between mitogenic stimuli, or, a thousand and one connections. Curr Opin Immunol. 1999;11:197–202. doi: 10.1016/s0955-0674(99)80026-x. [DOI] [PubMed] [Google Scholar]

PERMALINK

Constitutive activation of Lck and Fyn tyrosine kinases in large granular lymphocytes infected with the γ-herpesvirus agents of malignant catarrhal fever

S Swa

H Wright

J Thomson

H Reid

D Haig

Abstract

Introduction