Skip to main content
PMC home page
Immunology logoLink to Immunology
. 2001 Nov;104(3):341–348. doi: 10.1046/j.1365-2567.2001.01317.x

All-trans-retinoic acid and polyriboinosinic : polyribocytidylic acid in combination potentiate specific antibody production and cell-mediated immunity

Kathleen L DeCicco *, John D Youngdahl *, A Catharine Ross †
PMCID: PMC1783315  PMID: 11722649

Abstract

Retinoic acid (RA), an active metabolite of vitamin A, may synergize with interferons (IFN) to evoke a heightened immune response, suggesting combination therapy as a promising treatment for various cancers. Recently, we demonstrated a strong synergism between RA and polyriboinosinic : polyribocytidylic acid (PIC), an inducer of IFN, on antibody production in immunocompromised vitamin A-deficient animals. In the present study, we examined whether this combination could potentiate T-cell-dependent antibody production in non-immunocompromised rats. Forty male Lewis rats were treated with 100 µg all-trans-RA, 20 µg PIC, or the combination in either an 11-d study to evaluate antibody production, changes in lymphocyte populations, and cell proliferation, or a 21-hr study to evaluate early changes in lymphocyte populations and gene expression. The combination of RA + PIC significantly potentiated anti-tetanus IgG levels (P < 0·002). Similarly, this combination also increased the numbers of B cells and major histocompatibility complex (MHC) class II+ cells in spleen and lymph nodes, and natural killer (NK) cells in spleen and blood (P < 0·05). RA + PIC-treated rats had significantly higher levels of interleukin (IL)-10, IL-12, and signal transducer and activator of transcription-1 (STAT-1) mRNA (P < 0·05), and STAT-1 protein (P < 0·02). Treatments administered in vivo significantly modulated T-cell proliferation to anti-CD3/phorbol myristyl acetate + IFN-α ex vivo. These changes in antibody production, cell distribution, cytokine gene expression, and T-cell proliferation suggest that the combination of RA + PIC stimulates humoral and cell-mediated immunity, and deserves further testing in models of cancer chemoprevention in vivo.

Introduction

Vitamin A, its principal active metabolite retinoic acid (RA), and related natural and synthetic retinoids have gained prominence for their therapeutic benefits in dermatological diseases and in cancer chemoprevention and therapy. Due to the widespread effects of retinoids on cell growth, differentiation, and gene regulation, they are potentially important modulators of the immune system, often with immunopotentiating actions.1 Retinoids have been shown to enhance thymocyte differentiation2 and activation to mitogens,3–5 and augment antibody production in normal intact animals6–8 and isolated cells.2–8 Many cell types express one or more isoforms of two subfamilies of nuclear retinoid receptors.9 The binding of retinoids to the receptor's ligand-binding domain induces conformational changes which enable the retinoic acid receptors (RAR/RXR) to bind productively to retinoic acid response elements (RARE) located in the promoter region of retinoid-responsive genes, leading to transcriptional activation, or sometimes repression. Members of the interferon (IFN) family of cytokines are produced in response to various stimuli including foreign cells, bacteria, and viral antigens, and serve as important regulators in numerous immunological processes.10,11 The two major classes of IFNs, type I (IFN-I, IFN-α and -β) and type II (IFN-γ), bind to distinct plasma membrane receptors which utilize similar but non-identical signal transduction pathways.11 Each of these pathways initiates sequential interactions and phosphorylation of members of the non-receptor Janus tyrosine kinase (Jak) family which phosphorylate and activate members of the signal transducers and activator of transcription (STAT) family of latent cytoplasmic proteins,12 rendering them competent to activate the promoter regions of overlapping but non-identical sets of IFN-responsive genes.10,12 The STAT-1 protein is common to signalling by both type I and type II IFNs.11,12 Studies in cultured cells have demonstrated the induction of STAT-1 gene expression by retinoids via the binding of RAR/RXR to a STAT-1 RARE.13,14 Other transcription factors implicated in mediating IFN actions include members of the IFN regulatory factor (IRF) family.15 It has been reported that, in vitro, all-trans-RA regulated the mRNA and protein expression of both IRF-1 and IRF-2, thereby promoting cellular responsiveness to IFN.16,17

Because of their similar and often synergistic interactions in inhibiting cell growth, tumorigenicity, and angiogenesis,18,19 there is now considerable interest in testing the combination of RA with type I IFN for its anticancer activity. Polyriboinosinic : polyribocytidylic acid (PIC), a synthetic double-stranded RNA, mimics some of the effects of RNA viruses and has shown beneficial effects on both cell-mediated and humoral immunity.20–23 Its principal mechanism of action is thought to be through induction of multiple forms of IFN, mainly IFN-α, although the full range of cytokines induced by PIC is not known.19 PIC is well tolerated,24,25 and has undergone limited testing in human clinical trials25–27 as well as more extensive studies in several animal models.28,29

We recently showed that in the immunocompromised state of vitamin A deficiency, the combination of RA and PIC significantly augmented humoral immunity and modulated cytokine-related gene expression.21 Anti-tetanus immunoglobulin G (IgG) responses were potentiated many-fold in vitamin A-depleted rats treated at the time of immunization with RA + PIC.21 However, vitamin A deficiency affects many systems, and it was unknown whether RA and PIC, individually or in combination, can stimulate immunity in normally fed animals. Therefore the main purpose of the present study was to examine treatment with these agents, separately and together, on T-cell dependent antibody production in normal animals. After observing a significant enhancement with regard to antibody production in rats treated with RA + PIC, we determined whether lymphocyte populations, T-cell proliferation and cytokine and transcription factor genes are modulated to elucidate possible mechanisms through which these compounds interact to stimulate immunity.

Materials and methods

Materials

All-trans-retinoic acid, phorbol myristyl acetate (PMA), Ficoll-Hypaque (1·083 g/ml), and general buffers and reagents were purchased from Sigma Chemical (St. Louis, MO). Polyriboinosinic acid: polyribocytidylic acid (PIC) stabilized with poly l-lysine and carboxymethylcellulose was kindly provided to us by Dr Hilton B. Levy, National Institutes of Health. Tetanus toxoid was obtained from Connaught Laboratories (Willowdale, Canada) and used for immunization exactly as described previously.21 For flow cytometry monoclonal antibodies labelled with fluoroscein isothiocyanate (FITC) or phycoerythrin (PE) were purchased from BD-PharMingen (San Diego, CA): FITC-anti-CD3ε, PE-anti-CD3ε, PE-anti-CD4, FITC-anti-CD45, FITC-anti-CD8α, FITC-anti-NKRP1, PE-anti-CD54, and PE-anti-RT1β. PE-anti-Igk (OX-12) was purchased from Serotec (Raleigh, NC). For Western blot analysis, mouse anti-rat STAT-1 (Transduction Laboratories/PharMingen, San Diego, CA) and peroxidase-linked anti-mouse IgG (Amersham Life Science, Piscataway, NJ) were used with a chemoluminescence detection system from Amersham. Cell culture medium (RPMI-1640) was from Flow Laboratories (McLean, VA) and certified fetal bovine serum from Gibco BRL (Gaithersburg, MD). Recombinant rat IFN-α/-β was from Access BioMedical Diagnostic Research Laboratories Inc. (LaJolla, CA).

Experimental design for animal experiments

Protocols were approved by the Institutional Animal Use and Care Committee of The Pennsylvania State University. Male Lewis rats (Charles River Laboratories, Wilmington, DE) obtained when 6 weeks old were maintained on a nutritionally complete purified diet.30 For the first study (11-day study), 16 rats were divided into four equal groups (n = 4/group designated control, RA, PIC, and RA + PIC). The mean initial body weight per group did not differ (control = 142·9 g; RA = 142·5 g; PIC = 142·6 g; RA + PIC = 142·8 g). Rats in the RA group and the RA + PIC group received 100 µg of all-trans-RA, dissolved in 20 µl canola oil (vehicle) by mouth; other groups received vehicle only. This treatment was repeated daily on days 1–9 of the study to mimic a continuous chemotherapeutic regimen. On day 1, rats in the groups treated with PIC received a single i.p. injection of 20 µg PIC in sterile saline (vehicle); this treatment was not repeated. On day 1, all four groups were immunized with 100 µg of tetanus toxoid in sterile saline. Eight additional non-immunized control rats (n = 2/group) were given the same treatments (vehicles, RA, PIC, or RA + PIC), but received no antigen to serve as controls. Blood and tissues (spleen, mesenteric lymph nodes, and thymus) were collected aseptically 10 days after immunization (day 11 of study).

In the second study (21-hr experiment), 16 rats were divided into four groups (n = 4), receiving vehicle, RA, PIC, or RA + PIC in same dosage as for the 11-day study. All-trans-RA was given on day 0 and day 1, PIC on day 1, and tetanus toxoid as antigen on day 1 to maintain the same conditions that were present at this time in the first study. Tissues were collected 21 hr after immunization and treatment with PIC and the second dose of RA. Because of the need to process a large number of fresh samples, animals in each of the experiments were treated in a randomized blocked design so that tissues from four animals (one per treatment group) were processed per day, until all tissues from rats had been collected over a 3-week period.

Antibody assay

The quantification of antitetanus IgG by enzyme-linked immunosorbent assay (ELISA) has been described previously.21,31 Serial plasma dilutions were performed to assure that measurements were in the linear dose–response range. A pooled serum standard prepared from tetanus toxoid-immunized rats21 was run on each ELISA plate and titres were determined relative to this standard. All points were plotted and calculated into units based on a standard curve where one unit was defined as the equivalent of a 1/10 000 dilution of standard serum for IgG.

Analysis of cytokine-related gene expression

Total RNA was extracted from spleen and reverse transcriptase–polymerase chain reaction (RT–PCR) and Southern blot analysis were used to measure the relative mRNA level of each cytokine-related gene, as described previously.21 The optimum PCR cycle number was determined for each cytokine as well as for β-actin which was used as a reference gene. Sense and antisense primers, amplicon length, and cycle number used for each gene were as reported previously,21 or as follows, BCL-2: sense, aagctgtcacagaggggcta/antisense, tgaagagttcctccaccacc, 343, 15, cyclin D1: sense, cgtggcctctaagatgaagg/antisense, ctggcattttggagaggaag, 185, 15, After Southern blot analysis, the relative intensities of the autoradiographic signals were quantified by scanning with an Eagle Eye densitometer followed by analysis with ONEdSCAN programs (Stratagene, La Jolla, CA), and normalized to the expression of β-actin mRNA21 before statistical analysis (below).

Tissue and cell isolation

All animals were individually euthanized by CO2 asphyxiation, weighed and tissues and heparinized blood were collected aseptically. Peripheral blood white blood cells were counted using 50 µl of whole blood added to 450 µl of Türks reagent (1% crystal violet in diluted acetic acid).32 Cells were isolated from spleen, thymus, and mesenteric lymph nodes and the resulting cell suspensions were passed through 105-µm sterile nylon mesh before being layered over Ficoll-Hypaque (1·083 g/ml) and centrifuged at 1000 g for 20 min at 20°. The mononuclear cells were removed, diluted with RPMI-1640 as wash medium, and centrifuged at 1000 g for 10 min at 4°. The pelleted cells were washed two additional times with RPMI-1640 as above, then resuspended in RPMI medium. Aliquots of these cells were counted in a haemocytometer and tested for viability by Trypan blue dye exclusion.21 Cells from blood, thymus, lymph node, and spleen were resuspended in RPMI containing 10% fetal bovine serum (FBS) at a concentration of 1 × 106 cells/ml.

Flow cytometry

The optimal dilutions of all purified monoclonal antibodies were determined beforehand by dose–response titration and defined as the dilution which provided optimal separation of stained and unstained cell peaks. Flow cytometry was performed using a FACScan flow cytometer (Becton Dickinson, San Jose, CA) in the Penn State Center for Qualitative Cell Analysis, as described elsewhere.33 Briefly, washed cells were added to U-shaped 96-well plates already containing monoclonal antibody diluted in 50 µl of 4° wash buffer (phosphate buffered saline (PBS)/0·1% NaN3/1% FBS). The cells were incubated at 4° in the dark for 30–40 min, centrifuged (350 g for 5 min), and washed twice with 100 µl of wash buffer. The samples were transferred to 1·5-ml vials containing 0·4 ml of 1% paraformaldehyde (diluted in 1 × PBS) as a fixative. Samples were stored at 4° for 1–3 days until analysed. Single-stained cells were used to determine the gate boundaries for each marker, and the size and fluorescence of dual-labelled (FITC and PE) control beads (Rainbow Brite beads, Spherotec Inc., Libertyville, IL) were analysed daily for compensation.

Western blot analysis

For each sample, 120 mg spleen tissue was homogenized in PBS (pH 7·4, 1% sodium dodecyl sulphate (SDS)), containing one complete mini protease inhibitor cocktail tablet (Roche; Boehringer Mannheim, Indianapolis, IN), followed by three rounds of sonication to further disrupt cells. Protein concentration was determined by the detergent compatible dye-binding protein assay (Bio-Rad, Hercules, CA). Protein, 20 µg, was dissolved in Laemmli sample buffer,34 boiled for 5 min, and loaded on a 8·5% SDS–polyacrylamide gel electrophoresis (PAGE) (Bio-Rad) for size fractionation. After electrophoresis, the proteins were electroblotted onto nitrocellulose membranes. For western blot analysis, mouse monoclonal antibody to rat STAT-1 and peroxidase-linked anti-mouse IgG were diluted 1 : 2000 and 1 : 3000, respectively, in TBS-T (Tris-buffered saline, pH 7·4, 0·1% Tween 20) containing 5% dry non-fat milk. TBS-T with 5% dry milk was used as a blocking agent. TBS-T was used for the washes after blocking, incubation with primary antibody, and after incubation with the secondary antibody. ECL detection solution and Hyperfilm ECL high performance chemiluminescence film (Amersham) was used to detect protein expression.

T-cell proliferation experiments

Mononuclear cells were extracted from blood, lymph nodes, thymus, and spleen tissue and resuspended to 1 × 106 cells/ml in mitogen medium (RPMI-1640, 0·1 µm 2-mercaptoethanol, 10 mg/l gentamicin, 5 mm glutamine, 5% heat-inactivated FBS). To assess CD3/PMA-induced stimulation (thymidine incorporation) in the absence and presence of type I IFN (IFN-α/-β, 1000 U/ml), quadruplicate samples (2 × 105 cells) from either normal rats, or those treated with RA, PIC, or both, were added to incubation plates in a crossover design. Plates were precoated with 2 µg/ml of unlabelled, azide-free anti-CD3ε overnight at 4°, followed by washing. A fraction of the plate was left uncoated to serve as a control. Additionally, 10 ng/ml PMA was added as a second stimulus to cells stimulated with anti-CD3. IFN-α/-β (1000 U/ml) was also added to some samples, as this concentration of type I IFN has been reported to prevent the death of activated T and B cells.35,36 The plates were incubated at 37° in a humidified 5% CO2 incubator for 48 hr. After 44 hr of incubation, 3H-thymidine (0·5 µCi/well) was added to each plate for the final 4 hr. Cells were harvested onto glass fibre filters, allowed to dry, and counted by liquid scintillation spectrometry. Data were expressed as mean corrected c.p.m. (experimental counts – background counts), and results of cultures with IFN-α/-β were reported as the percentage of cultures stimulated with anti-CD3ε/PMA only.

Statistical analysis

The effects of RA and PIC were first evaluated using two-way anova in a 2 × 2 design that comprised the four groups of rats in each study. Statistically significant main effects and interactions were subjected to post-hoc analysis (Tukey–Kramer test and least-squares means test); P < 0·05 in the least-squares means test was considered significant.

Results

Phenotypic characteristics of rats

During the 11-day experiment, in which RA or vehicle was administered daily by mouth and PIC and antigen were injected once, growth and final body weight did not differ between treatment groups (control = 225·2 g; RA = 227·4; PIC = 227·6; RA + PIC = 224·1). Additionally, peripheral blood white blood cell (WBC) counts were not statistically different, although there was a trend towards slightly reduced WBC counts in treated groups (control = 1·1 × 107, RA = 1·0 × 107, PIC = 1·0 × 107, RA + PIC = 8·2 × 106 cells/ml).

Antibody responses to tetanus toxoid immunization

The primary anti-tetanus IgG response was measured 10 days after immunization, the time of peak response as determined previously.28 Because our previous work had established that the effects of RA + PIC were similar on the primary and secondary anti-tetanus responses, the primary anti-tetanus IgG response was measured in the present 11-day study. Administration of either RA or PIC alone increased antitetanus IgG production almost twofold (Fig. 1) compared to the control group, but these differences were not statistically significant. However, the combination of RA + PIC in normal rats resulted in a greater than fourfold enhancement of the anti-tetanus IgG response (214 versus 47 units/ml, RA + PIC versus control group, P < 0·002).

Figure 1.

Figure 1

Open in a new tab

The anti-tetanus IgG primary response is elevated in rats treated with retinoic acid (RA) and polyinosinic:polycytidylic acid (PIC). Male Lewis rats were treated with RA daily for 10 days, beginning 1 day prior to immunization, or once with PIC at the time of immunization. Data shown are the means±SEM (n = 4/group) of the primary antibody response measured 10 days after immunization; 1 U IgG is defined as equivalent to a 1 : 10 000 dilution of an antitetanus antiserum standard.21 Treatment groups with different letters differed, P ≤ 0·002 (least-squares means test).

Lymphocyte surface marker expression

In order to determine whether treatments with RA and/or PIC altered certain cell populations, flow cytometry was conducted in the 21-hr and 11-day study to assess the proportions of B cells, major histocompatibility complex (MHC) class II-positive cells, T cells, and natural killer (NK) cells. As noted above, total WBC counts did not differ significantly. Treatments with RA, PIC or the combination did not alter T-cell markers in the thymus (data not shown). However, within 21 hr of treatment with PIC, or RA + PIC, there was a significant reduction in the percentage of blood of cells expressing CD3 (data not shown) and CD8: control, 14·0 ± 1·7%; RA, 15·1 ± 0·7%; PIC, 10·6 ± 0·4% (P < 0·05 versus control); and RA + PIC, 10·4 ± 1·1% (P < 0·05 versus control). CD4+ cells did not differ at this time. By day 11 after treatment in vivo, the percentage of CD4+ and CD8+ T cells in blood were increased significantly in the PIC + RA group (CD4+ T cells: control, 27·3 ± 0·7%, versus RA + PIC, 38·0 ± 2·0%, P < 0·05; CD8+ T cells: control, 9·5 ± 0·1% versus RA + PIC, 13·4 ± 0·8% (P < 0·05)).

Data for OX-12+ B cells, MHC class II-positive cells, and NK cells are illustrated in Fig. 2. In blood, OX-12+ (kappa light chain-positive) B cells were reduced in rats treated with PIC or RA + PIC compared to the control group. Conversely, in lymph node and spleen, treatments with PIC (lymph node), or PIC or RA + PIC (spleen), resulted in a greater proportion of B cells in both of these tissues (P < 0·05, Fig. 2a). Results were similar for both the 21-hr and the 11-day times, and therefore are shown in Fig. 2 only for the 11-day experiment. Representative histograms are illustrated for these tissues for control and RA + PIC groups. RT-1β (MHC-II), expressed on antigen presenting cells (B cells, macrophages, and dendritic cells), showed a pattern similar to B cells, being lower in the blood from PIC and RA + PIC-treated rats, and significantly increased in lymph node and spleen from the same treatment groups (Fig. 2b).

Figure 2.

Figure 2

Open in a new tab

Combined treatment with retinoic acid (RA) and polyinosinic:polycytidylic acid (PIC) alters the distribution of B cells, MHC class-II-expressing cells, and NK cells. Cells from control, RA, PIC and RA + PIC-treated Lewis rats in the 11-day study were isolated from blood, lymph node, or spleen and incubated in the presence of monoclonal antibodies for FITC-CD45 (leucocyte common antigen WBC marker) and PE-OX-12 (B-cell marker, expressed as percentage of WBC) (a, CD45+OX12+ cells), or RT1β (MHC Class II,% of WBC) (b, RT1β+ CD45+ cells), or with FITC-NKRP1A (NK cell marker) and PE-CD3 (T cell marker) (c, NKRP1+ CD3– cells, % of WBC). The mean values±SEM for n = 4 rats/group are reported. Representative flow histograms are depicted in Fig. 2(a) to illustrate differences in OX-12 expression (quadrant 2) between the control and RA + PIC treated rats. An asterisk (*) denotes groups that differ significantly from the control group, P = 0·05.

The NK cell marker NKR-P1A was measured to determine if treatments altered the number of NK cells, known to be induced by PIC. In the 11-d experiment (Fig. 2c) NKR-P1A+ cells were increased by treatment with RA + PIC in the spleen (P < 0·05), and by treatment with PIC or RA + PIC in blood (P < 0·05). A similar pattern was observed in the 21-hr experiment (data not shown).

Gene expression of molecular and immunological factors

Because the cooperativity between RA and PIC on antibody levels was in response to a T-cell dependent antigen, we examined the expression of mRNAs for target genes in spleen that have been associated with the activation, expansion, survival, and/or signal transduction of T cells. These genes included cytokines (interleukin (IL)-2, IFN-γ, IL-10, IL-12, IL-15), cytokine receptors (IL-2Rα, IL-2Rβ), transcription factors (STAT-1, IRF-1, IRF-2), and cell cycle (cyclin D1) or survival (Bcl-2) proteins. For many of the genes analysed, treatment with RA or PIC alone or in combination had no effect on the level of mRNA. These included IL-15; IL-2Rα and IL-2Rβ; IRF-1 and IRF-2; and cyclin D1 and bcl-2. However, expression of IFN-γ mRNA was significantly increased by RA alone (P < 0·02, data not shown) but not by other treatments, whereas for IL-10 and IL-12 mRNA, expression was increased by PIC (P < 0·05) (Fig. 3a, b). The transcription factor STAT-1 was also elevated (P < 0·02) in rats treated with PIC with or without RA (Fig. 3c). To confirm STAT-1 differences at the protein level, western blots were performed. STAT-1 protein levels agreed well with STAT-1 mRNA expression (Fig. 3d), with elevated STAT-1 protein in PIC-treated groups (P < 0·02), but no further enhancement upon treatment with RA + PIC.

Figure 3.

Figure 3

Open in a new tab

The expression of cytokine and signal transduction genes is altered in spleen of rats treated in vivo with retinoic acid (RA) and polyinosinic:polycytidylic acid (PIC). Total RNA was extracted from individual spleens and RT–PCR, followed by Southern blot analysis, was performed on individual samples using (a) IL-10 (b) IL-12p40, or (c) STAT-1 specific probes, or (d) by Western blot analysis of STAT-1 protein. (a–c) The mean values±SEM of n = 4 individual animals/treatment are portrayed graphically, and Southern blots from pooled samples from each treatment are displayed pictorially. Different letters over bars indicate results that differed significantly (P ≤ 0·05), while bars with the same superscript were not different. (d) Total protein (20 µg) from rat splenocytes of untreated control rats (lanes 1–3), or rats treated with RA (lanes 4–6), PIC (lanes 7–9), or RA + PIC (lanes 10–12) was subjected to electrophoresis and electroblotting onto nitrocellulose, followed by incubation with a monoclonal antibody for STAT-1. After development (see Materials and Methods), densitometry was performed and results were calculated based on the sum of the p91 and p84 STAT-1 isoforms,12 with average values ± SEM (n = 3) for each treatment being graphically displayed. Treatment groups with different letters differed significantly (P < 0·02).

Cell proliferation

Cells from rats treated in vivo with RA, PIC or the combination were cultured ex vivo for 2 days in the presence of anti-CD3/PMA, with and without type I IFN (IFN-α/-β). In the absence of IFN, all cells showed significant thymidine incorporation, but differences between treatment groups were non-significant. However, when cultured in the presence of type I IFN, thymidine incorporation was significantly enhanced relative to the same cells without IFN in cells from rats that had been treated in vivo with RA + PIC (Fig. 4). For spleen cells, thymidine incorporation was ∼350% greater in cells from rats treated in vivo with the combination of RA + PIC compared to controls, or RA or PIC alone (P < 0·0001). A similar pattern was obtained with peripheral blood cells (∼410% greater response in RA + PIC group compared to control, RA or PIC alone (P < 0·0001), and to a lesser extent for thymocytes (P < 0·03). These results suggest that RA + PIC in vivo may be acting to increase the response of T cells to antigenic stimulation, or to prolong T-cell survival after stimulation.

Figure 4.

Figure 4

Open in a new tab

Type I interferon (IFN-I) in vitro enhances the T-cell proliferative response of cells from Lewis rats treated in vivo with retinoic acid (RA) and polyinosinic: polycytidylic acid (PIC). Cells from the 11-day study from spleen, blood, and thymus were stimulated with anti-CD3/phorbol myristyl acetate (PMA) plus IFN-α/-β. Cells (2 × 105) were cultured in triplicate in anti-CD3-coated wells with 10 ng/ml PMA in the presence of 1000 U/ml of IFN-α/-β for 48 hr; 3H-thymidine was added during the final 4 hr of incubation. The thymidine incorporation response to CD3/PMA in the absence of IFN-I did not differ among treatment groups (not shown), and the results with IFN-I are expressed in comparison to the same cultures in the absence of IFN-I (each defined as 100%). Treatment groups marked with an asterisk were statistically different from control cells (P ≤ 0·03, least-squares means test). Data shown are the mean±SEM from n = 4 rats/treatment. An asterisk (*) denotes groups that differ significantly from the control group, P = 0·05.

Discussion

Both retinoids and IFNs have shown utility as single agents in treating cancers, autoimmune diseases, and infections, but their use is often limited by significant side-effects. However, a growing body of evidence now supports the potential for using these two agents in combination due to their additive or synergistic effects on inducing cell differentiation, while inhibiting tumour size, growth, and angiogenesis.37–40 Nonetheless there is still little known of their combined effects on the immune system, and thus our main objective was to examine whether RA and PIC, separately and in combination, might potentiate antibody production and related immune functions. Previous work has shown a strong synergy between RA and PIC in severely immunocompromised vitamin A-deficient animals.21,22 But because vitamin A deficiency affects multiple systems, we could not infer that the combination of RA and PIC would potentiate responses in a state of normal nutrition. In the present study we evaluated vitamin A-adequate animals to test whether the combination of RA and PIC could potentiate specific immunity during a normal, non-immunocompromised state. The first parameter we measured was the T-cell dependent antibody response to tetanus toxoid. Whereas administration of RA alone or PIC alone produced no significant effect on anti-tetanus IgG, the combination resulted in a fourfold enhancement compared to the control group (Fig. 1). We reasoned that several possible factors might account for this elevation in a T-cell dependent antibody response. Because previous studies had revealed significant effects of vitamin A nutritional status or treatment with RA and/or PIC on lymphocyte cell populations,41 T-cell responses,42 and the expression of genes for IL-12, IL-10 and STAT-1,21 our further analysis focused on these factors, while including several other molecular factors (cytokines and transcription factors) that provide signals for B- and T-cell activation or enhance the proliferation or survival of existing B or T cells. One possible explanation for enhanced T-cell dependent antibody production could be that treatments with RA and PIC alter lymphocyte populations, either through driving the production and differentiation of new cells, preventing the death of existing cells, or altering their distribution. In normal rats, the percentage of cells in secondary lymphoid organs (spleen and lymph node) expressing the B-cell marker OX-12 was significantly increased after treatment with RA + PIC (in spleen and lymph node), or PIC alone (in spleen), but not by RA alone. At the same time, the percentage of cells in peripheral blood was reduced after PIC treatment. Second, it is also possible that PIC induced changes in the surface properties of B cells, including MHC-II expression, as we observed to be increased in spleen and lymph node. This could result in increased migration or retention of B cells in lymphoid organs such as the germinal centre regions of secondary lymphoid follicles.43 Third, Lui and Janeway44 have proposed that agents such as PIC are capable of activating B cells to provide costimulatory signals for T helper (Th) cells, allowing them to expand clonally; these Th cells in turn may affect the growth of the B cells that activated them. Such a mechanism could possibly contribute to the increases in B cells in secondary lymphoid organs shown in Fig. 2.

Inflammatory cytokines and antigens are known to trigger the maturation of dendritic cells and their migration into the paracortex of lymph nodes and the periarteriolar lymphoid sheaths of spleen,45 where a high density of MHC-II and T-cell stimulatory molecules on lymphoid tissue-associated interdigitating dendritic cells is related to their ability to stimulate T cells.46 We observed increased MHC-II expression in spleen and lymph node of rats treated with PIC or RA + PIC, concomitant with a decrease in blood. Because both RA and PIC have been reported to affect NK cell numbers and function,41,47–49 NK cells were determined by flow cytometry in blood, spleen, and lymph node tissues. In PIC-treated rats, NK cells were increased significantly in blood, as anticipated, with a similar trend in spleen and lymph node for both the 21-hr and the 11-day times. However, RA alone at the dosage used had no effect in normally nourished animals, in contrast to an increase in NK cell number and cytotoxic activity when vitamin A-deficient rats were treated with RA.41,47

Several of the cytokine-related factors we examined in normal animals were unaffected by RA alone and were nearly equally induced by PIC and RA + PIC (Fig. 3). Thus, their induction does not explain the interaction observed on antibody production. The lack of a stronger effect of RA + PIC than for PIC alone is in contrast to the pattern observed in vitamin A-deficient rats, in which RA + PIC more often interacted.21 A possible explanation for this difference could be related to differences in the metabolism of RA, as catabolic mechanisms that normally control RA concentration are strongly down-regulated during vitamin A deficiency.50 It is possible that when RA is administered to vitamin A-deficient rats, it is rapidly absorbed and tissues are rapidly exposed to non-physiological concentrations of RA which are capable of inducing the transcription of genes that are not induced in normally fed animals which catabolize excess RA. It also should be noted that a lack of effect on gene expression in the spleen may not be indicative of responses in immune system organs. Immune responses to viral infections are often associated with extensive proliferation of T cells and B cells and enlargement of lymphoid tissues.51 In the present studies, T-cell proliferation was assessed in tissues from RA and PIC treated rats that were stimulated in vitro with anti-CD3/PMA in the absence and presence of type I IFN (IFN-I) because IFN-β has been described as a survival factor for activated T cells.35,52,53 In the presence of anti-CD3/PMA but the absence of IFN-I, ‘basal’ T-cell proliferation was not influenced by the previous in vivo history of the cells tested (not shown). However, thymidine incorporation was significantly greater in cells from rats that had been treated with RA + PIC in vivo, and were incubated in the presence of IFN in vitro (Fig. 4). Because all comparisons were made between paired cultures of the same cells the characteristics of responder cells at the outset of incubation can be ruled out as a variable. A possible explanation may be that treatment with the combination of RA + PIC in vivo induced the expression of cell surface receptors for IFN-I, enabling a survival response to IFN-I added in vitro. The factors controlling the survival of antigen-activated T and B cells are still highly controversial. Although IFN-I was previously shown to promote the survival of T and B cells35,36,54,55 through up-regulation of Bcl-2 and Bcl-xL survival factors, we did not observe differences in the expression of the genes for bcl-2 or cyclin D1 in spleen, and thus the underlying mechanism for these results has not been identified. It has been speculated that infectious agents elicit powerful immune responses by containing their own built-in adjuvants.55,56 By mimicking a viral infection, PIC may act like one of these infectious agents. It is probable that a mixture of cytokines induced by viral infections may protect activated T cells from death. Further research is needed to identify which of these pathways may be stimulated by RA + PIC.

In conclusion, the combination of all-trans-RA and PIC augmented T-cell dependent antibody responses in normally nourished, non-immunocompromised animals. Because this combination appears to serve as a general stimulator of the immune system, it should be evaluated further for possible beneficial effects in tumour models and other immunocompromised states.

Acknowledgments

We thank Elaine Kunze, Director of the Center for Quantitative Cell Analysis, for providing assistance with flow cytometry. Supported by NIH grant DK-41479, United States Department of Agriculture National Needs Fellowship (J.D.Y.), and funds from the Howard Heinz Endowment.

References

  • 1.Ross AC. Vitamin A and retinoids. In: Shils ME, Olson JA, Shike M, Ross AC, editors. Modern Nutrition in Health and Disease. 9. Baltimore: Williams & Wilkins; 1999. pp. 305–27. [Google Scholar]
  • 2.Yagi J, Uchida T, Kuroda K, Uchiquam T. Influence of retinoic acid on the differentiation pathway of T cells in the thymus. Cell Immunol. 1997;181:153–62. doi: 10.1006/cimm.1997.1203. [DOI] [PubMed] [Google Scholar]
  • 3.Abb J, Deinhardt F. Effects of retinoic acid on the human lymphocyte response to mitogens. Exp Cell Biol. 1980;48:169–79. doi: 10.1159/000162985. [DOI] [PubMed] [Google Scholar]
  • 4.Dillehay DL, Li W, Kalin J, Walia AS, Lamon EW. In vitro effects of retinoids on murine thymus-dependent and thymus-independent mitogenesis. Cell Immunol. 1987;107:130–7. doi: 10.1016/0008-8749(87)90273-5. [DOI] [PubMed] [Google Scholar]
  • 5.Valone FH, Payan DG. Potentiation of mitogen-induced human T-lymphocyte activation by retinoic acid. Cancer Res. 1985;45:4129–31. [PubMed] [Google Scholar]
  • 6.Wang W, Ballow M. The effects of retinoic acid on in vitro immunoglobulin synthesis by cord blood and adult peripheral blood mononuclear cells. Cell Immunol. 1993;148:291–300. doi: 10.1006/cimm.1993.1113. 10.1006/cimm.1993.1113. [DOI] [PubMed] [Google Scholar]
  • 7.Ballow M, Wang WP, Xiang SN. Modulation of B-cell immunoglobulin synthesis by retinoic acid. Clin Immunol Immunopathol. 1996;80:S73–81. doi: 10.1006/clin.1996.0144. [DOI] [PubMed] [Google Scholar]
  • 8.Ballow M, Xiang S, Wang W, Brodsky L. The effects of retinoic acid on immunoglobulin synthesis: role of interleukin 6. J Clin Immunol. 1996;16:171–9. doi: 10.1007/BF01540916. [DOI] [PubMed] [Google Scholar]
  • 9.Mangelsdorf DJ, Thummel C, Beato M, et al. The nuclear receptor superfamily: the second decade. Cell. 1995;83:835–9. doi: 10.1016/0092-8674(95)90199-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sen GC, Ransohoff RM. Interferon-induced antiviral actions and their regulation. Adv Virus Res. 1993;42:57–102. doi: 10.1016/s0065-3527(08)60083-4. [DOI] [PubMed] [Google Scholar]
  • 11.Williams BRG, Haque SJ. Interacting pathways of interferon signaling. Semin Oncol. 1997;24:S9–70–7. [PubMed] [Google Scholar]
  • 12.Darnell JE., Jr STATs and gene regulation. Science. 1997;277:1630–5. doi: 10.1126/science.277.5332.1630. 10.1126/science.277.5332.1630. [DOI] [PubMed] [Google Scholar]
  • 13.Matikainen S, Ronni T, Lehtonen A, Sareneva T, Melén K, Nordling S, Levy DE, Julkunen I. Retinoic acid induces signal transducer and activator of transcription (STAT) 1, STAT2, and p48 expression in myeloid leukemia cells and enhances their responsiveness to interferons. Cell Growth Differ. 1997;8:687–98. [PubMed] [Google Scholar]
  • 14.Weihua X, Kolla V, Kalvakolanu DV. Modulation of interferon action by retinoids – induction of murine STAT1 gene expression by retinoic acid. J Biol Chem. 1997;272:9742–8. doi: 10.1074/jbc.272.15.9742. [DOI] [PubMed] [Google Scholar]
  • 15.Harada H, Fujita T, Miyamoto M, Kimura Y, Maruyama M, Furia A, Miyata T, Taniguchi T. Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell. 1989;58:729–39. doi: 10.1016/0092-8674(89)90107-4. [DOI] [PubMed] [Google Scholar]
  • 16.Matikainen S, Ronni T, Hurme M, Pine R, Julkunen I. Retinoic acid activates interferon regulatory factor-1 gene expression in myeloid cells. Blood. 1996;88:114–23. [PubMed] [Google Scholar]
  • 17.Pelicano L, Li FS, Schindler C, Chelbi-Alix MK. Retinoic acid enhances the expression of interferon-induced proteins: evidence for multiple mechanisms of action. Oncogene. 1997;15:2349–59. doi: 10.1038/sj.onc.1201410. [DOI] [PubMed] [Google Scholar]
  • 18.Moore DM, Kalvakolanu DV, Lippman SM, Kavanagh JJ, Hong WK, Borden EC, Paredes-Espinoza M, Krakoff IH. Retinoic acid and interferon in human cancer: mechanistic and clinical studies. Semin Hematol. 1994;31:31–7. [PubMed] [Google Scholar]
  • 19.Bollag W, Majewski S, Jablonska S. Cancer combinational chemotherapy with retinoids: experimental rationale. Leukemia. 1994;8:1453–7. [PubMed] [Google Scholar]
  • 20.Manetti R, Annunziato F, Tomasevic L, Giannò V, Parronchi P, Romagnani S, Maggo E. Polyinosinic acid: polycytidylic acid promotes T helper type 1-specific immune responses by stimulating macrophage production of interferon-α and interleukin-12. Eur J Immunol. 1995;25:2656–60. doi: 10.1002/eji.1830250938. [DOI] [PubMed] [Google Scholar]
  • 21.DeCicco KL, Zolfaghari R, Li N-Q, Ross AC. Retinoic acid and polyriboinosinic acid act synergistically to enhance the antibody response to tetanus toxoid during vitamin A deficiency: possible involvement of interleukin-2 receptor beta, signal transducer and activator of transcription-1, and interferon regulatory factor-1. J Infect Dis. 2000;182:S29–36. doi: 10.1086/315908. [DOI] [PubMed] [Google Scholar]
  • 22.DeCicco KL, Ross AC. All-trans-retinoic acid and polyriboinosinic: polyribocytidylic acid cooperate to elevate anti-tetanus immunoglobulin G and immunoglobulin M responses in vitamin A-deficient Lewis rats and Balb/c mice. Proc Nutr Soc. 2000;59:1–11. doi: 10.1017/s0029665100000756. [DOI] [PubMed] [Google Scholar]
  • 23.Schmidt ME, Douglas SD. Effects of synthetic single- and multistranded polynucleotides on human monocyte IgG receptor activity in vitro. Proc Soc Exp Biol Med. 1976;151:376–9. doi: 10.3181/00379727-151-39214. [DOI] [PubMed] [Google Scholar]
  • 24.Hilleman MR. Prospects for the use of double-stranded ribonucleic acid (Poly I. C) inducers in man. J Infect Dis. 1970;121:196–211. doi: 10.1093/infdis/121.2.196. [DOI] [PubMed] [Google Scholar]
  • 25.Thompson KA, Strayer DR, Salvato PD, et al. Results of a double-blind placebo-controlled study of the double-stranded RNA drug polyI: polyC12U in the treatment of HIV infection. Eur J Clin Microbiol Infect Dis. 1996;15:580–7. doi: 10.1007/BF01709367. [DOI] [PubMed] [Google Scholar]
  • 26.Levine AS, Levy HB. Phase I-II trials of poly IC stabilized with poly-l-lysine. Cancer Treat Rep. 1978;62:1907–12. [PubMed] [Google Scholar]
  • 27.Ewel CH, Urba WJ, Kopp WC, et al. Polyinosinic-polycytidylic acid complexed with poly-l-lysine and carboxymethylcellulose in combination with interleukin-2 in patients with cancer: clinical and immunological effects. Cancer Res. 1992;52:3005–10. [PubMed] [Google Scholar]
  • 28.Puri SK, Dutta GP, Levy HB, Maheshwari RK. Poly ICLC inhibits Plasmodium cynomolgi B malaria infection in rhesus monkeys. J Interferon Cytokine Res. 1996;16:49–52. doi: 10.1089/jir.1996.16.49. [DOI] [PubMed] [Google Scholar]
  • 29.Wong JP, Saravolac EG, Sabuda D, Levy HB, Kende M. Prophylactic and therapeutic efficacies of poly (IC·LC) against respiratory influenza A virus infection in mice. Antimicrob Agents Chemother. 1995;39:2574–6. doi: 10.1128/aac.39.11.2574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Reeves PG, Nielsen FH, Fahey GC., Jr AIN-93 purified diets for laboratory rodents: Final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J Nutr. 1993;123:1939–51. doi: 10.1093/jn/123.11.1939. [DOI] [PubMed] [Google Scholar]
  • 31.Kinoshita M, Pasatiempo AMG, Taylor CE, Ross AC. Immunological memory to tetanus toxoid is established and maintained in the vitamin A-depleted rat. FASEB J. 1991;5:2473–81. doi: 10.1096/fasebj.5.10.2065894. [DOI] [PubMed] [Google Scholar]
  • 32.Mishell BB, Shiigi SM. Selected Methods in Cellular Immunology. New York: WH. Freeman; 1980. [Google Scholar]
  • 33.Dawson HD, Li NQ, DeCicco KL, Nibert JA, Ross AC. Chronic marginal vitamin A status reduces natural killer cell number and function in aging Lewis rats. J Nutr. 1999;129:1510–7. doi: 10.1093/jn/129.8.1510. [DOI] [PubMed] [Google Scholar]
  • 34.Sambrook J, Fritsch EF, Maniatis T. Molecular cloningA Laboratory Manual. 2. New York: Cold Spring Harbor Laboratory Press; 1989. [Google Scholar]
  • 35.Marrack P, Kappler J, Mitchell T. Type I interferons keep activated T cells alive. J Exp Med. 1999;189:521–9. doi: 10.1084/jem.189.3.521. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Su L, David M. Inhibition of B cell receptor-mediated apoptosis by IFN. J Immunol. 1999;162:6317–21. [PubMed] [Google Scholar]
  • 37.Lotan R, Dawson MI, Zou C-C, Jong L, Lotan D, Zou C-P. Enhanced efficacy of combinations of retinoic acid- and retinoid X receptor-selective retinoids and α-interferon in inhibition of cervical carcinoma cell proliferation. Cancer Res. 1995;55:232–6. [PubMed] [Google Scholar]
  • 38.Lippman SM, Lotan R, Schleuniger U. Retinoid-interferon therapy of solid tumors. Int J Cancer. 1997;70:481–3. doi: 10.1002/(sici)1097-0215(19970207)70:4<481::aid-ijc20>3.0.co;2-h. 10.1002/(sici)1097-0215(19970207)70:4<481::aid-ijc20>3.0.co;2-h. [DOI] [PubMed] [Google Scholar]
  • 39.Lotan R, Clifford JL, Lippman SM. Retinoids and interferons: combination studies in human cancer. In: Livrea AM, editor. Vitamin A and Retinoids: an Update of Biological Aspects and Clinical Applications. Basel: Birkhäuser Verlag; 2000. pp. 221–30. [Google Scholar]
  • 40.Majewski S, Szmurlo A, Marczak M, Jablonska S, Bollag W. Synergistic effect of retinoids and interferon α on tumor-induced angiogenesis: anti-angiogenic effect on HPV-harboring tumor-cell lines. Int J Cancer. 1994;57:81–5. doi: 10.1002/ijc.2910570115. [DOI] [PubMed] [Google Scholar]
  • 41.Zhao Z, Ross AC. Retinoic acid repletion restores the number of leukocytes and their subsets and stimulates natural cytotoxicity in vitamin A-deficient rats. J Nutr. 1995;125:2064–73. doi: 10.1093/jn/125.8.2064. [DOI] [PubMed] [Google Scholar]
  • 42.Dawson HD, Ross AC. Chronic marginal vitamin A status affects the distribution and function of T cells and natural T calls in aging Lewis rats. J Nutr. 1999;129:1782–90. doi: 10.1093/jn/129.10.1782. [DOI] [PubMed] [Google Scholar]
  • 43.Li L, Zhang X, Kovacic S, Long AJ, Bourque K, Wood CR, Choi YS. Identification of a human follicular dendritic cell molecule that stimulates germinal center B cell growth. J Exp Med. 2000;191:1077–83. doi: 10.1084/jem.191.6.1077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Liu Y, Janeway CA., Jr Microbial induction of co-stimulatory activity for CD4 T-cell growth. Int Immunol. 1991;3:323–32. doi: 10.1093/intimm/3.4.323. [DOI] [PubMed] [Google Scholar]
  • 45.Johansson B, Ingvarsson S, Björck P, Borrebaeck CAK. Human interdigitating dendritic cells induce isotype switching and IL-13-dependent IgM production in CD40-activated naive B cells. J Immunol. 2000;164:1847–54. doi: 10.4049/jimmunol.164.4.1847. [DOI] [PubMed] [Google Scholar]
  • 46.Banchereau J, Steinman RM. Dendritic cells and the control of immunity. Nature. 1998;392:245–8. doi: 10.1038/32588. 10.1038/32588. [DOI] [PubMed] [Google Scholar]
  • 47.Zhao Z, Murasko DM, Ross AC. The role of vitamin A in natural killer cell cytotoxicity, number and activation in the rat. Natur Immun. 1994;13:29–41. [PubMed] [Google Scholar]
  • 48.Cantorna MT, Nashold FE, Hayes CE. Vitamin A deficiency results in a priming environment conducive for Th1 cell development. Eur J Immunol. 1995;25:1673–9. doi: 10.1002/eji.1830250629. [DOI] [PubMed] [Google Scholar]
  • 49.Carman JA, Hayes CE. Abnormal regulation of IFN-γ secretion in vitamin A deficiency. J Immunol. 1991;147:1247–52. [PubMed] [Google Scholar]
  • 50.Yamamoto Y, Zolfaghari R, Ross AC. Regulation of CYP26 (Cytochrome P450RAI) mRNA expression and retinoic acid metabolism by retinoids and dietary vitamin A in liver of mice and rats. FASEB J. 2000;14:2119–27. doi: 10.1096/fj.00-0061com. [DOI] [PubMed] [Google Scholar]
  • 51.Tough DF, Sprent J. Bystander stimulation of T cells in vivo by cytokines. Vet Immunol Immunopathol. 1998;63:123–9. doi: 10.1016/s0165-2427(98)00088-9. [DOI] [PubMed] [Google Scholar]
  • 52.Vella AT, Dow S, Potter TA, Kappler J, Marrack P. Cytokine-induced survival of activated T cells in vitro and in vivo. Proc Natl Acad Sci USA. 1998;95:3810–5. doi: 10.1073/pnas.95.7.3810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.Akbar AN, Lord JM, Salmon M. IFN-α and IFN-β: a link between immune memory and chronic inflammation. Immunol Today. 2000;21:337–41. doi: 10.1016/s0167-5699(00)01652-2. 10.1016/s0167-5699(00)01652-2. [DOI] [PubMed] [Google Scholar]
  • 54.Mitchell T, Kappler J, Marrack P. Bystander virus infection prolongs activated T cell survival. J Immunol. 1999;162:4527–35. [PubMed] [Google Scholar]
  • 55.Gombert W, Borthwick NJ, Wallace DL, et al. Fibroblasts prevent apoptosis of IL-2-deprived T cells without inducing proliferation: a selective effect on Bcl-xL expression. Immunology. 1996;89:397–404. doi: 10.1046/j.1365-2567.1996.d01-759.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56.Medzhitov R, Janeway CA., Jr Innate immunity: impact on the adaptive immune response. Curr Opin Immunol. 1997;9:4–9. doi: 10.1016/s0952-7915(97)80152-5. [DOI] [PubMed] [Google Scholar]
  • 57.Maxwell JR, Weinberg A, Prell RA, Vella AT. Danger and OX40 receptor signaling synergize to enhance memory T cell survival by inhibiting peripheral deletion. J Immunol. 2000;164:107–12. doi: 10.4049/jimmunol.164.1.107. [DOI] [PubMed] [Google Scholar]

Articles from Immunology are provided here courtesy of British Society for Immunology

RESOURCES