A microtubule-binding Rho-GEF controls cell morphology during convergent extension of Xenopus laevis

SUMMARY

During Xenopus development, convergent extension movements mediated by cell intercalation drive axial elongation. While many genes required for convergent extension have been identified, little is known of regulation of the cytoskeleton during these cell movements. Although microtubules are required for convergent extension, this applies only to initial stages of gastrulation, between stages 10–10.5 (Lane and Keller, 1997).

To examine the cytoskeleton more directly during convergent extension, we visualized actin and microtubules simultaneously in live explants using spinning disk confocal fluorescence microscopy. Microtubule depolymerization by nocodazole inhibits lamellipodial protrusions and cell-cell contact, thereby inhibiting convergent extension. However, neither taxol nor vinblastine, both of which block microtubule dynamics while stabilizing a polymer form of tubulin, inhibits lamellipodia or convergent extension. This suggests an unusual explanation: the mass of polymerized tubulin, not dynamics of the microtubule cytoskeleton, is critical for convergent extension. Because microtubule depolymerization elicits striking effects on actin-based protrusions, the role of Rho-family GTPases was tested. The effects of nocodazole are partially rescued using dominant negative Rho, Rho-kinase inhibitor, or constitutively active Rac, suggesting that microtubules regulate small GTPases, possibly via a guanine-nucleotide exchange factor. We cloned full-length XLfc, a microtubule-binding Rho-GEF. Nucleotide exchange activity of XLfc is required for nocodazole-mediated inhibition of convergent extension; constitutively active XLfc recapitulates the effects of microtubule depolymerization. Morpholino knockdown of XLfc abrogates the ability of nocodazole to inhibit convergent extension. Therefore, we believe that XLfc is a crucial regulator of cell morphology during convergent extension, and microtubules limit its activity through binding to the lattice.

INTRODUCTION

Early vertebrate development depends on the coordination of inductive events and morphogenetic movements, driven by specific cell behaviors, which generate, from the spherical egg, a body axis extended in the anterior-posterior dimension. In Xenopus and likely all chordates, axial elongation is driven via mediolateral intercalation of cells toward the midline, resulting in anterior-posterior extension of the tissue as a whole. This set of movements is known collectively as convergent extension (Gerhart and Keller, 1986; Keller et al., 2000). The cellular processes underlying this behavior are best understood for the convergence of dorsal mesoderm toward the midline in Xenopus. During this process, cells establish a polarized morphology with active actin-based lamellipodial protrusions, pointing both toward and away from the midline. These protrusions exert force upon neighboring cells, and inhibition of convergent extension is often correlated with dysregulation of these protrusions. For example, perturbations of non-canonical Wnt signaling that inhibit convergent extension cause either defective or hyperactive protrusive behavior at the cellular level ((Wallingford et al., 2000); K.M.K, unpublished observations).

While the basis of convergent extension has been extensively addressed by classical observational studies, the molecular mechanisms underlying cell behaviors remain obscure. In particular, little is understood about the regulation and function of actin and microtubules during these cell movements. One striking observation suggesting a role for microtubules in convergent extension is the ability of the microtubule depolymerizing drug nocodazole to block mediolateral cell polarity (Lane and Keller, 1997). Exposure of embryos or explants to nocodazole from stage 10 to 19 (the beginning of gastrulation to the end of neurulation) inhibited convergent extension, however, nocodazole treatment from stage 10.5 to 19 (the first appearance of a fully circular blastopore to the end of neurulation) had no effect on the process. Therefore, the microtubule cytoskeleton appeared to be required for a very brief and specific period of time. After stage 10.5, microtubules appear to be dispensible, although there is little analysis of the cellular effects of microtubule depolymerization.

The effect of nocodazole on convergent extension is unlikely to be due to an effect on the cell cycle, since cell division is completely inhibited in the chordamesoderm during this period, as assayed by phosphohistone H3 staining (Saka and Smith, 2001). In fact, cell cycle blockade is actually necessary to allow the productive cell-cell contacts integral to convergent extension movements (Leise and Mueller, 2004).

We have followed the microtubule requirement to questions of how cell shape and dynamics change during convergent extension. Using spinning disk confocal microscopy, we have documented the microtubule requirement for actin assembly and dynamics. These studies have led to a surprising function for microtubules as a bulk regulator of Rho-family GTPases through a specific Rho-GEF. These results tie signaling to polymer assembly and indicate a direct role that microtubules may possess in regulating cell polarity.

MATERIALS AND METHODS

Xenopus Methods

Xenopus eggs were obtained from X. laevis frogs (NASCO or bred in our colony), fertilized in vitro, dejellied in 2% cysteine (pH 7.8), and cultured at 14–18° C in 0.1x Marc’s Modified Ringer’s (MMR) (Peng, 1991). Embryos were staged according to Nieuwkoop and Faber, 1967. For injection, embryos were placed in 0.1x MMR containing 5% Ficoll and 50 μg/ml gentamycin. Injected embryos were cultured in 0.1x MMR containing 50 μg/ml gentamycin at 14–18° C. For dorsal marginal zone (DMZ) explants, the two dorsal cells of a 4-cell embryo were injected equatorially. All injection amounts reported are per blastomere unless otherwise indicated.

DMZ explants for whole-mount analysis were dissected at stage 10 or 10.5 (as noted) and cultured in 0.5x MMR until stage 19. DMZ explants for confocal microscopy were dissected and cultured in 1x Danilchik’s For Amy (DFA) + bovine serum albumin (BSA) (Marsden and DeSimone, 2003), in chambered coverglasses (VWR) and secured below a separate coverslip using Lubriseal stopcock grease (Thomas Scientific). Chambered coverglasses and coverslips were coated overnight at 4° C with BSA (1% in water). Explants for confocal microscopy were oriented with the inner cells down (toward the objective on an inverted scope) and the epithelium up (away from the objective). Confocal imaging was performed on deep chordamesoderm cells.

Transfection of NIH3T3 cells; immunofluorescence of cells and explants

NIH3T3 cells were grown in DMEM + 10% calf serum. Cells were grown to 40–70% confluence for transfection with TransIT-LT1 transfection reagent (Mirus). Transfections were performed according to manufacturer’s protocol, using 3–6 μg DNA and 15 μl transfection reagent.

Cells and explants were fixed in methanol, permeabilized in Modified Barth’s Solution (MBS) (Peng, 1991) + 0.1% Triton X-100, and blocked in MBS + 0.1% Triton X-100 + 2% BSA. DM1α (monoclonal antibody to tubulin) was used at 1:1000, followed with appropriate secondary antibody. Explants were dehydrated, cleared in 2:1 benzyl benzoate:benzyl alcohol (BB:BA), and mounted for imaging. As methanol fixation destroys eGFP fluorescence, staining for eGFP-tagged constructs was performed using a polyclonal antibody to eGFP (Abcam 6556, 1:1000), followed with appropriate secondary antibody.

Imaging/Image analysis

Confocal images were acquired in the Nikon Imaging Center at Harvard Medical School using a Nikon TE2000U inverted microscope with a Perkin Elmer Ultraview Spinning Disk Confocal Head, Hamamatsu Orca-ER cooled CCD Camera and MetaMorph software (Universal Imaging).

Color images of whole explants and embryos were acquired using a Sony 3CCD Color Camera mounted on a Zeiss Stemi SV11 Stereoscope. Explant elongation was quantitated similar to Tahinci and Symes (2003) by measuring the length of the longest vector of each explant and the width of each explant at the point where the mesoderm extends from the neurectoderm. The length/width ratio was calculated for each explant. All images were acquired and measurements performed using Metamorph software (Universal Imaging). Data were analyzed using analysis of variance (ANOVA) and P-values determined using Tukey’s method.

RNAs/DNAs

Plasmid DNAs were linearized overnight and purified using the Qiagen PCR Purification Kit. RNAs were synthesized using the mMessage mMachine kit (Ambion) for capped RNA, purified using the Qiagen RNeasy Mini Kit, precipitated in ethanol, and resuspended in RNAse-free water.

Morpholino oligonucleotide experiments

Two morpholinos (GeneTools, LLC) were synthesized. MoXLfc (AGAAGAGGACTCAATCCGAGACATA) is complementary to XLfc and spans –1 to +24 of the coding sequence. MoCon, the control morpholino, is the same sequence as MoXLfc, only reversed (ATACAGAGCCTAACTCAGGAGAAGA). Morpholinos were resuspended and diluted in RNAse-free water.

Wobbled-XLfc (wXLfc) was created by altering as many nucleotides as possible in the sequence recognized by MoXLfc, while preserving the amino acid sequence (MSRIESSS). wXLfc has 9 nucleotide changes from wild type XLfc (ATGTCAAGAATAGAAAGCTCATCA; changes in bold). For rescue experiments, embryos were first injected in both cells of two-cell embryos with morpholino oligonucleotides, and subsequently injected at the 4-cell stage in the marginal zone of the two dorsal cells with wXLfc RNA.

RESULTS

Nocodazole inhibits active lamellipodial protrusions within a specific time period during convergent extension

Previously, Lane and Keller (1997) demonstrated that there is a specific period during which microtubules are required for convergent extension. Verifying these results, treatment of explants with the microtubule depolymerizing drug nocodazole (15 μg/ml) starting at stage 10 inhibits convergent extension, while treatment of explants with nocodazole starting at stage 10.5 has no effect on convergent extension (Figure 1A, B). In all figures, column graphs display quantitation of length/width ratios of explants pictured just prior. A higher length/width ratio indicates a greater degree of convergent extension movements. The extent of elongation in explants treated with nocodazole at stage 10.5 is significantly greater than in explants treated with nocodazole at stage 10 (P < 0.01).

Figure 1.

(A) Nocodazole inhibits convergent extension, but only when explants are treated before stage 10.5. (B) Length/width ratios of explants in (A). Data are from one representative experiment of three trials, analyzing 5–8 explants per sample per trial.

To determine the effects of microtubule depolymerization at the cellular level, actin and microtubules were imaged simultaneously in live explants. To visualize the complete microtubule lattice, we utilized eGFP-tau. To visualize the growing ends of microtubules, we utilized eGFP-CLIP-170, a microtubule plus-end binding protein. By coinjection of eGFP-tau (100 pg RNA) or eGFP-CLIP-170 (300 pg RNA) with rhodamine-labeled actin protein (15 ng), we could image either actin and the complete microtubule lattice or actin and microtubule plus-ends in living explants. Injections were targeted to the marginal zone of the two dorsal cells of the 4-cell embryo. At the appropriate stage, dorsal marginal zone explants were cut, secured between coverglasses, and imaged using spinning disk confocal microscopy.

As shown in Figure 2A, when visualized for rhodamine-actin, cells within the dorsal marginal zone exhibit one or two large flat lamellipodia extending from one cell to another. The lamellipodia are dynamic, extending and retracting (Supplemental Movie 1). Using eGFP-tau, the microtubule cytoskeleton is visualized as an extensive network (Figure 2B), which is also dynamic, as observed by timelapsed confocal microscopy visualizing eGFP-CLIP-170 (Figure 3A, Supplemental Movie 2). Within all cells, microtubules can be seen growing and shrinking; the polymers also bend and move (Supplemental Movie 3).

Figure 2.

Confocal microscopic analysis of chordamesoderm explants. (A, C, E, G, I, K, M, O, Q, S) Rhodamine-actin localization. (J) eGFP-CLIP-170 fluorescence. (B, D, F, H, L, N, P, R, T) eGFP-tau fluorescence. (A, B) Control explant. (C, D) Stage 10 explant: nocodazole treatment (15 μg/ml), phase 1. Note loss of lamellipodial protrusions. (E, F) Stage 10 explant: nocodazole treatment (15 μg/ml), phase 2. Note loss of cell-cell contact. (G, H) Stage 10.5 explant: nocodazole treatment (15 μg/ml). Note maintenance of lamellipodia although microtubules are depolymerized. (I, J) Taxol treatment (20 μg/ml) of stage 10 explant. Note maintenance of lamellipodia and stabilized microtubule cytoskeleton, as evidenced by uniform eGFP-CLIP-170 binding. (K, L) dn Rho (200 pg RNA) rescues lamellipodia inhibited by nocodazole (15 μg/ml). (M, N) Y-27632 (10 μM) rescues lamellipodia inhibited by nocodazole (15 μg/ml). (O, P) V12 Rac (25 pg DNA) overcomes the inhibition of lamellipodia by nocodazole (15 μg/ml). (Q, R) XLfc Y398A (2 ng RNA) rescues lamellipodia inhibited by nocodazole (15 μg/ml). (S, T) XLfc C55R (250 pg DNA) inhibits lamellipodial protrusions and cell-cell contact.

Figure 3.

Velocity of microtubule growth does not change between stage 10 and 10.5. (A) eGFP-CLIP-170 marks growing ends of microtubules in explants. (B) Velocities of microtubule growth in explants, either stage 10 or 10.5. Each point represents an individual microtubule tracked for at least 20 seconds.

Nocodazole treatment of cells fully depolymerizes the microtubule cytoskeleton, as assayed by fixation and antibody staining for microtubules (Lane and Keller, 1997). Individual microtubules are replaced by diffuse eGFP-tau fluorescence (Figure 2D, F). Cell morphology and actin-rich protrusions are also affected, in two time-dependent phases. In the first phase, active protrusions are inhibited; many fewer cells produce lamellipodia (Figure 2C). This becomes apparent within 15–30 minutes of nocodazole treatment. Prolonged nocodazole treatment produces a second phase of effects: cell-cell contacts are lost and cells look almost dissociated (Figure 2E). The onset of this phase varies between one and three hours after initial nocodazole treatment. These effects are unlikely to be due to a pharmacological side effect of nocodazole, as colcemid, a microtubule depolymerizing drug structurally unrelated to nocodazole, produces the same effects (data not shown).

The loss of cell-cell contacts may be a consequence of the loss of actin-based protrusions. Latrunculin B, a small molecule that induces actin depolymerization, causes rapid and severe loss of active protrusions and cell-cell contact, inhibiting convergent extension movements (Supplemental Figure 1). This, coupled with the significant delay in the loss of cell-cell contact relative to the inhibition of active protrusions following exposure to nocodazole, suggests that loss of cell-cell contact may be a secondary effect of microtubule depolymerization.

Microtubule structure, dynamics are equally sensitive to nocodazole after stage 10.5

Why are explants stage 10.5 or older insensitive to nocodazole? We tested whether there might be a large-scale change in the structure, stability, or dynamics of the microtubule cytoskeleton. For example, drug-resistant microtubules are seen in neurons and other cell types (Bulinski and Gundersen, 1991). As shown in Figure 2H, microtubules in explants stage 10.5–11 are depolymerized by nocodazole, as indicated by diffuse eGFP-tau fluorescence. Notably, lamellipodia are not inhibited by nocodazole or colcemid after stage 10.5, whereas they are before stage 10.5 (compare Figure 2G to Figure 2C, E).

Microtubule dynamics are not obviously different after stage 10.5. Velocity measurements of microtubule plus-end growth (using eGFP-CLIP-170, 300 pg RNA) reveal that dynamic growth is not significantly different before and after stage 10.5. In Figure 3B, each point represents the velocity of growth of a single microtubule, tracked for at least 20 seconds. Blue points are microtubules from stage 10 explants (37 microtubules from 8 cells in two explants), while red points are microtubules from stage 10.5 explants (34 microtubules from 7 cells in two explants). At stage 10, the average velocity of microtubule growth is 0.514 ± 0.042 μm/sec, while at stage 10.5, the average velocity is 0.486 ± 0.056 μm/sec; there is no significant change in velocity of growth. These data suggest that significant changes in the microtubule cytoskeleton or dynamics are not responsible for the change in the sensitivity of convergent extension to microtubule depolymerization. It should be noted, however, that these experiments have only monitored the velocity of microtubule growth, not disassembly, as eGFP-CLIP-170 marks only growing ends of microtubules. As a result, it is possible that there is a change in the velocity of microtubule disassembly, the proportion of microtubules undergoing shrinkage, or the fraction of stable microtubules. However, the similar growth characteristics of microtubules and continued sensitivity to nocodazole suggest that their intrinsic properties change little, if at all, between stages 10 and 10.5.

Microtubule mass is a critical factor in convergent extension

It has been reported that the microtubule stabilizing drug taxol has no effect on convergent extension movements (Lane and Keller, 1997). Although taxol stabilizes, rather than depolymerizes microtubules, it also interferes with dynamic functions of microtubules. We have confirmed the insensitivity to taxol, using continuous treatment of explants with taxol (20 μg/ml) from stage 10 to 19 (Figure 4A, B). Confocal microscopy reveals that unlike nocodazole, taxol has no effect on active protrusions or cell-cell contacts (Figure 2I). Taxol-stabilized microtubules bound eGFP-CLIP-170 uniformly, not just at their plus-ends, an indication that the microtubules are static (Figure 2J).

Figure 4.

Taxol and vinblastine do not inhibit convergent extension. (A) Morphology of explants treated with taxol. (B) Length/width ratios of explants in (A). (C) Tubulin staining (DM1α stin vinblastine-treated explants. Note crystalline arrays of tubulin in vinblastine-treated cells. (D) Morphology of explants treated with vinblastine. (E) Length/width ratios of explants in (D). Data are from one representative experiment of three trials (for each taxol and vinblastine), analyzing 6–7 explants per sample per trial.

Taxol treatment, while abolishing the dynamic properties of microtubules, leaves them structurally intact, allowing continued interaction with microtubule-associated proteins and vesicular trafficking via motor proteins. To distinguish the role of polymer mass independent of microtubule structure, we utilized another pharmacological inhibitor of microtubule dynamics, vinblastine. In mammalian cells, high concentrations of vinblastine completely convert microtubules into paracrystalline arrays of tubulin protofilaments, which have none of the biological features of microtubules that rely on their dynamics. As shown in Figure 4C, vinblastine (1 μM) induces paracrystalline arrays of tubulin in Xenopus explants, however, continuous exposure of explants to vinblastine from stage 10 to 19 does not significantly inhibit convergent extension (Figure 4D, E).

Although taxol and vinblastine inhibit microtubule dynamics, the stabilized microtubules or tubulin protofilaments are in a conformation to which microtubule-associated proteins can still bind; proteins that might bind to microtubules under normal conditions should still bind in the presence of either taxol or vinblastine. These data suggest that although there is a microtubule requirement at stage 10 for convergent extension, the requirement does not include the structure and dynamics of the microtubule array. Instead, the crucial microtubule requirement during convergent extension is protofilament mass.

The microtubule mass requirement can be rescued by dominant negative Rho and Rho-kinase inhibitor

The link between microtubules and actin has not been shown to be a direct physical one, which suggests a role of microtubules in regulating signaling or other activities. Small GTPases of the Rho family have long been demonstrated to regulate cell morphology and the actin cytoskeleton (Hall and Nobes, 2000). These small GTPases, including Rac, Rho, and Cdc42, cycle between an active, GTP-bound state, and an inactive, GDP-bound state. The nucleotide state of the GTPase is regulated intrinsically by the nucleotide hydrolysis activity of the GTPase, and extrinsically by factors such as guanine-nucleotide exchange factors (GEFs) and GTPase-activating proteins (GAPs). There is evidence that microtubule depolymerization can lead to the activation of certain Rho-family GTPases, which then induce changes in cell morphology (Etienne-Manneville and Hall, 2002). In HeLa cells, microtubule depolymerization induces cell retraction and formation of stress fibers, a phenotype characteristic of Rho activation (Krendel et al., 2002). Based on this, we tested the involvement of Rho in convergent extension.

We injected RNA encoding a dominant negative (dn) Rho mutant (N19) into the prospective dorsal marginal zone of the 4-cell embryo. We find that dn Rho (200 or 400 pg RNA) partially rescues the effects of nocodazole on convergent extension (Figure 5A, B). When treated with nocodazole (15 μg/ml), the extension of explants expressing dn Rho is statistically greater than of those not expressing dn Rho (P < 0.05). When dn Rho is coinjected with rhodamine-actin (15 ng) and eGFP-tau (100 pg RNA), confocal microscopy reveals that although microtubules in the explant remain depolymerized, dn Rho rescues the inhibition of lamellipodia caused by nocodazole (Figure 2K, L).

Figure 5.

Dominant negative Rho and Rho-kinase inhibitor partially rescue the effects of nocodazole on convergent extension. (A) Morphology of explants treated with nocodazole and expressing dn Rho. (B) Length/width ratios of explants in (A). * = P < 0.05, as calculated by Tukey’s method. (C) Morphology of explants treated with nocodazole and Rho-kinase inhibitor Y-27632. (D) Length/width ratios of explants in (C). * = P < 0.01, as calculated by Tukey’s method. Data are from one representative experiment of five trials (dn Rho), and three trials (Y-27632), analyzing 6–7 explants per sample per trial.

Since dn Rho rescues the inhibition of convergent extension by nocodazole, we tested the involvement of a downstream effector of Rho, Rho kinase, via the small molecule inhibitor Y-27632. Inhibition of Rho kinase (10 μM Y-27632) partially rescues the inhibition of convergent extension by nocodazole (Figure 5C, D). The extent of elongation in explants treated with both nocodazole and Y-27632 is significantly greater than the elongation of explants treated only with nocodazole (P < 0.01). Y-27632 also rescues the inhibition of lamellipodia by nocodazole, without affecting nocodazole-mediated microtubule depolymerization (Figure 2M, N).

These data suggest that activation of the small GTPase Rho, and subsequently its downstream effector Rho kinase, could be at least partially responsible for mediating the effects of microtubule depolymerization.

The microtubule depolymerization effects can be overcome by V12 Rac, but not V12 Cdc42

Because actin assembly and protrusive activity can be mediated by Rac and Cdc42, we asked whether the nocodazole-mediated inhibition of convergent extension could be overcome by activated forms of Rac (V12) or Cdc42 (V12). In mammalian cell culture, activated Rac induces the formation of lamellipodia, while activated Cdc42 induces the formation of filopodia (Nobes and Hall, 1995); these effects are recapitulated in Xenopus cells (Hens et al., 2002; Kwan and Kirschner, 2003). Therefore, active protrusions induced by these proteins might bypass the effects of microtubule depolymerization, thereby rescuing convergent extension movements.

V12 Rac (25 pg DNA) partially overcomes the inhibition of convergent extension by nocodazole (Figure 6A, B). The extent of elongation in explants expressing V12 Rac and treated with nocodazole (15 μg/ml) is significantly greater than the elongation of explants only treated with nocodazole (P < 0.05). Confocal microscopy reveals that active protrusions are restored, even though microtubules remain depolymerized (Figure 2O, P). It should be noted that higher amounts of V12 Rac (50–200 pg DNA) do not rescue convergent extension. Under these conditions, cells are unpolarized, displaying protrusive activity around the entire perimeter of the cells (data not shown). Such dysregulation of active protrusions has been shown to be sufficient to inhibit convergent extension (Wallingford et al., 2000). When V12 Cdc42 was tested for its ability to rescue convergent extension blocked by nocodazole, it was ineffective (Figure 6C, D). This was true over the entire range of DNA concentrations tested (25–100 pg DNA).

Figure 6.

Activated Rac, but not activated Cdc42, partially overcomes the effects of nocodazole on convergent extension. (A) Morphology of explants treated with nocodazole and expressing V12 Rac. (B) Length/width ratios of explants in (A). * = P < 0.05, as calculated by Tukey’s method. (C) Morphology of explants treated with nocodazole and expressing V12 Cdc42. (D) Length/width ratios of explants in (C). Data are from one representative experiment of three trials (V12 Rac), and two trials (V12 Cdc42), analyzing 6–7 explants per sample per trial.

These data suggest that induction of lamellipodia by V12 Rac, and not induction of filopodia by V12 Cdc42, is sufficient to overcome nocodazole-mediated inhibition of convergent extension.

Cloning and alignment of XLfc

We have shown that a sufficient mass of oligomerized or polymerized tubulin is critical for convergent extension, and that dn Rho, Rho kinase inhibition, and activated Rac can partially overcome the inhibition of convergent extension by nocodazole. This is reminiscent of a phenomenon reported in HeLa cells, where microtubule depolymerization induces cell retraction and formation of stress fibers downstream of Rho (Krendel et al., 2002). A microtubule-binding Rho-GEF, GEF-H1, was identified, which is inactivated by binding to microtubules. Microtubule depolymerization liberates GEF-H1, which activates Rho; Rho then induces cell retraction and stress fiber formation.

A small fragment of the Xenopus homolog of GEF-H1 had already been cloned (Morgan et al., 1999). Xenopus Lfc (XLfc, after the mouse homolog of GEF-H1, Lfc) was reported to be a zygotic transcript, with expression beginning at stage 9.5 (late blastula). In situ analysis demonstrated that XLfc is expressed in the ectoderm and mesoderm, with expression restricted to the neural ectoderm during neurula stages (Morgan et al., 1999). Since XLfc is expressed at the right time and place to be involved in convergent extension, we cloned the full-length gene to see if its activity is responsible for the effects induced by microtubule depolymerization.

Full-length XLfc is 981 amino acids (Figure 7A), with a predicted molecular weight of 131 kD. Like its mouse and human homologs, XLfc contains a C1/zinc-binding region near the N-terminus, which has been demonstrated to be required for microtubule binding (Krendel et al., 2002), as well as a Dbl-homology (DH) domain, responsible for nucleotide exchange activity, a pleckstrin-homology (PH) domain, and a coiled-coil (CC) region.

Figure 7.

XLfc alignment and localization. (A) Alignment of XLfc with homologs GEF-H1 (human) and Lfc (mouse). Yellow marks C1/zinc-binding domain, green marks Dbl homology (DH) domain, blue marks pleckstrin homology (PH) domain, and purple marks coiled-coil (CC) region. XLfc C55, marked with a red dot, is mutated to arginine for the non-microtubule binding constitutively active mutant. XLfc Y398, also marked with a red dot, is mutated to alanine for the catalytically dead dominant negative mutant. Numbers indicate percent identity between XLfc and its homologs. (B) eGFP-XLfc localizes to microtubules in NIH3T3 cells. Cells were transfected, fixed and stained for eGFP and tubulin. Inset: magnified view of colocalization of eGFP-XLfc (green) with microtubules (red). (C) eGFP-XLfc C55R does not localize to microtubules in NIH3T3 cells. Inset: magnified view of eGFP-XLfc C55R (green) and microtubules (red). Note cytoplasmic, non-filamentous localization of eGFP-XLfc C55R.

As localization of GEF-H1 and Lfc to microtubules is crucial for regulation of nucleotide exchange activity, the localization of XLfc was tested. NIH3T3 cells were transfected with eGFP-XLfc, fixed, and stained for eGFP and tubulin. In transfected cells, eGFP-XLfc colocalizes with microtubules (Figure 7B).

The effects of microtubule depolymerization are rescued by dominant negative XLfc and recapitulated by activated XLfc

To determine whether XLfc nucleotide exchange activity is required for the inhibition of convergent extension by microtubule depolymerization, we generated a dominant negative construct with a point mutant in the conserved QRITKY motif in the Dbl homology domain, the domain responsible for nucleotide exchange activity. Tyr 398 was converted to Ala; the analogous mutation in GEF-H1 abolishes nucleotide exchange activity in vitro (Krendel et al., 2002; Sterpetti et al., 1999). XLfc Y398A (1 or 2 ng RNA) partially rescues nocodazole-mediated inhibition of convergent extension (Figure 8A, B). The elongation of explants expressing XLfc Y398A and treated with nocodazole is significantly greater than elongation in explants only treated with nocodazole (P < 0.05). Confocal microscopy reveals that cell-cell contact and active protrusions are restored (Figure 2Q, R). These data suggest that XLfc nucleotide exchange activity is required for nocodazole to inhibit convergent extension. It should be noted that wild type XLfc, in contrast, has a weakly inhibitory effect on convergent extension on its own, and was not tested for its ability to rescue the effects of microtubule depolymerization on convergent extension (data not shown).

Figure 8.

XLfc nucleotide exchange activity is required for inhibition of convergent extension by nocodazole; constitutively active XLfc is sufficient to inhibit convergent extension. (A) Morphology of explants treated with nocodazole and expressing XLfc Y398A. (B) Length/width ratios of explants in (A). * = P < 0.05, as calculated by Tukey’s method. (C) Morphology of explants expressing XLfc C55R. (D) Length/width ratios of explants in (C). (E) Whole embryos expressing XLfc C55R display convergent extension defects. Data are from one representative experiment of three trials for both XLfc Y398A and XLfc C55R, analyzing 6–9 explants per sample per trial.

According to the current model for regulation of XLfc family members, sequestration by microtubules inhibits GEF activity; conversely, release from microtubules or the inability to bind microtubules results in high GEF activity (Krendel et al., 2002). In this case, a form of XLfc unable to bind microtubules should recapitulate the effects of nocodazole on convergent extension. Previously, a mutation in the GEF-H1 C1/zinc-binding region (C53R) was found to abolish microtubule localization in HeLa cells, and exhibit high GEF activity (Krendel et al., 2002). We made the analogous point mutant (C55R) and tested its ability to localize to microtubules in NIH3T3 cells. Unlike wild type XLfc, which localizes to microtubules, eGFP-XLfc C55R displays a diffuse cytoplasmic localization (Figure 7C), consistent with an inability to bind microtubules. XLfc C55R (175 and 250 pg DNA) inhibits convergent extension in the absence of nocodazole (Figure 8C, D). In contrast, wild type XLfc has only a weak inhibitory effect at similar concentrations (data not shown). Confocal microscopy reveals inhibition of lamellipodia and loss of cell-cell contact; however, the microtubule cytoskeleton is completely intact (Figure 2S, T). Whole embryos expressing XLfc C55R display defects in convergent extension (Figure 8E). This suggests that activation of XLfc is sufficient to inhibit lamellipodial protrusions, and, as a result, convergent extension. In effect, we have uncoupled the effects of microtubule depolymerization from the effects on lamellipodial protrusions.

Morpholino knockdown of XLfc diminishes the effects of microtubule depolymerization on convergent extension

While the dominant negative and constitutively active XLfc results argue that overexpression of altered forms of XLfc can affect convergent extension, we wanted to determine whether XLfc is required for the effects of nocodazole on convergent extension. Our hypothesis suggests that if XLfc is a major effector of microtubule depolymerization, knockdown of XLfc will block the ability of nocodazole to inhibit convergent extension. To test the requirement for XLfc in mediating the effects of nocodazole, we designed a translation-blocking morpholino against XLfc (MoXLfc); embryos were injected in both cells of the two-cell stage with morpholino oligonucleotides. Knockdown of XLfc diminishes the inhibition of convergent extension by nocodazole, in a dose-dependent manner (Figure 9A, B). A control morpholino (MoCon) with the same nucleotide composition as MoXLfc has no effect. Interestingly, knockdown of XLfc has no effect on convergent extension without the addition of nocodazole (see Discussion).

Figure 9.

Morpholino knockdown of XLfc diminishes the ability of nocodazole to inhibit convergent extension. (A) Morphology of explants treated with nocodazole and injected with morpholino against XLfc (MoXLfc) or control morpholino (MoCon). (B) Length/width ratios of explants in (A). * = P < 0.05, as calculated by Tukey’s method. (C) Length/width ratios of explants treated with nocodazole and injected with morpholinos and wobbled XLfc (wXLfc) rescue RNA. * = P < 0.01, as calculated by Tukey’s method. Data are from one representative experiment of four trials (morpholino knockdown), and two trials (wXLfc rescue), analyzing 6–7 explants per sample per trial.

To confirm the specificity of the morpholino effects, we designed a version of full-length XLfc not recognized by the morpholino; the amino acid sequence is conserved while the nucleotide sequence is altered. This version of XLfc is referred to as wobbled-XLfc (wXLfc). For these experiments, embryos were first injected at the two-cell stage with morpholinos. At the four-cell stage, embryos were injected in the dorsal marginal zone with wXLfc RNA. At these doses, expression of wXLfc alone has only modest effects on convergent extension (Figure 9C, compare panels I and III); because wXLfc has an intact microtubule-binding site, it is presumably buffered by microtubules. Expression of wXLfc restores, in a dose-dependent manner, the ability of nocodazole to inhibit convergent extension (Figure 9C, panel II). These data suggest that XLfc is a major endogenous effector of microtubule depolymerization during convergent extension.

DISCUSSION

During early development of Xenopus, convergent extension serves to narrow and lengthen the embryo along the anterior-posterior dimension. While many developmental genes regulating convergent extension have been identified, little is understood about the cell biological basis of these movements. Microtubules were previously shown to be required for convergent extension (Lane and Keller, 1997), although only for a specific time period. Microtubules are known to be involved in cell polarity, but in some cases (e.g. leukocyte chemotaxis), the actin cytoskeleton can support cell polarity without microtubules. In convergent extension, mediolateral cell polarity involves actin-based lamellipodial protrusions. Therefore, this system presents a novel developmental context in which to explore microtubule-actin crosstalk.

At the cellular level, there are two effects of microtubule depolymerization on convergent extension. Within 30 minutes of nocodazole addition, active protrusions cease; lamellipodia are inhibited. By one to three hours of nocodazole exposure, cell-cell contacts are inhibited. We hypothesize that loss of cell-cell contact is an indirect effect of having lost active protrusions, because of the time difference in effects, and also because targeting actin filaments directly (via latrunculin B) inhibits active protrusions and rapidly induces dissociation (Supplemental Figure 1). We therefore sought a connection between microtubule depolymerization and lamellipodial retraction that would occur within 30 minutes.

We have confirmed that there is an abrupt switch at stage 10.5, after which convergent extension is insensitive to microtubule depolymerization (Lane and Keller, 1997). This switch does not seem to correspond to changes in the structure or dynamics of the microtubule cytoskeleton (Figure 2G, H and Figure 3). It seemed unusual that convergent extension is not affected by either taxol or vinblastine, both of which impair filament organization and dynamics in mechanistically distinct ways from each other and from nocodazole. Taxol stabilizes microtubule polymers but completely blocks dynamics. Vinblastine completely dissolves microtubules, dissembling them into short protofilaments that aggregate into large paracrystals. Although normal microtubule functions are inhibited, both of these represent stabilized forms of tubulin polymer still capable of binding microtubule-associated proteins. The most likely explanation for the sensitivity of convergent extension to nocodazole and insensitivity to vinblastine and taxol is that it is not microtubule dynamics that are important, but simply the mass of assembled protofilaments.

Because of the effects of nocodazole on lamellipodial protrusions, we tested the role of Rho-family GTPases downstream of microtubule depolymerization. Inhibition of convergent extension by nocodazole can be partially rescued by dn Rho (N19), Rho-kinase inhibitor (Y-27632), or V12 Rac (Figure 5 and 6A, B). Confocal microscopy reveals that each of these factors restores lamellipodia, suggesting that microtubule depolymerization inhibits convergent extension via alterations of the actin cytoskeleton (Figure 2K-P). Similarly, it has been demonstrated that alterations of active protrusions are sufficient to inhibit convergent extension (Wallingford et al., 2000). It is worth mentioning that some of the factors tested here, such as Rho and Rho kinase, can, at high levels, inhibit convergent extension (Marlow et al., 2002; Tahinci and Symes, 2003). In the experiments reported here, we have used levels of dn Rho and Rho-kinase inhibitor 2-to 4-fold lower than the levels that inhibit convergent extension. There exists a continuum of effects that goes from no protrusive activity (convergent extension is blocked), to sufficient protrusive activity to maintain polarity (favoring convergent extension), to exuberant protrusive activity (polarity is lost and convergent extension is again blocked). For example, with V12 Rac, 25 pg DNA is sufficient to overcome the inhibition of convergent extension by nocodazole, but higher amounts (50–200 pg DNA) induce lamellipodia indiscriminately, in an unpolarized manner, and block convergent extension (data not shown). This suggests that whatever signals lead to cell polarization, directed motility can be blocked by inhibition of protrusive activity and also by excessive protrusive activity that occurs around the entire cell. This underscores the dynamic nature of the process; although many cell biological regulators are required for convergent extension, their levels and activity must be tightly regulated. It has been previously noted that the expression level of many regulators is crucial for convergent extension (Djiane et al., 2000; Wallingford et al., 2002).

Microtubule depolymerization in HeLa cells induces cell retraction and stress fiber formation, as a result of Rho activation. These effects can be accounted for by activation of the microtubule-binding Rho-GEF, GEF-H1 (Krendel et al., 2002). We have cloned the full-length Xenopus homolog of GEF-H1, XLfc (Figure 7A). Previously, a partial clone of XLfc was isolated (Morgan et al., 1999); in situ analysis revealed that XLfc is expressed at the right time and place to be involved in convergent extension. Dominant negative XLfc (Y398A), which lacks nucleotide exchange activity, partially rescues the effects of nocodazole on convergent extension (Figure 2Q,R and 8A, B), suggesting that nucleotide exchange activity of XLfc is required for microtubule depolymerization to inhibit convergent extension. Conversely, constitutively active XLfc (C55R), which does not localize to microtubules, is sufficient to inhibit convergent extension (Figure 8C-E), recapitulating the effects of microtubule depolymerization at the cellular level: inhibition of lamellipodia and loss of cell-cell contact (Figure 2S, T).

Though dominant negative and constitutively active forms of XLfc affected convergent extension in the manner expected, this did not test directly the role of XLfc in convergent extension. Therefore, we designed a translation-blocking morpholino to knockdown endogenous XLfc. We reasoned that if nocodazole acts via XLfc, knockdown of XLfc would block the ability of nocodazole to inhibit convergent extension. XLfc morpholino diminishes, in a dose-dependent manner, the ability of nocodazole to inhibit convergent extension (Figure 9A, B). Expression of a wobbled XLfc construct not recognized by the morpholino restores the ability of nocodazole to inhibit convergent extension (Figure 9C). Interestingly, knockdown of XLfc has no discernible effect on convergent extension in the absence of nocodazole, suggesting that under normal circumstances, endogenous polarization cues are strong enough to overcome the lack of XLfc, or that reduced levels of XLfc are still sufficient to carry out normal function. Alternately, since knockdown of XLfc gives only a partial block of the nocodazole effect, there may be other XLfc-like genes not recognized by the morpholino that can partially compensate in the absence of XLfc. In any case, the loss-of-function experiment suggests that XLfc is a major endogenous effector of microtubule depolymerization during convergent extension.

Since XLfc activity is regulated by microtubules, at least before stage 10.5, we ask why such an unusual mechanism of regulation, among the many transcriptional, translational, and posttranslational means available. The unique feature of microtubules is that their distribution (and hence, mass) is nonuniform, dynamic and reflective of overall cell polarity. Summarizing our current model of XLfc regulation (Figure 10A), XLfc binds microtubules and is inactive. Upon microtubule depolymerization, XLfc is released and becomes active for nucleotide exchange activity, thereby activating certain Rho-family GTPases. Activation of Rho-family GTPases leads to inhibition of lamellipodia and loss of cell-cell contact.

Figure 10.

Current models of XLfc action. (A) XLfc regulation by microtubules: when bound to microtubules, XLfc is inactive. Upon microtubule depolymerization, XLfc is released and becomes active for nucleotide exchange activity. Active XLfc activates Rho-family GTPases, which inhibit lamellipodial protrusions and cell-cell contact. (B) Working model for how XLfc contributes to establishment of cell polarity. Polarity cues alter local microtubule stability; local microtubule depolymerization leads to local activation of XLfc. XLfc induces local inhibition of lamellipodial protrusions.

These data suggest that XLfc could be a critical and novel regulator of cell morphology during convergent extension and perhaps other processes. Because deregulation of XLfc is sufficient to uncouple the effects of microtubule depolymerization from changes in actin-based cell morphology, and because the developmental switch at stage 10.5 effectively does the same, regulation of XLfc protein or activity may account for the change in sensitivity of convergent extension to nocodazole, and may reflect a regulatory shift in controlling cell polarity at that stage.

While it is possible that global regulation of XLfc by microtubule polymer creates permissive conditions for lamellipodial activity and convergent extension, microtubule binding creates the opportunity for XLfc to act locally within cells; a speculative model is schematized (Figure 10B). While we might expect the steady state concentration of unbound XLfc to be uniform in the cell, this might not be true in transient states. Episodes of microtubule turnover could induce local Rho activation and inhibition of lamellipodia. Such local effects could help break the symmetry of lamellipodial extension around the cell’s entire periphery. This proposed model is consistent with the original work describing the establishment of polarity during convergent extension (Shih and Keller, 1992). The crucial step in establishment of polarity is not induction of polarized mediolateral protrusions, but loss or repression of anterior-posterior protrusions. Identification of the signals inducing polarization during convergent extension will greatly aid the dissection of these models.

It is important to point out that dn Rho only partially rescues nocodazole-mediated inhibition of convergent extension, suggesting that Rho may not be the relevant or only target of XLfc. Two different forms of activated Rho (V14 and L30) do not fully recapitulate the effects of microtubule depolymerization on convergent extension (data not shown). V14 Rho can indeed inhibit convergent extension, but lamellipodia are not lost (data not shown). This result was also obtained in a study of GTPase overexpression during convergent extension (Tahinci and Symes, 2003). These observations reinforce the importance of combining whole explant analysis with cellular-level analysis. While inhibition of lamellipodial protrusions is sufficient to inhibit convergent extension, other mechanisms (e.g. subtle changes in cell morphology and dynamics of active protrusions) are likely to be important and merit further analysis. One hundred small GTPases have been tested in a simple morphological assay; HeLa cells were transfected and observed for changes in cell shape, polarity, and spreading (Heo and Meyer, 2003). This work suggests that considering only Rac, Rho, and Cdc42 is inadequate when evaluating cell morphology. Unfortunately, these reagents are not readily available; therefore, it was not possible for us to test involvement of other Rho-family GTPases in convergent extension. It is likely that XLfc activates one or more small GTPases in addition to Rho; the activity of these targets alone or in combination with Rho would be responsible for mediating the effects of XLfc, which are only clearly revealed under conditions of microtubule depolymerization.