Skip to main content
NCBI home page
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2006 Nov 22;73(2):622–629. doi: 10.1128/AEM.01493-06

Vertical Transmission of Diverse Microbes in the Tropical Sponge Corticium sp.▿

Koty H Sharp 1,†, Boreth Eam 1, D John Faulkner 2,‡, Margo G Haygood 1,2,*
PMCID: PMC1796987  PMID: 17122394

Abstract

Sponges are host to extremely diverse bacterial communities, some of which appear to be spatiotemporally stable, though how these consistent associations are assembled and maintained from one sponge generation to the next is not well understood. Here we report that a diverse group of microbes, including both bacteria and archaea, is consistently present in aggregates within embryos of the tropical sponge Corticium sp. The major taxonomic groups represented in bacterial 16S rRNA sequences amplified from the embryos are similar to those previously described in a variety of marine sponges. Three selected bacterial taxa, representing proteobacteria, actinobacteria, and a clade including recently described sponge-associated bacteria, were tested and found to be present in all adult samples tested over a 3-year period and in the embryos throughout development. Specific probes were used in fluorescence in situ hybridization to localize cells of the three types in the embryos and mesohyl. This study confirms the vertical transmission of multiple, phylogenetically diverse microorganisms in a marine sponge, and our findings lay the foundation for future work on exploring vertical transmission of specific, yet diverse, microbial assemblages in marine sponges.

Many marine invertebrates engage in long-term, specific associations with microorganisms. Sometimes these symbiotic associations are highly specialized, like the association between the squid Euprymna scolopes and a single species of light-producing bacterium (Vibrio fischeri), where the host utilizes strain-specific mechanisms to acquire a single symbiont species from the surrounding environment and the symbiont induces developmental changes in the host (25, 29). In contrast, the gutless marine oligochaete genus Olavius hosts multiple bacterial symbionts (5, 11). Not surprisingly, in marine sponges, the choanocytes, which filter seawater, tend to accumulate diverse microbial assemblages. More remarkably, microbes are often observed in the interior tissues (mesohyl) of sponges by microscopy. Indeed, complex communities found in some sponges lead one to view these as macroscopic microbial consortia organized by a scaffold of sponge cells. The microbial community within some sponges is dominated by a single bacterial or archaeal species. Recent biochemical and genomic research on specific sponge-associated prokaryotes has shown that, in several sponges, bacteria and archaea are involved in production of bioactive compounds, autotrophic carbon fixation, or translocation of nutrients and antioxidants to the sponge host (21, 32, 33, 40, 44). Genomic data from Cenarchaeum symbiosum, a crenarchaeon found in the sponge Axinella mexicana (32), suggest that the archaeal symbiont can live chemolithoautotrophically by ammonia oxidation (17). Other sponges appear to have very few interior microbes at all (19, 43). The metabolic diversity of the various eubacteria and archaea found in marine sponges is likely to contribute significantly to nutrient cycling within sponges and their survival in the ecosystems they inhabit.

In addition to understanding the functional roles of bacteria and archaea in sponges, a central objective of sponge microbiology is to gain a better understanding of the diversity and predictability of sponge-prokaryote associations. Small-subunit rRNA-based molecular approaches (20, 22) indicate that several unrelated groups of microbes are consistently found in diverse sponges. This pattern suggests reliable mechanisms of transmission or recruitment of multiple microbes, but whether the microbes are selected by sponges from environmental populations or transmitted directly between sponge generations is unknown.

Vertical transmission of microbial symbionts, characteristic of long-term obligate associations, is documented in many animal phyla, including bivalves (8, 10, 16, 26, 36), bryozoans (18), and ascidians (23). Ultrastructural studies showing bacteria in sponge reproductive tissues provide strong evidence that vertical transmission of bacteria is a common phenomenon in sponges (34, 35, 42). Recently, Enticknap et al. (12) used fluorescence in situ hybridization (FISH) to localize an alphaproteobacterium within the developing embryos of the sponge Mycale laxissima. The species found in M. laxissima embryos belongs to a larger group of bacteria found in several other marine sponges (12, 47). Microscopy revealed the presence of cyanobacterial symbionts in the eggs and sperm of Chondrilla australiensis (41, 42). Oren et al. used fluorescence microscopy and electron microscopy to demonstrate the presence of cyanobacteria in larvae of the Red Sea sponge Diacarnus erythraenus. 16S rRNA gene sequence analysis from D. erythraenus larval DNA extracts showed the presence of unicellular cyanobacteria closely related to the known symbiotic cyanobacteria in Aplysina aerophoba and Chondrilla nucula (30). However, in most sponges, microbes in or on the oocytes, sperm, embryos, and larvae have yet to be investigated via rRNA gene sequence analysis. To date, in situ hybridization has not been used to confirm transmission of a diverse set of bacteria in sponge embryos.

In this study, the vertical transmission of microbial assemblages was investigated in the tropical Pacific sponge Corticium sp., which broods its embryos and releases fully developed larvae into the water column. Previous ultrastructural investigations demonstrate that microorganisms are present in the central cavity of Corticium candelabrum larvae (6), suggesting that the sponge maintains microbial associates intergenerationally, but the composition and diversity of the transmitted assemblage have yet to be characterized. The aims of this study were to (i) localize bacteria and archaea in various embryonic stages via FISH and (ii) identify members of the bacterial community in the sponge embryos. FISH revealed that both bacteria and archaea are present throughout Corticium embryogenesis, and bacteria are more abundant than archaea in the embryos, as well as in the sponge mesohyl. The bacterial community composition was studied in more detail by construction of small-subunit rRNA (16S rRNA) clone libraries from dissected embryos within adult Corticium sp. Specific FISH probes were designed to confirm the presence of select sequences from the embryo clone libraries, and the specificity of each probe was tested with rigorous negative-control probes.

MATERIALS AND METHODS

Sponge collection.

Sponges of the genus Corticium are widespread throughout the tropical Pacific. In Palau, Corticium sp. individuals ranging in size from 0.5 cm to 3 cm in diameter occur on and beneath overhangs on reef slopes. The Corticium sp. collected in Palau occurs in clusters on reef substrate. Figure 1 shows an underwater photo of the sponge; it has a black, smooth outer layer with apparent oscules. Slicing the sponge reveals a light gray interior beneath the black cortex. For this study, large individuals (approximately 2.5 to 3 cm in diameter) were collected by scuba divers from 10 different reef slopes in the Palau archipelago at depths ranging from 3 to 20 m in September 2001, September 2002, and March 2004. Sponges were collected in plastic bags at depth and brought to the surface. Samples were preserved in 100% ethanol and 2.5% glutaraldehyde or frozen solid at −20°C until use. For FISH, whole sponges were fixed in paraformaldehyde (4% in buffer: 20 mM K2HPO4, 0.5 M NaCl, pH 7.4) for 2 h at room temperature and transferred to 70% ethanol for long-term storage at −20°C. Voucher specimens from each location were frozen in ethanol for potential future DNA analysis.

FIG. 1.

FIG. 1.

Open in a new tab

Corticium sp. underwater. The photo was taken at approximately a 30-ft depth, Koror-Babeldaob channel, Palau, Micronesia. Bar = 4 cm.

FISH.

Samples were fixed and stored on the day of collection as described above. Individual sponges embedded in paraffin wax were sectioned to 10 μm. Sections were deparaffinized (twice for 5 min in xylene, twice for 5 min in 100% ethanol, and one rinse in Milli-Q water) and air dried. FISH was performed in a humidity chamber in hybridization buffer (0.9 M NaCl, 20 mM Tris-HCl [pH 7.4], 0.01% sodium dodecyl sulfate) with 35% percent formamide for 2 h. All probes, including the general eubacterial and archaeal probes and the sequence-specific probes designed in this study, were used at a final concentration of 5 ng/μl in hybridization buffer. Sequences of all probes used in this study are listed in Table 1. After hybridization, the slides were incubated at 48°C in wash buffer (0.7 M NaCl, 20 mM Tris-HCl [pH 7.4], 50 mM EDTA, 0.01% sodium dodecyl sulfate) for 20 min. The wash buffer was rinsed off with Milli-Q water, and slides were air dried and mounted in VectaShield (Vector Labs, Burlingame, CA). Slides were visualized on an Axioskop epifluorescence microscope (Zeiss) with a 40× objective nonimmersion lens.

TABLE 1.

List of oligonucleotide probes and primers used in this study

Probe or primer Sequence (5′-3′) Reference(s) or source
27f AGAGTTTGATCMTGGCTCAG 27
EUB338 GCTGCCTCCCGTAGGAGT 2, 28
EUBNON ACTCCTACGGGAGGCAGC 28, 45
ARCH915 GTGCTCCCCCGCCAATTCCT 37
ARCH915NON GTGCTACCCCGCCAATTCCT This study
α-CC01 CGACCTCGCGATCTCGCT This study
actino-CC07 CGCTTGACCTCGCGGTGT This study
SpC1 CTACACATTCCACCGCTA This study
α-CC01NON CGACTTCGCGATCTCGCT This study
actino-CC07NON CGCTTGACCTCGCAGTGT This study
SpC1NON CTACTCATTCCACCGCTA This study
Open in a new tab

Bacterial 16S rRNA gene library construction.

For embryo DNA extractions, approximately 100 embryos were picked intact from ethanol-preserved sponges with a sterile 23-gauge syringe needle and rinsed twice in sterile artificial seawater (ASW) (100 mM MgSO4 · 7H2O, 80 mM CaCl2 · 2H2O, 2.4 M NaCl, 80 mM KCl). Genomic DNA was extracted from the picked embryos using a protocol adapted from Preston et al. (32). ASW was removed and replaced by 1 mg/ml lysozyme-TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), and the samples were incubated at 37°C for 30 min. Proteinase K was added to final concentration of 0.5 mg/ml, and the sample was incubated at 55°C for 1.5 h, until the solution was transparent. To complete lysis, the sample was boiled for 60 s. After lysis, the DNEasy genomic extraction kit (QIAGEN) bacterial DNA protocol was used.

PCR with general eubacterial primers 27f (5′-AGAGTTTGATCMTGGCTCAG-3′) and 1492r (5′-TACGGYTACCTTGTTACGACTT-3′) was done with the following profile conditions: initial denaturation for 3 min at 95°C; 35 cycles of denaturation for 30 s at 95°C, annealing for 1 min at 50°C, and elongation for 1 min at 72°C; and a final extension step for 7 min at 72°C. Product was analyzed by electrophoresis on a 0.8% agarose gel and purified with a Rapid PCR purification system (Marligen Biosciences). The purified PCR fragment was cloned into a PCR 2.1 vector (Invitrogen), which was transformed into TOP10 cells (Invitrogen). Transformants were selected using Luria-Bertani plates (10 g/liter tryptone, 5 g/liter yeast extract, 10 g/liter NaCl, 15 g/liter agar) containing 5 μg/liter kanamycin sulfate, top spread with 50 ng/ml X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside). Inserts were amplified from white colonies picked from the selective plates in 96-well format PCR, with plasmid-specific primers (M13f, 5′-GTAAAACGACGGCCAG-3′; M13r, 5′-CAGGAAACAGCTATGAC-3′; Invitrogen). From the three embryo clone libraries, PCR products of the correct sizes were obtained from a total of 200 colonies. The PCR products were screened in a restriction digest with the enzymes HhaI and HaeIII, yielding approximately 90 total unique restriction patterns. Initial sequencing of the inserts suggested that the 90 unique patterns could be grouped into 19 closely related sequence types. Representatives of each sequence group were selected for full twofold sequence coverage, and the resulting sequence contigs were constructed and aligned for each clone in Sequencher 4.2 (GeneCodes Corp., Ann Arbor, MI) and compared to databases at Ribosomal Database Project and NCBI (http://rdp.cme.msu.edu/index.jsp; http://www.ncbi.nlm.nih.gov/BLAST/).

Phylogenetic analysis.

Sequences from each individual clone were edited and assembled in Sequencher 4.2 (GeneCodes Corp., Ann Arbor, MI). The 16S rRNA gene sequences obtained from the clones were run through chimera check analysis in the Ribosomal Database Project (9) to confirm that they are not hybrid sequences. The sequences that did not appear to be chimeras were then compared with other described bacterial sequences through BLAST (1) and the Ribosomal Database Project (9). Sequences that matched most closely were used in an alignment with the 16S rRNA sequences. Sequences were combined with alignments downloaded from Ribosomal Database Project (9) using Sequencher 4.2 (Gene Codes Corp., Ann Arbor, MI) and aligned by eye with secondary structure information (7), yielding 1,300 bp of aligned sequence. Phylogenetic trees were constructed in PAUP* 4.0b10 (38) using a maximum-parsimony (MP) algorithm. Transversions were weighted three times more than transitions (based on maximum likelihood estimations of the transition-to-transversion ratio), and a heuristic search of 100 repetitions with random addition of sequences was performed. MP bootstrapping was performed with 1,000 replicates.

Design and application of species-specific primers and probes.

Probes were designed targeting three groups of bacterial 16S rRNA gene sequences from the library for use as confirmation of their presence in the sponge and in order to survey additional Corticium individuals. Three sequences, representing an alphaproteobacterial 16S sequence, an actinobacterial sequence, and a deeply branching clade of bacteria, were of particular interest because of their close relation to known symbionts, producers of bioactive compounds, and appearance as a sponge-specific clade, respectively. In order to ensure specificity, the primers were designed to target a hypervariable region of the 16S rRNA, and for efficiency as probes, the primers target regions of extremely high accessibility on the 16S rRNA molecule (3). The specific oligonucleotide primers CC01-1216 (5′-CGACCTCGCGATCTCGCT-3′), CC07-1245 (5′-CGCTTGACCTCGCGGTGT-3′), and SpC1 (5′-CTACACATTCCACCGCTA-3′) were designed. PCR, targeting the specific sequences, was performed with the general eubacterial oligonucleotide primer 27f (5′-AGAGTTTGATCMTGGCTCAG-3′) paired with each of the specific oligonucleotide primers. Thermal cycling conditions for the PCRs with the specific primers were as follows: initial denaturation for 3 min at 95°C; 35 cycles of denaturation for 30 s at 95°C, annealing for 1 min at 65°C, and elongation for 1 min at 72°C; and a final extension step for 7 min at 72°C. Identity of the amplification products from the specific primers was confirmed with sequencing. ProbeMatch (RDP; http://rdp.cme.msu.edu/probematch/search.jsp) suggests that the three probes do not match the 16S sequence of any microbe known in the database. In order to construct probes for FISH, the specific oligonucleotide primers were 5′-cyanine 3 (CY3) end labeled. Negative-control probes, CY3-labeled single mismatch probes, were designed to confirm the specificity of the probes (sequences in Table 1).

Nucleotide sequence accession numbers.

The GenBank accession numbers for the 16S rRNA gene sequences cloned from Corticium sp. are DQ247938 to DQ247957.

RESULTS

Bacteria and archaea in Corticium sp. embryos.

Corticium sp. tissue sections were hybridized simultaneously with the CY5-labeled general eubacterial probe (EUB338) and a CY3-labeled general archaeal probe (ARCH915) (sequences shown in Table 1) by FISH. Strong autofluorescence in sponge cells allows visualization of sponge structures without counterstaining, and a probe-conferred signal is identified by comparison with negative controls. Early-stage embryos contain conspicuous and regularly arranged clusters of bacteria, resembling beads on a necklace, lining the inner periphery of the embryos (Fig. 2A). Archaea are present in these aggregates also but are less abundant (Fig. 2B). Negative controls for specificity of both ARCH915 and EUB338 show no hybridization to cells in the aggregates (Fig. 2C). In later developmental stages, bacteria are in the central cavity of the developing embryo (Fig. 2D). Localization of bacteria in the late-stage embryos is consistent with previous ultrastructural studies of Corticium sp. swimming larvae, in which bacterial cells were noted in the larval cavity (6). In addition, hybridization with CY5-ARCH915 and CY3-EUB338 indicates that small numbers of archaea are located close to host tissues and are absent in the cavity (Fig. 2E). CY3-EUB338NON and CY5-ARCH915NON do not hybridize to cells within developing Corticium sp. embryos (Fig. 2F). CY3-EUB338 and CY5-ARCH915 both hybridize to cells densely packed in choanocyte chambers and throughout the mesohyl of the adult sponge (Fig. 2G and H). Negative-control probes (CY3-EUBNON and CY5-ARCH915NON) showed no hybridization to cells in the mesohyl or choanocyte chambers of adult Corticium sp. (Fig. 2I).

FIG. 2.

FIG. 2.

Open in a new tab

Bacteria and archaea within developing Corticium sp. embryos. (A) CY5-labeled general eubacterial probe (EUB338) reveals clusters of bacterial cells (arrowheads) in the inner periphery of the developing embryo. Bar = 10 μm. (B) Simultaneous hybridization with CY5-EUB338 (green) and CY3-ARCH915 (red) shows the presence of both archaea and bacteria in the aggregates (arrowheads) within the Corticium sp. embryos. Bar = 10 μm. (C) Negative controls with probes EUBNON and ARCHNON show no hybridization to cells in the aggregates (lines). Bar = 10 μm. (D) CY5-EUB338 hybridizes to a mass of cells (arrowheads) in the central cavities of later-stage embryos. Bar = 100 μm. (E) Both bacteria (green) and archaea (red) are present in the cavity (arrowhead) of a developing Corticium sp. embryo. Bar = 100 μm. (F) Negative controls with probes EUBNON and ARCHNON show no hybridization to central cavity (arrowhead) in the embryo. Bar = 100 μm. (G) CY5-EUB338 shows that the sponge mesohyl is densely packed with eubacterial cells. Bacteria line the choanocyte chambers (ch) but also appear further in the sponge interior. Bar = 60 μm. (H) Bacteria (green) and archaea (red) are present throughout the mesohyl and around the choanocyte chambers. Bar = 60 μm. (I) Negative controls with probes EUBNON and ARCHNON show no hybridization to cells of the mesohyl (bar = 60 μm).

Bacterial 16S rRNA clone libraries.

We constructed three clone libraries of embryo-associated bacterial 16S rRNA genes. Each library contained 16S rRNA gene sequences amplified from the embryos within a Corticium sp. individual from one of three sampling locations. All three of the libraries contained sequences representing diverse bacterial lineages, and none of the libraries was dominated by any one sequence. Two hundred clones were initially analyzed from the three Corticium sp. libraries. Initial sequencing suggested that sequences fell into 19 different groups of closely related sequences; representatives of each group were sequenced for full (twofold) coverage.

Bacterial phylotypes represented in the embryo clone libraries (Fig. 3) showed less than 90% identity to any microbial 16S rRNA gene sequences in the Ribosomal Database Project or GenBank (NCBI) databases. Cloned sequences represented members of several groups of bacteria, including the Proteobacteria, the Actinobacteria, and the Nitrospira and Chloroflexus groups. One of the most abundant sequences, representing CC01, is from an alphaproteobacterium closely related to the terrestrial plant-symbiotic Rhizobium-Agrobacterium group. Other proteobacterial sequences cluster with those from sulfur-oxidizing chemoautotrophic gammaproteobacterial symbionts. Actinobacterial sequences from the Corticium sp. embryos were distantly related to most known actinobacterial 16S rRNA sequences but were most closely related to sequences from microorganisms previously isolated from seawater and marine sponges. Similarly, other sequences from the Corticium sp. embryos fell into distinct clades with those from microbes previously found in marine sponges that have been identified as Nitrospira, Chloroflexus, and deltaproteobacteria. Other sequences are close matches to those of unclassified microbes, including the tentative “Poribacteria” clade proposed by Fieseler et al. (14). In addition, there is a clade of sequences from the embryos that fall into a group with sequences from other marine sponges but are not closely related to any other sequences currently in RDP or GenBank databases. This clade is labeled sponge clade 1 (SpC1).

FIG. 3.

FIG. 3.

Open in a new tab

Bacterial sequence diversity in clone libraries. Maximum-likelihood phylogenetic tree of the bacterial 16S rRNA sequences obtained from embryo clone libraries, based on 1,200 bp. Numbers with CC prefix are Corticium sequences from this study. Boxes indicate sequences targeted by specific probes (this study). Included are sequences previously found in the marine sponges Aplysina and Theonella, shown in boldface and labeled by sponge host genus. Sequences from Corticium sp. embryos fall into the Nitrospira, proteobacteria, actinobacteria, and Chloroflexus groups. Many sequences show affiliation with other sequences found in marine sponges. The lineage of sequences that consists of sequences only to date found in sponges are labeled sponge clades. *, bootstrap support value of >60%. The scale bar represents 10 substitutions per nucleotide position.

Specific microbes: PCR survey.

Three of the cloned sequences similar to 16S rRNA sequences of previously described symbionts or bacteria found in other marine sponges were to chosen for further investigation. The abundance and localization of these bacteria, CC01 (alphaproteobacterium), CC07 (actinobacterium), and SpC1, were analyzed with specific reverse primers designed for PCR amplification and for in situ hybridization to rRNA. The specific primers were paired with the general eubacterial primer 27f (sequence in Table 1) for PCR amplification. Sequences for each specific oligonucleotide and its negative control are shown in Table 1. PCR with α-CC01 and actino-CC07 primers yielded only one 16S sequence from Corticium sp. samples, and PCR with the SpC1 primer yielded a group of closely related sequences. A PCR survey with the three specific primers on 12 Corticium sp. samples showed that the two bacterial species (primers α-CC01 and actino-CC07) and members of the SpC1 clade are present in Corticium sp. populations across broad temporal (3-year) and geographic (∼100-km) scales (Fig. 4). Sequencing analysis of each PCR product confirmed the identity as the sequence targeted by the specific primers and confirmed that the sequences from each Corticium sp. sample were identical, except in the case of the SpC1 primer pair, in which they were closely related (<2%). Negative controls (no template) were run for each PCR to confirm that the amplification products were not due to contamination of reagents (not shown).

FIG. 4.

FIG. 4.

Open in a new tab

Specific PCR survey. A specific PCR survey demonstrates the presence of two bacterial species (actinobacterium CC07 and alphaproteobacterium CC01) and SpC1 in all 12 tested Corticium sp. samples collected across the Palau Islands. Sample numbers on the gel pictures and map correspond to the location and year of collection in the table. Circles on the map indicate approximate locations of the 12 collection sites across the Palau Islands. Negative controls (no template) were run for each PCR to confirm that the amplification products were not due to contamination of reagents (not shown). The map was reprinted courtesy of http://www.reefbase.org.

Specific probes: FISH.

The three specific oligonucleotide primers, CY3 labeled for use as probes (α-CC01, actino-CC07, and SpC1), hybridize to bacterial cells within the peripheral clusters of microbes in early-stage embryos (Fig. 5A, B, and C). Negative control probes (single-base-mismatch probes) were designed to test the specificity of each of the three probes. In all three cases, the negative-control probes demonstrate sequence specificity: the negative probes do not hybridize to cells in the aggregates lining the embryos under our experimental conditions (Fig. 5D, E, and F). The three specific probes hybridize to cells within the central cavities of the later-stage embryos (Fig. 6A, B, and C), in addition to the mesohyl of the adult sponge (Fig. 6D, E, and F).

FIG. 5.

FIG. 5.

Open in a new tab

Specific probes hybridize to cells in aggregates in Corticium sp. embryos. CY3-labeled probes specific for the alphaproteobacterium CC01 (A), the actinobacterium CC07 (B), and the clade SpC1 (C) hybridize to cells (arrowheads) in the aggregates in the embryos. Single-base-mismatch probes, negative controls testing probe specificity, do not hybridize to cells in the bacterial aggregates (lines) in the embryos (D, E, and F).

FIG. 6.

FIG. 6.

Open in a new tab

Specific probes hybridize to cells in the central cavities of later-stage embryos (A-C) and in adult sponge mesohyl (D-F). CY3-labeled probes specific for the alphaproteobacterium CC01 (A), the actinobacterium CC07 (B), and the clade SpC1 (C) hybridize to cells (arrowheads) in the mass in the later-stage larval cavity. Specific probes also hybridize to cells occurring throughout the mesohyl and surrounding the choanocyte chambers (panels D, E, and F, respectively). ch, choanocyte chambers.

DISCUSSION

Phylogenetic analysis suggests that vertical-transmission mechanisms are often present in highly coevolved host-microbe associations (31). Previous work on vertical transmission in sponges has demonstrated the presence of a single microbe species in developing embryos (12, 30, 42), and molecular methods indicate the possibility of more-complex assemblages in the larvae of the sponge M. laxissima (12). Our embryo-based research on Corticium sp. revealed that both bacteria and archaea are vertically transmitted. A detailed study of the bacterial community showed remarkable diversity of bacteria in Corticium sp. embryos. At least three of these, but likely more of them, are constant across time and space. The sequences identified in this study add to the growing collection of 16S rRNA sequences found in diverse marine sponges from diverse regions around the world. Phylogenetic analysis shows that Corticium sp. hosts a diverse suite of bacteria in its embryos, including bacteria from phylogenetic groups previously observed in other marine sponges (20, 22, 39, 47). Because the composition of this community is strikingly similar to that previously described for many other sponges, these results lay a foundation for future research on transmission of similar, complex microbial communities in other sponges. Similar diverse microbial communities found in different sponge orders around the globe, “sponge specialists” (20, 22), may be members of specific, highly evolved associations that are maintained and regulated by reproductive transmission in the host sponge.

While the composition of sequences found in the Corticium sp. bacterial 16S rRNA gene clone library reflects the makeup of other described bacterial communities in sponges, some of the previously well-characterized sponge-associated bacteria are not closely related to those represented by any of the sequences found in Corticium sp. in this study. For instance, there are many well-documented associations between sponges and cyanobacteria (4, 30, 40, 42), but PCR from Corticium sp. embryo DNA did not yield any cyanobacterial 16S sequences. In addition, very few autofluorescent prokaryotic cells were observed in sections of embryos or mesohyl, indicating a striking absence of photosynthetic bacteria in Corticium sp. Though α-CC01 16S sequences were a relatively large portion of the sequences in the embryo clone libraries (approximately 30% of the sequences), neither the alphaproteobacterium NW001, isolated from the tropical Pacific sponge Rhopaloeides odorabile (12, 46), nor the clade of closely related bacteria found in other sponges (12) was found in Corticium sp. embryo libraries. In addition, none of the sequences from the embryos were closely related to those from NW001. A potential explanation is that NW001 is not present in Corticium sp. However, the clone libraries in this study were unlikely to have exhausted the diversity of the community in the embryos. Enticknap et al. (12) also noted that, while NW001-like alphaproteobacteria make up an estimated 50% of the biomass in M. laxissima embryos, they are underrepresented in 16S rRNA gene clone libraries, perhaps due to PCR primer bias. Further investigation would be necessary to determine whether members of the NW001-like clade of alphaproteobacteria, a proposed “sponge-specific” lineage, are truly absent in the tropical Pacific sponge Corticium sp. Another interesting observation is that the NW001-like alphaproteobacterium seems to be concentrated around and in the embryos in the sponge M. laxissima but is not highly abundant in the mesohyl (12). The three microbial groups examined in this study appear in Corticium sp. embryos and also are evenly distributed throughout Corticium mesohyl (Fig. 5 and 6).

FISH with specific probes confirms that the embryo-based DNA libraries contained sequences that were present within embryos, not merely contaminants from the surrounding seawater. The specific groups are consistently present in Corticium sp. individuals over both spatial and temporal scales (Fig. 4). Each of the three phylotypes was present in all tested Corticium sp. samples from the Palau Islands, spanning nearly 100 km and 3 years of sampling, further evidence for a long-term association between the sponge host and the microbial assemblage. Our specific FISH demonstrates that at least three specific bacterial phylotypes from the libraries are consistently associated with Corticium sp. embryos throughout their development. However, the images show that none of the three phylotypes is a dominant portion of the bacterial biomass in the embryos, suggesting that other bacteria—whether or not they are represented in the clone libraries—are also present in the embryos. If there is a single microbial species that is numerically dominant in the embryos, it is yet to be identified. Alternatively, the bacterial assemblage is diverse, and none of the bacteria are particularly dominant in number or biomass. Further probing in Corticium sp. embryos for groups of bacteria that appear to be sponge specific will broaden our understanding of the diversity and transmission of microbe-sponge associations.

The prokaryotic community in Corticium sp. includes bacteria whose closest relatives are the sulfur-oxidizing gammaproteobacteria in invertebrates of highly reduced environments (Codakia symbionts, Riftia symbionts, scaly snail symbiont). There are others that fall into a clade with the nitrogen-fixing Rhizobiales. In addition, many of the sequences from Corticium embryos are related to actinobacteria, a division of the bacteria known for its production of diverse and complex bioactive compounds. While the archaea in Corticium sp. are yet to be identified, ammonia-oxidizing archaea have been shown to be quite widespread in many marine environments, including the interior of sponges (15, 17, 24), and further exploration of ammonia-oxidizing archaea in sponges is necessary to understand whether they are widespread in marine sponges. Though it is unknown how or if the transmitted microbial community functions as part of the host sponge physiology, it seems likely that this sponge and others possess a predictable set of eubacterial and archaeal partners that construct chemical microenvironments within the animal host and live in syntrophy, cycling nutrients and carbon within the sponge. In addition, some microbes may prevent predation of the host via production of bioactive molecules.

Recent work outlines different possible modes of symbiont incorporation from adult mesohyl into embryos or eggs of Halisarca dujardini (13). Our study highlights the utility of using probe-based technology to visualize microbes in early sponge embryonic stages, allowing new insight into the processes governing inoculation of sponge embryos. FISH probes reveal that, during embryogenesis in Corticium sp., bacteria form aggregates within the embryos, and by later stages of development, the bacteria are primarily in the central cavity. This embryonic acquisition of bacteria may indicate a fairly specialized mechanism of transfer during (or before) embryonic development, such as those previously described in the sponge Chondrilla australiensis (34, 35, 42). The presence of bacterial cells in the central cavity of the embryos is consistent with the description of bacteria in the cavities of Corticium sp. larvae (6). We also show that Corticium sp. possesses a specific, diverse assemblage of bacteria and archaea, within its embryos, and the microbial assemblage is constant across individuals sampled across a 3-year and 100-km spread in the Palau Islands. It is striking that the composition of the embryo-associated community is similar to those found in many other sponge species. While sponge-bacterium symbioses are widely accepted to be ancient associations, the data here show for the first time that a highly complex microbial assemblage, like those found in many sponges, is maintained intergenerationally. Further use of 16S rRNA-based molecular approaches on diverse sponges will test whether vertical transmission is a common strategy for the maintenance of specific symbioses in marine sponges.

Acknowledgments

This work was funded by California Sea Grant (R/MP-88), the National Institutes of Health (grant 5R01CA079678-03), and the Scripps Institution of Oceanography Graduate Student Office. K.H.S. was supported by the Los Angeles ARCS Foundation.

Collection efforts in Palau were made possible by Pat and Lori Colin and the Coral Reef Research Foundation. We thank Catherine Sincich, Christian Ridley, Melissa Lerch, and Joel Sandler for assistance with SCUBA collection of Corticium sp. in Palau. We thank Nancy Knowlton and Nick Holland for their review of the manuscript.

Footnotes

▿

Published ahead of print on 22 November 2006.

REFERENCES

  • 1.Altschul, S. F., W. Gish, W. Miller, E. W. Wyers, and D. J. Lipman. 1990. Basic Local Alignment Search Tool. J. Mol. Biol. 215:403-410. [DOI] [PubMed] [Google Scholar]
  • 2.Amann, R. I., B. J. Binder, R. J. Olson, S. W. Chisholm, R. Devereux, and D. A. Stahl. 1990. Combination of 16S rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial populations. Environ. Microbiol. 56:1919-1925. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Behrens, S., C. Ruhland, J. Inacio, H. Huber, A. Fonseca, I. Spencer-Martins, B. M. Fuchs, and R. Amann. 2003. In situ accessibility domains of small-subunit rRNA of members of the domains Bacteria, Archaea, and Eucarya to Cy3-labeled oligonucleotide probes. Appl. Environ. Microbiol. 69:1748-1753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bewley, C. A., N. D. Holland, and D. J. Faulkner. 1996. Two classes of metabolites from Theonella swinhoei are localized in distinct populations of bacterial symbionts. Experientia (Basel) 52:716-722. [DOI] [PubMed] [Google Scholar]
  • 5.Blazejak, A., C. Erseus, R. Amann, and N. Dubilier. 2005. Coexistence of bacterial sulfide oxidizers, sulfate reducers, and spirochetes in a gutless worm (Oligochaeta) from the Peru Margin. Appl. Environ. Microbiol. 71:1553-1561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Boury-Esnault, N., A. Ereskovsky, C. Bezac, and D. Tokina. 2003. Larval development in the Homoscleromorpha (Porifera, Demospongiae). Invertebr. Biol. 122:187-202. [Google Scholar]
  • 7.Cannone, J. J., S. Subramanian, M. N. Schnare, J. R. Collett, L. M. D'Souza, Y. Du, B. Feng, N. Lin, L. V. Madabusi, K. M. Muller, N. Pande, Z. Shang, N. Yu, and R. R. Gutell. 2002. The comparative RNA web (CRW) site: an online database of comparative sequence and structure information for ribosomal, intron, and other RNAs. BMC Bioinformatics 3:15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Cary, S. C. 1994. Transovarial inheritance of endosymbiotic bacteria in the protobranch bivalve, Solemya reidi. EOS 75:60. [Google Scholar]
  • 9.Cole, J. R., B. Chai, T. L. Marsh, R. J. Farris, Q. Wang, S. A. Kulam, S. Chandra, D. M. McGarrell, T. M. Schmidt, G. M. Garrity, and J. M. Tiedje. 2003. The Ribosomal Database Project (RDP-II): previewing a new autoaligner that allows regular updates and the new prokaryotic taxonomy. Nucleic Acids Res. 31:442-443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Distel, D. L., D. J. Beaudoin, and W. Morrill. 2002. Coexistence of multiple proteobacterial endosymbionts in the gills of the wood-boring bivalve Lyrodus pedicellatus (Bivalvia: Teredinidae). Appl. Environ. Microbiol. 68:6292-6299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dubilier, N., C. Mulders, T. Ferdelman, D. de Beer, A. Pernthaler, M. Klein, M. Wagner, C. Erseus, F. Thiermann, J. Krieger, O. Giere, and R. Amann. 2001. Endosymbiotic sulphate-reducing and sulphide-oxidizing bacteria in an oligochaete worm. Nature 411:298-302. [DOI] [PubMed] [Google Scholar]
  • 12.Enticknap, J. J., M. Kelly, O. Peraud, and R. T. Hill. 2006. Characterization of a culturable alphaproteobacterial symbiont common to many marine sponges and evidence for vertical transmission via sponge larvae. Appl. Environ. Microbiol. 72:3724-3732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ereskovksy, A. V., E. Gonobobleva, and A. Vishnyakov. 2005. Morphological evidence for vertical transmission of symbiotic bacteria in the viviparous sponge Halisarca dujardini Johnston (Porifera, Demospongiae, Halisarcida). Mar. Biol. 146:869-875. [Google Scholar]
  • 14.Fieseler, L., M. Horn, M. Wagner, and U. Hentschel. 2004. Discovery of the novel candidate phylum “Poribacteria” in marine sponges. Appl. Environ. Microbiol. 70:3724-3732. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Francis, C. A., K. J. Roberts, J. M. Beman, A. E. Santoro, and B. B. Oakley. 2005. Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean. Proc. Natl. Acad. Sci. USA 102:14683-14688. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Gros, O., L. Frenkiel, and H. Felbeck. 2000. Sulfur-oxidizing endosymbiosis in Divaricella quadrisulcata (Bivalvia: Lucinidae): morphological, ultrastructural, and phylogenetic analysis. Symbiosis 29:293-317. [Google Scholar]
  • 17.Hallam, S. J., T. J. Mincer, C. Schleper, C. M. Preston, K. Roberts, P. M. Richardson, and E. F. DeLong. 2006. Pathways of carbon assimilation and ammonia oxidation suggested by environmental genomic analyses of marine Crenarchaeota. PLoS Biol. 4:520-536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Haygood, M., and S. Davidson. 1997. Small-subunit rRNA genes and in situ hybridization with oligonucleotides specific for the bacterial symbionts in the larvae of the bryozoan Bugula neritina and proposal of “Candidatus endobugula sertula.” Appl. Environ. Microbiol. 63:4612-4616. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Hentschel, U., L. Fieseler, M. Wehrl, C. Gernert, M. Steinert, and J. Hacker. 2003. Microbial diversity of marine sponges, p. 59-88. In W. E. G. Muller (ed.), Marine molecular biotechnology. Springer-Verlag, Berlin, Germany. [DOI] [PubMed]
  • 20.Hentschel, U., J. Hopke, M. Horn, A. B. Friedrich, M. Wagner, J. Hacker, and B. S. Moore. 2002. Molecular evidence for a uniform microbial community in sponges from different oceans. Appl. Environ. Microbiol. 68:4431-4440. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Hentschel, U., M. Schmid, M. Wagner, L. Fieseler, C. Gernert, and J. Hacker. 2001. Isolation and phylogenetic analysis of bacteria with antimicrobial activities from the Mediterranean sponges Aplysina aerophoba and Aplysina cavernicola. FEMS Microbiol. Ecol. 35:305-312. [DOI] [PubMed] [Google Scholar]
  • 22.Hill, M., A. Hill, N. Lopez, and O. Harriott. 2006. Sponge-specific bacterial symbionts in the Caribbean sponge, Chondrilla nucula (Demospongiae, Chondrosida). Mar. Biol. 148:1221-1230. [Google Scholar]
  • 23.Hirose, E. 2000. Plant rake and algal pouch of the larvae in the tropical ascidian Diplosoma similis: an adaptation for vertical transmission of photosynthetic symbionts Prochloron sp. Zool. Sci. (Tokyo) 17:233-240. [Google Scholar]
  • 24.Konneke, M., A. E. Bernhard, J. R. de la Torre, C. B. Walker, J. B. Waterbury, and D. A. Stahl. 2005. Isolation of an autotrophic ammonia-oxidizing marine archaeon. Nature 437:543-546. [DOI] [PubMed] [Google Scholar]
  • 25.Koropatnick, T. A., J. T. Engle, M. A. Apicella, E. V. Stabb, W. E. Goldman, and M. J. McFall-Ngai. 2004. Microbial factor-mediated development in a host-bacterial mutalism. Science 306:1186-1188. [DOI] [PubMed] [Google Scholar]
  • 26.Krueger, D. M., R. G. Gustafson, and C. M. Cavanaugh. 1996. Vertical transmission of chemoautotrophic symbionts in the bivalve Solemya velum (Bivalvia: Protobranchia). Biol. Bull. 190:195-202. [DOI] [PubMed] [Google Scholar]
  • 27.Lane, D. S. 1990. 16S and 23S rRNA sequencing, p. 115-148. In E. Stackebrandt and M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley, New York, NY.
  • 28.Loy, A., M. Horn, and M. Wagner. 2003. probeBase—an online resource for rRNA-targeted oligonucleotide probes. Nucleic Acids Res. 31:514-516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Nyholm, S. V., and M. J. McFall-Ngai. 2004. The winnowing: establishing the squid-Vibrio symbiosis. Nat. Rev. Microbiol. 2:632-642. [DOI] [PubMed] [Google Scholar]
  • 30.Oren, M., L. Steindler, and M. Ilan. 2005. Transmission, plasticity and the molecular identification of cyanobacterial symbionts in the Red Sea sponge Diacarnus erythraenus. Mar. Biol. 148:35-41. [Google Scholar]
  • 31.Peek, A. S., R. A. Feldman, R. A. Lutz, and R. C. Vrijenhoek. 1998. Cospeciation of chemoautotrophic bacteria and deep sea clams. Proc. Natl. Acad. Sci. USA 95:9962-9966. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Preston, C. M., K. Y. Wu, T. F. Molinski, and E. F. Delong. 1996. A psychrophilic crenarchaeon inhabits a marine sponge: Cenarchaeum symbiosum gen. nov., sp. nov. Proc. Natl. Acad. Sci. USA 93:6241-6246. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Regoli, F., C. Cerrano, E. Chierici, S. Bompadre, and G. Bavestrello. 2000. Susceptibility to oxidative stress of the Mediterranean demosponge Petrosia ficiformis: role of endosymbionts and solar irradiance. Mar. Biol. 137:453-461. [Google Scholar]
  • 34.Sciscioli, M., E. Lepore, M. Gherardi, and L. S. Liaci. 1994. Transfer of symbiotic bacteria in the mature oocyte of Geodia cydonium: (Porifera, Demospongiae): an ultrastructural study. Cah. Biol. Mar. 35:471-478. [Google Scholar]
  • 35.Sciscioli, M., E. Lepore, M. Mastrodonato, L. S. Liaci, and E. Gaino. 2002. Ultrastructural study of the mature oocyte of Tethya aurantium (Porifera: Demospongiae). Cah. Biol. Mar. 43:1-7. [Google Scholar]
  • 36.Sipe, A. R., A. E. Wilbur, and S. C. Cary. 2000. Bacterial symbiont transmission in the wood-boring shipworm Bankia setacea (Bivalvia: Teredinidae). Appl. Environ. Microbiol. 66:1685-1691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Stahl, D. A., and R. Amann. 1991. Development and application of nucleic acid probes, p. 205-248. In E. S. A. M. Goodfellow (ed.), Nucleic acid techniques in bacterial systematics. John Wiley & Sons Ltd., Chichester, England.
  • 38.Swofford, D. L. 2003. PAUP*: phylogenetic analysis using parsimony (* and other methods), version 4.0b 10. Sinauer Associates, Sunderland, MA.
  • 39.Taylor, M. W., P. J. Schupp, I. Dahllof, S. Kjelleberg, and P. D. Steinberg. 2004. Host specificity in marine sponge-associated bacteria, and potential implications for marine microbial diversity. Environ. Microbiol. 6:121-130. [DOI] [PubMed] [Google Scholar]
  • 40.Unson, M. D., N. D. Holland, and D. J. Faulkner. 1994. A brominated secondary metabolite synthesized by the cyanobacterial symbiont of a marine sponge and accumulation of the crystalline metabolite in the sponge tissue. Mar. Biol. 119:1-11. [Google Scholar]
  • 41.Usher, K. M., and A. V. Ereskovskyz. 2005. Larval development, ultrastructure and metamorphosis in Chondrilla australiensis Carter, 1873 (Demospongiae, Chondrosida, Chondrillidae). Invertebr. Reprod. Dev. 47:51-62. [Google Scholar]
  • 42.Usher, K. M., J. Kuo, J. Fromont, and D. C. Sutton. 2001. Vertical transmission of cyanobacterial symbionts in the marine sponge Chondrilla australiensis (Demospongiae). Hydrobiologia 461:15-23. [Google Scholar]
  • 43.Vacelet, J., and C. Donadey. 1977. Electron microscope study of the association between some sponges and bacteria. J. Exp. Mar. Biol. Ecol. 30:301-314. [Google Scholar]
  • 44.Vacelet, J., A. Fiala-Medioni, C. R. Fisher, and N. Boury-Esnault. 1996. Symbiosis between methane-oxidizing bacteria and a deep-sea carnivorous cladorhizid sponge. Mar. Ecol. Prog. Ser. 145:77-85. [Google Scholar]
  • 45.Wallner, G., R. Amann, and W. Beisker. 1993. Optimizing fluorescent in situ hybridization with rRNA-targeted oligonucleotide probes for flow cytometric identification of microorganisms. Cytometry 14:136-143. [DOI] [PubMed] [Google Scholar]
  • 46.Webster, N. S., and R. T. Hill. 2001. The culturable microbial community of the Great Barrier Reef sponge Rhopaloeides odorabile is dominated by an alpha-proteobacterium. Mar. Biol. 138:843-851. [Google Scholar]
  • 47.Webster, N. S., K. J. Wilson, L. L. Blackall, and R. T. Hill. 2001. Phylogenetic diversity of bacteria associated with the marine sponge Rhopaloeides odorabile. Appl. Environ. Microbiol. 67:434-444. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES