A Conserved Histidine in Cytochrome c Maturation Permease CcmB of Shewanella putrefaciens Is Required for Anaerobic Growth below a Threshold Standard Redox Potential

Abstract

Shewanella putrefaciens strain 200 respires a wide range of compounds as terminal electron acceptor. The respiratory versatility of Shewanella is attributed in part to a set of c-type cytochromes with widely varying midpoint redox potentials (E′₀). A point mutant of S. putrefaciens, originally designated Urr14 and here renamed CCMB1, was found to grow at wild-type rates on electron acceptors with high E′₀ [O₂, NO₃⁻, Fe(III) citrate, MnO₂, and Mn(III) pyrophosphate] yet was severely impaired for growth on electron acceptors with low E′₀ [NO₂⁻, U(VI), dimethyl sulfoxide, TMAO (trimethylamine N-oxide), fumarate, γ-FeOOH, SO₃²⁻, and S₂O₃²⁻]. Genetic complementation and nucleotide sequence analyses indicated that the CCMB1 respiratory mutant phenotype was due to mutation of a conserved histidine residue (H108Y) in a protein that displayed high homology to Escherichia coli CcmB, the permease subunit of an ABC transporter involved in cytochrome c maturation. Although CCMB1 retained the ability to grow on electron acceptors with high E′₀, the cytochrome content of CCMB1 was <10% of that of the wild-type strain. Periplasmic extracts of CCMB1 contained slightly greater concentrations of the thiol functional group (-SH) than did the wild-type strain, an indication that the E_h of the CCMB1 periplasm was abnormally low. A ccmB deletion mutant was unable to respire anaerobically on any electron acceptor, yet retained aerobic respiratory capability. These results suggest that the mutation of a conserved histidine residue (H108) in CCMB1 alters the redox homeostasis of the periplasm during anaerobic growth on electron acceptors with low (but not high) E′₀. This is the first report of the effects of Ccm deficiencies on bacterial respiration of electron acceptors whose E′₀ nearly span the entire redox continuum.

Cytochromes with covalently attached heme (c-type cytochromes) are often major components of anaerobic electron transport chains of prokaryotic microorganisms. c-type cytochromes displaying widely varying midpoint reduction potentials (E′₀) may confer respiratory versatility on prokaryotes residing in redox-stratified environments (13, 15, 19). The genome of the metal-respiring gammaproteobacterium Shewanella oneidensis MR-1, for example, encodes 42 putative c-type cytochromes, several of which are involved in electron transfer to metals and other anaerobic electron acceptors with E′₀ values virtually spanning the entire redox continuum encountered by microorganisms in the environment (26, 37, 46). The molecular mechanism of bacterial metal respiration, however, remains poorly understood.

In several metal-respiring bacteria, c-type cytochromes are involved in electron transport to oxidized forms of metals and radionuclides. In Geobacter sulfurreducens, outer membrane c-type cytochromes OmcB and OmcF are required for respiration on solid Fe(III) oxides, and diheme c-type cytochrome MacA is an intermediate electron carrier (7, 29, 35). Metal-respiring members of the genus Shewanella also require outer membrane c-type cytochromes OmcA and OmcB (MtrC) for respiration on U(VI) and solid Fe(III) or Mn(IV) oxides (3, 39, 44). c-type cytochromes involved in periplasmic electron transport in S. oneidensis include MtrA and CymA (41, 50). CymA oxidizes quinol and transfers electrons to downstream components of the electron transport pathway terminating with the reduction of Fe(III), NO₃⁻, NO₂⁻, fumarate, and dimethyl sulfoxide (DMSO) (41, 53, 54). A purified cytochrome c₃-hydrogenase complex isolated from U(VI)-reducing Desulfovibrio vulgaris Hildenborough displays H₂-U(VI) oxidoreductase activity in vitro (38). In addition, cytochrome c₃ mutants of Desulfovibrio desulfuricans G20 are deficient in U(VI) reduction activity with H₂ as electron donor (47, 48).

Bacteria, archaea, and the mitochondria and chloroplasts of eukarya require maturation systems to complete c-type cytochrome synthesis. Cytochrome c maturation (Ccm) systems attach heme groups to the CXXCH motifs of apocytochrome c via stereospecific thioether covalent bonds. Three Ccm systems are currently known (for recent reviews, see references 57 and 59). System I, found predominantly in alpha- and gammaproteobacteria, land plant and protozoan mitochondria, and some archaea, consists of eight dedicated components (CcmA to -H). System II, commonly found in gram-positive bacteria, cyanobacteria, beta- and deltaproteobacteria, plant and algal chloroplasts, and some archaea, includes the major components ResA to -C and CcdA. The third cytochrome c maturation system, system III, is restricted to fungal and animal mitochondria and consists of a single heme lyase component (CCHL).

Cytochrome c maturation system I is the most extensively studied cytochrome c maturation pathway. System I is organized into two branches that converge at heme lyase (CcmF): a heme delivery branch comprised of CcmA to -E and a thioredoxin branch that includes DsbD and CcmGH (59). The heme delivery branch transfers heme to apocytochrome c and includes ABC transporter subunits CcmABC, membrane protein CcmD, and heme chaperone CcmE. The thioredoxin branch transfers reducing equivalents to the periplasm and ensures that the thiol groups of apocytochrome c remain reduced for heme attachment. Maintenance of redox homeostasis in the periplasm is crucial for optimal Ccm activity (2, 8).

A random point mutant of S. putrefaciens strain 200 (originally designated Urr14 and here renamed CCMB1) was isolated by combining chemical mutagenesis (ethyl methanesulfonate) procedures with a rapid mutant screen designed to detect respiratory mutants deficient in U(VI) reduction activity (63). Subsequent anaerobic liquid growth experiments demonstrated that CCMB1 was unable to respire U(VI) or NO₂⁻ as an anaerobic electron acceptor, yet retained the ability to respire on O₂, NO₃⁻, MnO₂, and Fe(III) citrate. In the present study, CCMB1 was found to contain a mutation in a gene displaying high similarity to ccmB, encoding a permease involved in system I cytochrome c maturation in Escherichia coli (60, 61). A comparison of wild-type and CCMB1 growth rates, cytochrome content, and periplasmic free thiol content indicated that wild-type ccmB was required for growth on electron acceptors with low (but not high) E′₀ and for maintaining periplasmic redox homeostasis.

MATERIALS AND METHODS

Growth media and cultivation conditions.

A previously isolated rifamycin-resistant strain of Shewanella putrefaciens strain 200 (hereafter referred to as S. putrefaciens) was routinely cultured in the presence of 50 μg ml⁻¹ rifamycin in either Luria broth or a defined salts growth medium (SM, pH 7.5) (14, 16, 42). Anaerobic growth experiments were carried out in 13-ml Hungate tubes (Bellco Glass, Inc.) containing 10 ml SM supplemented with sodium lactate (30 mM) and sealed with black butyl rubber stoppers under an N₂ atmosphere. Electron acceptor stocks were added at the indicated final concentrations (electron acceptor stock solutions were prepared as previously described [14, 63], except where indicated): NO₃⁻, 20 mM; NO₂⁻, 2.0 mM; U(VI) carbonate, 1.0 mM (63); Fe(III) citrate, 50 mM; γ-FeOOH (55), 40 mM; MnO₂ (as colloidal MnO₂), 10 mM (49); Mn(III) pyrophosphate, 10 mM (31); TMAO (trimethylamine N-oxide), 30 mM; SO₃²⁻, 10 mM; S₂O₃²⁻, 10 mM; DMSO, 50 mM; fumarate, 35 mM. Aerobically grown cells were inoculated in batch cultures vigorously aerated with atmospheric gas. U(VI) growth experiments were carried out in SM with the headspace gas consisting of 10% H₂, 5% CO₂, and the balance N₂. Control experiments consisted of incubating wild-type S. putrefaciens in SM liquid growth medium with electron acceptor omitted or with heat-killed cells as inoculum. Antibiotics were added from filter-sterilized stocks at the indicated concentrations: chloramphenicol, 25 μg ml⁻¹, and tetracycline, 15 μg ml⁻¹.

Genetic complementation and nucleotide sequence analyses.

Standard genetic procedures were used in genetic complementation and subcloning experiments (52). A previously constructed clone library of partially digested HindIII chromosomal DNA fragments of the S. putrefaciens strain (harbored in broad-host-range cosmid pVK100 and maintained in Escherichia coli strain HB101) was mobilized into respiratory mutant CCMB1 following previously described triparental mating procedures that included helper strain E. coli HB101(pRK2013) (14). To identify CCMB1 transconjugates with restored U(VI) reduction activity, Rif^r and Tet^r transconjugate colonies were screened for a positive U(VI) reduction phenotype on SM agar growth medium supplemented with U(VI) carbonate (1 mM) (63). After screening of approximately 1,000 transconjugates, a CCMB1 transconjugate (designated CCMB1-D14) with restored U(VI) reduction ability was identified and subsequently confirmed for wild-type U(VI) reduction activity in liquid culture.

Transconjugate CCMB1-D14 was found to contain a 34-kb complementing cosmid (designated pD14; see Fig. S1 in the supplemental material for subcloning strategy). D14 contained two internal HindIII restriction sites resulting in three HindIII fragments (D14-1, D14-2, and D14-3), each of which was ligated into cosmid pVK100. The three resulting recombinant cosmids were electroporated into E. coli HB101, and the three corresponding transformants were mated triparentally with HB101(pRK2013) and CCMB1. Each CCMB1 transconjugate was tested for anaerobic growth in liquid culture with U(VI) as electron acceptor. CCMB1 transconjugates containing complementing subclone D14-2 were restored for U(VI) reduction activity. Complementing subclone D14-2 was sequenced (sixfold coverage) with an ABI 3700 automated sequencer. Initial sequencing primers complementary to the unique cloning site of cosmid pVK100 included pvkF (GAT CCT GGT ATC GGT CTG CGA TTC CGA CTC GTC) and pvkR (GTA CTC CTG ATG ATG CAT GGT TAC TCA CCA CTG CGA TCC). Overlapping internal regions of D14-2 (designated DC1 to -10) were PCR amplified and cloned into broad-host-range plasmid pBBR1MCS (32) for further genetic complementation analyses (Table 1 shows strains and plasmids; see Table S1 in the supplemental material for primers and restriction sites used for subcloning). The altered nucleotide in mutant CCMB1 was identified via PCR amplification of the CCMB1 chromosomal region that corresponded to complementing fragment DC9 of wild-type S. putrefaciens (primers were identical to those used to PCR amplify the DC9 region of wild-type S. putrefaciens). Nucleotide sequencing of the DC9 region of CCMB1 was carried out as described above.

TABLE 1.

Bacterial strains and plasmids used in the present study

Strain or plasmid	Description	Reference
Strains
Shewanella putrefaciens
200R	Spontaneous Rifr derivative of S. putrefaciens (NCIB 12577)	14
CCMB1	U(VI) reduction-deficient ccmB point mutant (H108Y) of 200R	63
ΔccmB	ccmB deletion mutant of 200R	This study
Escherichia coli
S17-1	thi pro recA hsdR [RP4-2Tc::Mu-Km::Tn7] Mob+	56
HB101	F−hsdS20(r− m−) recA13 ara-14 proA2 lacY1 galK2 rpsL20 xyl-5 mtl-1 supE44 λ−; Smr	5
β2155	thrB1004 pro thi strA hsdS lacZΔM15 (F φlacZΔM15 lacIqtraD36 proA+proB+) ΔdapA::erm pir::RP4; Ermr Kmr	12
Plasmids
pRK2013	ColE1 replicon containing RK2 transfer region; Kmr Tra+	23
pVK100	Broad-host-range cosmid, 23 kb; Tcr Kmr Tra+	30
pKO2.0	Suicide vector, 4.5 kb; R6K replicon; mobRP4 sacB Gmr	Burns and DiChristina, submitted
pD14	pVK100 with cloned 34-kb partially digested chromosomal HindIII fragment D14	This study
pD14-1	pVK100 with cloned 15-kb D14-derived HindIII subclone fragment D14-1	This study
pD14-2	pVK100 with cloned 13-kb D14-derived HindIII subclone fragment D14-2	This study
pD14-3	pVK100 with cloned 6-kb D14-derived HindIII subclone fragment D14-3	This study
pBBR1MCS	Broad-host-range cloning vector, 4.7-kb α-lac/multiple cloning site; Cmr	32
pDC1-10	pBBR1MCS with cloned PCR-amplified fragments DC1 thru DC10	This study

In-frame deletion mutagenesis of ccmB.

ccmB was deleted in frame from the S. putrefaciens chromosome according to recently described procedures (J. L. Burns and T. J. DiChristina, submitted for publication). Briefly, 700-bp fragments (CCMB-A and CCMB-B, see Table S1 in the supplemental material) flanking ccmB were PCR amplified with iProof high-fidelity polymerase (Bio-Rad Laboratories, Hercules, CA). CCMB-A and CCMB-B were fused by overlap extension PCR generating fragment CCMB-C. CCMB-C was cloned into pKO2.0 with BamHI and SpeI restriction endonucleases and electroporated into E. coli strain β2155. pKO2.0-CCMB-C was mobilized into recipient 200R via biparental mating. A plasmid integrant was identified by PCR analysis, and the mutation was resolved on LB agar containing sucrose (10%). The in-frame deletion of ccmB in S. putrefaciens (ΔccmB) was verified by PCR amplification with primers flanking the deletion (forward, CGCTTGTTATGATGAGTACCG, and reverse, CCTTGGTGGAGGCAGACTCAT) and DNA sequencing.

Analytical techniques.

Cell growth was monitored by simultaneously measuring cell number and electron acceptor depletion or end product production. Acridine orange-stained cells were counted directly via epifluorescence microscopy (Nikon Diaphot 300 microscope). Fe(III) reduction was monitored by measuring HCl-extractable Fe(II) with the ferrozine technique (58). MnO₂ reduction was monitored by measuring MnO₂ depletion with the benzidine blue colorimetric assay (6). Mn(III) pyrophosphate depletion was monitored spectrophotometrically at 480 nm (31). U(VI) was measured colorimetrically with Arsenazo III reagent (33). NO₂⁻ was measured spectrophotometrically with sulfanilic acid-N-1-naphthylethylene-diamine dihydrochloride reagent (40). Growth on O₂, TMAO, DMSO, fumarate, S₂O₃²⁻, and SO₃²⁻ was monitored by cell growth only. Free thiol equivalents (exposed thiol functional groups [-SH] free to react with Ellman's reagent) were determined with 5,5′-dithio-bis-2-nitrobenzoic acid (17) standardized with reduced glutathione per μg protein. Protein concentration was determined with the Coomassie Plus Bradford assay (Pierce Biotechnology) standardized with bovine serum albumin. Homologous and orthologous protein sequences were identified by BLAST analysis and aligned with ClustalW (1, 27). Membrane topology was predicted in silico with World Wide Web-interfaced software HMMTOP and TopPred2 (9).

Cytochrome detection.

Wild-type and CCMB1 mutant cell cultures were grown on the array of electron acceptors in SM liquid medium supplemented with lactate (30 mM) as a carbon and energy source. Cells were harvested during late logarithmic growth phase and washed three times in anaerobic phosphate-buffered saline (130 mM NaCl, 50 mM sodium phosphate, pH 7.2, 4°C). Cell extracts were prepared as in previously described procedures (18). Briefly, cells were resuspended in cold extraction buffer (50 mM sodium phosphate, 2 mg/ml polymyxin B sulfate, 300 mM NaCl, 5 mM EDTA, pH 7.2, 4°C). The suspension was stirred gently for 1 h at 4°C and centrifuged (Beckman Coulter Optima L-100 XP Ultracentrifuge, 40,000 × g for 20 min at 4°C). Extracts from each sample were collected, and specific cytochrome content was determined by measuring dithionite-reduced-minus-ferricyanide-oxidized difference spectra on a Shimadzu UV-1601 spectrophotometer operated in the split-beam mode. Estimates of total cytochrome content were based on the difference between absorbance values at the peak and trough of the Soret peak standardized per mg total protein (10, 43). Protein fractions were separated by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis on a linear gradient gel (4% to 20% resolving) with 200 μg/ml total protein loaded per well (34). Gels were stained for heme peroxidase activity by being incubated in a solution containing 3,3-dimethoxybenzidine-peroxide (1 μg ml⁻¹) and H₂O₂ (30% stock solution, 0.0025 μl ml⁻¹) (24).

Nucleotide sequence accession number.

The nucleotide sequence of D14-2 has been submitted to the GenBank database under accession number DQ682922.

RESULTS

Genetic complementation analysis of S. putrefaciens respiratory mutant CCMB1.

A transconjugate (designated CCMB1-D14) displaying wild-type U(VI) reduction activity was identified by reapplying the respiratory mutant screen that was originally used to identify U(VI) reduction-deficient mutant CCMB1 (Fig. 1) (63). Subsequent subcloning and anaerobic growth experiments demonstrated that only those subclones containing a wild-type copy of ccmB restored anaerobic growth capability to CCMB1 (see Fig. S1 in the supplemental material). The CCMB1 chromosomal region corresponding to the wild-type DC9 subclone was PCR amplified and sequenced with sixfold coverage. A single nucleotide transversion (H108Y) was identified in ccmB at amino acid position 108 (Fig. 2).

FIG. 1.

U(VI) reduction screening plate from which complementing transconjugate CCMB1-pD14 (second colony from left in fourth row) was identified. Strains 200-pVK100 (colony in top row) and CCMB1-pVK100 (first colony from left in second row) were included as U(VI) reduction-positive and U(VI) reduction-negative control strains, respectively.

FIG. 2.

CcmB amino acid sequence of S. putrefaciens (Sputr) aligned with E. coli (Ecoli), orthologous Ccb206 of Arabidopsis thaliana (Athal), Orf206 of Triticum aestivum (Taest), Orf277 of Marchantia polymorpha (Mpoly), and YejV of Cyanidioschyzon merolae (Cmero). Identical residues are highlighted. H108 of S. putrefaciens and corresponding identical residues are boxed. Predicted transmembrane domains in S. putrefaciens are indicated by bars above the sequence.

Sequence analysis of S. putrefaciens ccmB.

ccmB is the second gene in a five-gene cluster that includes ccmA to -E (Table 2). The ccm gene cluster is conserved among all Shewanella species sequenced to date and, in S. putrefaciens and S. oneidensis MR-1, is flanked by divergently transcribed c-type cytochrome scyA and an operon encoding RNA polymerase subunits. Gene assignments are based on The Institute for Genomic Research's annotation of the MR-1 genome sequence (www.tigr.org) (26). The ccm gene cluster has been studied most extensively in E. coli, and the translated amino acid sequences from the ccmABCDE genes of S. putrefaciens share high similarity with these proteins (40 to 61% identity, 62 to 74% similarity; Table 2).

TABLE 2.

Sequence analysis of S. putrefaciens CcmABCDE gene cluster

ORFd	Shewanella spp.a			Escherichia colib			GenBankc				Putative function
	Sim	ID	E value	Sim	ID	E value	Best hit	Sim	ID	E value
CcmA	84-100	71-100	10−101-10−122	63	46	10−48	Colwellia psychrerythraea	78	64	10−75	ABC transporter, ATP-binding subunit
CcmB	96-100	82-100	10−82-10−97	73	61	10−73	Colwellia psychrerythraea	87	72	10−90	ABC transporter, permease subunit
CcmC	93-100	84-99	10−96-10−134	74	60	10−78	Vibrio fischeri	83	66	10−99	Heme delivery subunit; required for CcmE heme attachment
CcmD	81-100	69-100	10−19-10−32	62	40	10−6	Mannheimia succiniciproducens	71	57	10−12	Membrane protein; CcmCDE complex assembly
CcmE	86-100	81-100	10−40-10−51	69	54	10−18	Vibrio cholerae	77	66	10−26	Heme chaperone; covalently binds heme

^aPercent similarity (Sim), percent identity (ID), and expect value (E value) between S. putrefaciens Ccm amino acid sequences translated from sequenced clone library fragment D14-2. Ranges were determined for S. putrefaciens compared to the completed genome of S. oneidensis MR-1 and draft genomes of Shewanella amazonensis SB2B, Shewanella baltica OS155, Shewanella denitrificans OS217, Shewanella frigidimarina NCIMB 400, S. putrefaciens CN-32, Shewanella sp. strain ANA-3, Shewanella sp. strain MR-4, Shewanella sp. strain PV-4, and Shewanella strain W3-18-1.

^bPercent similarity (Sim), percent identity, and expect value (E value) from S. putrefaciens compared to E. coli.

^cOrganism outside the genus Shewanella with the ortholog of highest similarity to S. putrefaciens (best hit) determined by BLASTP analysis of the GenBank nonredundant database.

^dS. putrefaciens open reading frames translated from chromosomal DNA fragment D14-2.

Topology prediction analysis indicated that CcmB contains six transmembrane helices (Fig. 2). Based on similarity to previous results of C-terminal tagging analysis and prior topology models in E. coli, the N and C termini of CcmB in S. putrefaciens are both predicted to face the cytoplasm (11, 25). Residue H108 is predicted to reside at the interface of a cytoplasmic loop and the third transmembrane helix. Residue H108 of S. putrefaciens CcmB is highly conserved among alpha-, beta- and gammaproteobacteria (Fig. 2) and is one of six CcmB residues strictly conserved among several land plant mitochondrial orthologs such as those found in Marchantia polymorpha, Arabidopsis thaliana, Triticum aestivum, and Oenothera berteriana and in the red alga Cyanidioschyzon merolae (20).

Respiratory mutant CCMB1 retains the ability to respire on electron acceptors with high (but not low) reduction potentials (E′₀).

To determine the overall respiratory capability of CCMB1, anaerobic growth experiments were carried out on a set of 13 electron acceptors. CCMB1 retained the ability to grow at wild-type rates with O₂, MnO₂, Mn(III) pyrophosphate, NO₃⁻, and Fe(III) citrate, yet was severely impaired for growth on NO₂⁻, U(VI), DMSO, TMAO, fumarate, Fe(III) oxide, SO₃²⁻, or S₂O₃²⁻ as an electron acceptor (Fig. 3; see also Fig. S2 in the supplemental material). CCMB1 transconjugates containing plasmid pDC9 in trans displayed wild-type rates of growth and reduction of each electron acceptor (see Fig. S2 in the supplemental material). CCMB1 was unable to grow at wild-type rates on electron acceptors with E′₀ values below a threshold value of approximately 0.36 V (NO₂⁻/NH₄⁺ couple) (Fig. 4; see also Fig. S2 in the supplemental material). CCMB1 grew at wild-type rates on NO₃⁻ yet was unable to grow on NO₂⁻. After stoichiometric reduction of NO₃⁻ to NO₂⁻, growth of the wild-type strain continued on NO₂⁻ until all NO₂⁻ was depleted (see Fig. S2D in the supplemental material). CCMB1, on the other hand, was able to grow at wild-type rates on NO₃⁻ and to stoichiometrically convert NO₃⁻ to NO₂⁻ at a rate similar to that of the wild-type strain, yet was unable to sustain growth or deplete NO₂⁻ after all NO₃⁻ was reduced. CCMB1 cell density and NO₂⁻ concentrations remained unchanged after NO₃⁻ was completely reduced to NO₂⁻.

FIG. 3.

Growth rate of CCMB1 on a set of 13 electron acceptors (rates normalized to the wild-type strain of S. putrefaciens). Wild-type growth rates are as indicated (h⁻¹): O₂, 1.39; MnO₂, 0.71; Mn(III) pyrophosphate, 0.32; NO₃⁻, 0.38; Fe(III) citrate, 0.21; NO₂⁻, 0.23; DMSO, 0.87; TMAO, 0.36; fumarate, 0.91; U(VI), 0.04; SO₃²⁻, 0.18; γ-FeOOH, 0.25; S₂O₃²⁻, 0.14. See Fig. S1 in the supplemental material for individual growth curves. Error bars represent the standard deviations of three parallel yet independent incubations.

FIG. 4.

Reduction potential (E′₀) of electron acceptors included in the present study. E′₀ values were obtained from published values for the indicated couples at neutral pH. CCMB1 displayed wild-type growth rates on the set of electron acceptors that are boxed. DMS, dimethyl sulfide.

CCMB1 contains low c-type cytochrome content.

CCMB1 retained the ability to grow anaerobically on electron acceptors with high E′₀ [MnO₂, Mn(III) pyrophosphate, NO₃⁻, and Fe(III) citrate]. To determine if CCMB1 produced c-type cytochromes at wild-type levels during growth on these electron acceptors, the cytochrome content of CCMB1 cell extracts was determined via reduced-minus-oxidized difference spectra and by staining SDS-polyacrylamide gels for covalently attached heme (Fig. 5; see also Table S2 in the supplemental material). For comparison, wild-type S. putrefaciens cells were grown and extracts were prepared under identical conditions. Prominent c-type cytochrome bands in the heme stain and pronounced reduced-minus-oxidized difference spectra at 552 nm were observed for wild-type cells grown on Fe(III) citrate and fumarate. The cytochrome content of CCMB1, however, was nearly undetectable for cells grown on any electron acceptor (Fig. 5). Wild-type levels of mature cytochrome c, therefore, do not appear essential for anaerobic growth on electron acceptors with high E′₀.

FIG. 5.

Analysis of cytochrome content of wild-type S. putrefaciens and respiratory mutant CCMB1. (A and B) SDS-polyacrylamide gel electrophoresis heme stains of periplasmic fractions of S. putrefaciens (A) and CCMB1 (B) cells grown on the indicated electron acceptors. Horse heart cytochrome c was included as a positive control. Molecular mass markers (daltons) are indicated with arrows. (C) Reduced-minus-oxidized difference spectra of cell extracts from S. putrefaciens (spectra 1 and 2) and CCMB1 (3 and 4) grown on Fe(III) citrate (1 and 3) and fumarate (2 and 4). The scale bar corresponds to absorbance units.

Thiol content of the CCMB1 periplasm is slightly greater than that of the wild-type strain.

Previous studies with a variety of other proteobacteria containing ccm mutations indicated that periplasmic redox homeostasis was disrupted (2, 8). To determine if the periplasm of CCMB1 was more oxidizing or reducing than the wild-type strain, the thiol (-SH) content in periplasmic extracts of CCMB1 and wild-type S. putrefaciens cells was determined after growth on 13 alternate electron acceptors. The thiol content of periplasmic extracts from S. putrefaciens after growth on O₂, NO₃⁻, NO₂⁻, TMAO, DMSO, Mn(III) pyrophosphate, and MnO₂ ranged from 40 to 238 pmol μg protein⁻¹ (Fig. 6). Although CCMB1 grew on NO₂⁻, TMAO, and DMSO at rates less than 25% of that of the wild-type strain, the periplasmic thiol concentration of CCMB1 grown on the identical set of electron acceptors was slightly greater than that of the wild-type strain (Fig. 6). Periplasmic fractions could not be recovered from CCMB1 cultures grown on U(VI), SO₃²⁻, γ-FeOOH, or S₂O₃²⁻ as electron acceptor due to low growth rates (and correspondingly low cell yields) under these growth conditions (data not shown). Periplasmic extracts from the wild-type strain contained the highest thiol content after growth on γ-FeOOH, SO₃²⁻, or S₂O₃²⁻ as electron acceptor, ranging from 682 to 1,130 pmol μg protein⁻¹ (approximately 5 to 10 times greater than those of the other electron acceptors). Overall, the periplasmic extracts recovered from CCMB1 contained a slightly greater concentration of thiol groups than the wild-type strain did (Fig. 6).

FIG. 6.

Free thiol content of periplasmic fractions of S. putrefaciens and CCMB1 cells grown on the indicated electron acceptors. The box below the bar graph indicates CCMB1 growth ability on the electron acceptor (^a). +, growth rate >80% of wild-type rate; −, growth rate <25% of wild-type rate.

The CcmB deletion mutant is incapable of anaerobic growth on any electron acceptor.

An in-frame deletion mutant of ccmB (ΔccmB) was constructed and subsequently tested for growth on the entire suite of 13 electron acceptors respired by the wild-type strain. The ΔccmB strain was unable to grow anaerobically on any electron acceptor, yet retained the ability to grow aerobically (see Fig. S3 in the supplemental material). Transconjugates of the ΔccmB strain, containing a wild-type copy of ccmB in trans, were restored for the ability to respire at wild-type rates on all electron acceptors (see Fig. S3 in the supplemental material).

DISCUSSION

The main objective of the present study was to identify the gene mutated in CCMB1, an S. putrefaciens respiratory mutant originally isolated for its inability to respire U(VI) as anaerobic electron acceptor. Subcloning and nucleotide sequence analyses indicate that CCMB1 contains an H108Y mutation in a protein similar to the CcmB permease subunit of an ABC transporter required for cytochrome c maturation in E. coli (system I). CcmABC works in concert with membrane protein CcmD and heme chaperone CcmE to transfer heme to apocytochrome c (59).

S. putrefaciens respiratory mutant CCMB1 grows on electron acceptors with E′₀ values greater than a threshold level of approximately 0.36 V [O₂, Fe(III) citrate, MnO₂, Mn(III) pyrophosphate, and NO₃⁻]. This finding is unexpected for several reasons. First, anaerobic respiration by S. oneidensis on Fe(III) citrate, MnO₂, and NO₃⁻ as electron acceptor involves several c-type cytochromes including CymA, MtrA, MtrC, and OmcA (3, 41, 44, 50). Second, ccmC mutants of S. oneidensis are unable to produce mature cytochrome c or grow anaerobically on U(VI), fumarate, TMAO, DMSO, Fe(III) citrate, MnO₂, NO₃⁻, or NO₂⁻ as electron acceptor (4, 39). Several possibilities may explain these differences in the anaerobic growth capability of the Shewanella ccm mutants: (i) S. putrefaciens ccmB and S. oneidensis ccmC mutant genotypes display different respiratory deficiencies, (ii) S. putrefaciens contains cytochrome c-independent respiratory pathways, or (iii) replacement of the histidine residue at position 108 with tyrosine permits limited, but sufficient, CcmB activity to sustain growth of CCMB1 on electron acceptors with high E′₀. Results from the present study favor the third possibility. The ΔccmB deletion mutant does not respire anaerobically on any electron acceptor, indicating that anaerobic electron transport pathways in S. putrefaciens require mature c-type cytochromes. Point mutant CCMB1, on the other hand, retains growth on anaerobic electron acceptors with an E′₀ of >0.36 V, despite lacking the ability to produce c-type cytochromes at detectable levels. These findings suggest that the H108Y CcmB mutant may retain partial Ccm activity and produce low levels of mature cytochrome c that are adequate to sustain wild-type growth rates on electron acceptors above a threshold E′₀.

Mutations in ccmA, ccmB, or ccmC in other bacteria often result in mutant phenotypes not associated with cytochrome c activity. Legionella pneumophila CcmB and CcmC mutants, for example, display defective iron acquisition capability and aberrant virulence phenotypes (8, 45, 62). Pseudomonas fluorescens CcmC mutants are unable to complete synthesis of the siderophore pyoverdine (2). CcmC mutants of Pantoea citrea, Gluconacetobacter diazotrophicus, and Pseudomonas putida are unable to oxidize gluconate and 2-ketogluconate, synthesize indole-3-acetic acid, or isomerize (cis-trans) unsaturated fatty acids, respectively (28, 36, 51). The seemingly unrelated Ccm mutant phenotypes are postulated to reflect improper redox homeostasis in the periplasm (2, 8).

To determine if CcmB plays a similar role in maintaining periplasmic redox homeostasis in S. putrefaciens, CCMB1 and wild-type S. putrefaciens were grown on the suite of 13 electron acceptors and free thiol content was determined in the corresponding periplasmic fractions. The wild-type strain contained approximately 100 pmol μg protein⁻¹ free thiol after growth on O₂, NO₃⁻, Mn(III) pyrophosphate, and Mn(IV). Free thiol content was approximately two to three times greater after growth on NO₂⁻, TMAO, DMSO, Fe(III) citrate, and fumarate and approximately 10 times greater after growth on γ-FeOOH, SO₃²⁻, and S₂O₃²⁻. The pattern of free thiol content in the wild-type strain reflects the ability of CCMB1 to grow on electron acceptors with an E′₀ of >0.36 V (NO₃⁻/NO₂⁻ threshold). Periplasmic redox conditions corresponding to a free thiol content of >300 pmol μg protein⁻¹ require wild-type CcmB activity to sustain growth. These results parallel those obtained with P. fluorescens ccmC mutants that are unable to complete pyoverdine biosynthesis (2). The periplasm of the P. fluorescens mutant strain was abnormally reducing and contained high free thiol content.

Increased free thiol in the periplasm of CCMB1 after growth on electron acceptors with low E′₀ may result from several factors. First, the low redox poise associated with growth of CCMB1 on electron acceptors with low E′₀ may result in inadvertent reduction of disulfide bonds that otherwise remain unaltered in the wild-type strain. In contrast, the redox poise associated with growth of CCMB1 on electron acceptors with high E′₀ does not dramatically alter disulfide bond formation. Second, increased periplasmic free thiol content in CCMB1 may reflect an overabundance of periplasmic apocytochrome c (i.e., immature cytochrome c with CXXCH heme binding motifs not bound by heme). Finally, CcmABC may mediate periplasmic redox homeostasis via an as-yet-unknown mechanism (2, 8).

The present study is the first to identify an amino acid residue critical for CcmB function. Residue H108 is conserved in >88% of the 185 bacterial and land plant mitochondrial CcmB orthologs currently available in the nonredundant database. Residue H108 may therefore play a pivotal role in CcmB activity. Membrane protein topology prediction in S. putrefaciens indicates that residue H108 is found at the interface of a hydrophobic transmembrane helix and a hydrophilic cytoplasmic loop, well situated for controlling CcmB complex formation with other Ccm subunits or for allocrite recognition and subsequent transport across the cytoplasmic membrane. The identity of the CcmB allocrite in E. coli, however, remains controversial. Initial studies of E. coli indicate that heme is the CcmB allocrite and that CcmABC functions as a high-affinity heme transporter (21, 22). More recent results suggest that E. coli CcmABC drives the release of holo-CcmE (CcmE with covalently attached heme) from CcmC by coupling the release with ATP hydrolysis (22). Current work is aimed at identifying the CcmABC allocrite and determining the role that H108 plays in cytochrome c maturation in S. putrefaciens.