Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2006 Oct 6;189(4):1366–1381. doi: 10.1128/JB.01013-06

Time-Resolved Determination of the CcpA Regulon of Lactococcus lactis subsp. cremoris MG1363▿

Aldert L Zomer 1, Girbe Buist 1,†, Rasmus Larsen 1,‡, Jan Kok 1, Oscar P Kuipers 1,*
PMCID: PMC1797362  PMID: 17028270

Abstract

Carbon catabolite control protein A (CcpA) is the main regulator involved in carbon catabolite repression in gram-positive bacteria. Time series gene expression analyses of Lactococcus lactis MG1363 and L. lactis MG1363ΔccpA using DNA microarrays were used to define the CcpA regulon of L. lactis. Based on a comparison of the transcriptome data with putative CcpA binding motifs (cre sites) in promoter sequences in the genome of L. lactis, 82 direct targets of CcpA were predicted. The main differences in time-dependent expression of CcpA-regulated genes were differences between the exponential and transition growth phases. Large effects were observed for carbon and nitrogen metabolic genes in the exponential growth phase. Effects on nucleotide metabolism genes were observed primarily in the transition phase. Analysis of the positions of putative cre sites revealed that there is a link between either repression or activation and the location of the cre site within the promoter region. Activation was observed when putative cre sites were located upstream of the hexameric −35 sequence at an average position of −56.5 or further upstream with decrements of 10.5 bp. Repression was observed when the cre site was located in or downstream of putative −35 and −10 sequences. The highest level of repression was observed when the cre site was present at a defined side of the DNA helix relative to the canonical −10 sequence. Gel retardation experiments, Northern blotting, and enzyme assays showed that CcpA represses its own expression and activates the expression of the divergently oriented prolidase-encoding pepQ gene, which constitutes a link between regulation of carbon metabolism and regulation of nitrogen metabolism.


Carbon catabolite repression (CCR), a well-known regulatory mechanism by which bacteria regulate the metabolism of carbon and other energy sources, has been the subject of intense study for the last three decades. In gram-positive bacteria, CCR is mediated by carbon catabolite control protein A (CcpA) (57). The unrelated transcription factor cyclic AMP receptor protein (CRP) is responsible for CCR in gram-negative bacteria (40). In addition to CCR, CcpA has been found to be required for positive regulation (carbon catabolite activation) of the expression of genes encoding enzymes involved in glycolysis in Bacillus subtilis (4) and Lactococcus lactis (32).

Positive and negative regulation of the transcription of CcpA-regulated genes involves the binding of CcpA to cis-acting catabolite responsive elements (cre sites) (47). The binding of CcpA to a cre site is strongly stimulated by HPr when the latter compound is phosphorylated at Ser46 (HPr-Ser46p) (45). CcpA binds to DNA as a heterotetramer with one HPr-Ser46p protein per CcpA subunit (45). A second HPr-like protein in B. subtilis, Crh, has been shown to be functional in CCR and could partially take over the function of HPr (46). It has been suggested that Crh might be specifically involved in repression of metabolic genes by nonsugars (56).

Different mechanisms have been suggested for the repression of target genes in B. subtilis by CcpA; these mechanisms include inhibition of transcription initiation (13, 24) and “roadblocking” of the transcription machinery (6, 19). Recently, it has been reported that B. subtilis CcpA interacts with RNA polymerase (RNAP), causing inhibition of transcription initiation (25). For this interaction to occur, the cre site must be present at a specific face of the DNA helix. Previous research has shown that for transcriptional activation of ackA by CcpA in B. subtilis, a cre site must be present upstream of the −35 sequence in the ackA promoter, specifically at position −56.5 (49). Transcriptional activation of the ackA gene by CcpA was abolished when a 5-bp fragment was inserted between cre and the ackA promoter, while insertion of a 10-bp fragment did not have a negative effect on transcription (49). This phenomenon has also been demonstrated for class I activators in Escherichia coli, where the activator binding site must be on the same face of the DNA helix as the RNAP binding site to achieve transcriptional activation. It has been shown that for transcriptional activation of the ppsA gene by the CcpA homolog Cra in E. coli, the Cra binding site must be centered at position −45.5 (38).

Less is known about carbon catabolite control by CcpA in L. lactis. The known targets of L. lactis CCR are the gal operon for galactose utilization (32), the fru operon for fructose utilization (3), and the noxE gene (NADH oxidase) (12). Furthermore, it has been proposed by Guedon et al. (16) that lactococcal pepP (aminopeptidase P) is regulated by CcpA. A known target of L. lactis carbon catabolite activation is the las operon (32), and it has been suggested that CcpA also activates the expression of the fhuR (heme uptake regulator) regulatory protein under respiration-permissive conditions (12).

Since CcpA has been shown to be able to act both as a repressor and as an activator, analysis of the exact locations of the cre sites relative to the RNAP binding sites and a comparison of the in silico data obtained with in vivo experiments involving, for example, transcriptome analysis could provide new insights into the activation and repression mechanisms of CcpA.

CcpA-mediated CCR in B. subtilis has been extensively studied using various techniques, including DNA microarray analysis and proteomics techniques. A genome-wide transcriptome comparison of a wild-type strain and a ccpA knockout mutant of a lactic acid bacterium has not been reported yet. As lactic acid bacteria (LAB) live in natural environments (e.g., milk, silage, and gastrointestinal tracts) that are substantially different from the environment in which B. subtilis normally resides (soil), we anticipate that there are differences in the types of genes regulated by the CcpA proteins of these organisms. For Streptococcus thermophilus, which commonly resides in the same niche as L. lactis, the importance of the CcpA protein for adaptation to growth in milk and for the use of lactose as the primary carbon source has already been shown (52).

Completion of the genome sequence of L. lactis MG1363 (U. Wegmann, M. O'Connell-Motherway, A. L. Zomer, et al., unpublished results) allowed us to perform full genome transcriptome analyses of L. lactis MG1363 using L. lactis MG1363 DNA microarrays. This nucleotide sequence also made it possible to search for possible cre sites in the coding and noncoding regions of the L. lactis MG1363 genome.

In transcriptome studies of carbon catabolite control by the CcpA protein in other gram-positive bacteria, workers have focused on regulation of gene expression in the exponential growth phase (4, 31, 37, 58). We expected to be able to extract more information by studying the transcriptome in all growth phases, and we focused on CcpA-mediated regulation of L. lactis MG1363 gene expression not only in the exponential phase but also at the onset of the exponential phase, at the transition between the exponential growth phase and the stationary phase, and in the stationary phase.

We found that CcpA is a key regulator in L. lactis and that both the “interaction” mechanism and the “roadblocking” mechanism of gene regulation may play significant roles in CcpA-mediated carbon catabolite repression in L. lactis. Furthermore, we identified a link between carbon metabolism regulation and nitrogen metabolism regulation via activation of pepQ by CcpA.

MATERIALS AND METHODS

Bacterial strains, plasmids, and growth conditions.

Relevant information concerning the plasmids and strains used in this study is shown in Table 1. L. lactis was grown at 30°C or 38°C in GM17 medium (Difco Laboratories, Detroit, MI) as standing cultures or on agar plates containing 1.5% (wt/vol) agar. L. lactis was also grown in chemically defined medium (CDM) (21) supplemented with Casitone (Difco Laboratories) at a concentration of 0.2% or 2% (wt/vol). All media were supplemented with 0.5% (wt/vol) glucose, while 4 μg/ml chloramphenicol (Sigma Chemical Co., St. Louis, MO), 5 μg/ml erythromycin (Roche Molecular Biochemicals, Mannheim, Germany), or 0.008% 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-Gal) (Sigma Chemical Co.) was added when appropriate. Escherichia coli was grown in TY medium (Difco Laboratories) at 37°C with vigorous agitation or on TY medium solidified with 1.5% agar; 100 μg/ml erythromycin or 100 μg/ml ampicillin (Roche Molecular Biochemicals) and 0.002% X-Gal were added when necessary.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmid Relevant phenotype or genotype Reference or source
L. lactis strains
    MG1363 L. lactis subsp. cremoris, plasmid-free derivative of NCDO712 11
    MG1363ΔccpA MG1363, chromosomal deletion of ccpA This study
E. coli strains
    EC1000 Kmr, glgB, derivative of MC1000 containing repA gene of pWV01 28
    XL1-Blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F′ proAB lacIqZΔM15 Tn10 (Tetr)] Stratagene
Plasmids
    pORI280 Emr, β-Gal+, ori+ of pWV01; integration vector that replicates in strains containing repA 28
    pVE6007 Cmr, pWV01 derivative encoding a temperature-sensitive RepA protein 33
    pORI280::ΔccpA pORI280 derivative carrying ccpA up- and downstream regions This study
    pILORI4 Emr, pIL252 carrying the multiple cloning site and promoterless lacZ of pORI13 27
    pILORIAZ pILORI4 carrying 280-bp ccpA promoter fragment This study
    pILORIQZ pILORI4 carrying 280-bp pepQ promoter fragment This study
    pQE30-ccpA Ampr, pQE30 carrying ccpA from L. lactis IL1403 26

DNA techniques and transformation.

Molecular cloning techniques were performed essentially as described by Sambrook et al. (43). Restriction enzymes, T4 DNA ligase, Expand DNA polymerase, Taq DNA polymerase, and PWO DNA polymerase (Roche Molecular Biochemicals) were used according to the instructions of the supplier. Synthetic oligonucleotides were synthesized at Isogen Life Science (Ijsselstein, The Netherlands). PCR products were purified using a High Pure PCR product purification kit (Roche Molecular Biochemicals). Plasmid DNA was introduced into E. coli and L. lactis by electrotransformation as described by Zabarovsky et al. (59) and Leenhouts et al. (29), respectively. Analytical grade chemicals were obtained from Merck (Darmstadt, Germany) or BDH (Poole, United Kingdom).

Construction of a ccpA mutant of L. lactis.

The ccpA deletion mutation was introduced into L. lactis subsp. cremoris MG1363 using plasmids pVE6007 (33) and pORI280 (28) in a double-crossover procedure, as described by Leenhouts et al. (28). E. coli EC1000 (RepA+) was used as the intermediate host during vector construction. The ccpA upstream region was amplified with primers RLTRXB1 and RLCCPA1 (see Table P1 posted at http://molgen.biol.rug.nl/publication/ccpA_data) using Expand polymerase and was cloned as an XbaI/BamHI fragment in the corresponding sites in pORI280. The ccpA downstream region was amplified using primers HE74 and HE51 (see Table P1 posted at http://molgen.biol.rug.nl/publication/ccpA_data) and was cloned as a BamHI/EcoRI fragment in the vector carrying the upstream fragment, resulting in plasmid pORI280::ΔccpA. The deletion plasmid was introduced into L. lactis MG1363(pVE6007). The deletion strain was obtained in two steps as described previously (28). First, integration and deletion of helper plasmid pVE6007 were performed at the nonpermissive temperature (38°C) and were confirmed by Southern blotting, colony PCR, and determination of the sensitivity of the strains to chloramphenicol; second, excision and deletion of the integration vector were performed by growth of the integrant in the absence of antibiotic for at least 100 generations at 30°C. The genetic structure of the resulting ccpA deletion strain, L. lactis MG1363ΔccpA, was confirmed by colony PCR, Southern blotting, and determination of the sensitivity of the strain to erythromycin.

Cloning of ccpA and pepQ promoter fragments.

Oligonucleotides used to amplify the region between the divergent ccpA and pepQ genes are shown in Table P1 posted at http://molgen.biol.rug.nl/publication/ccpA_data. Primers ccpA-pepQ-fw and ccpA-pepQ-rev were used to amplify chromosomal DNA of L. lactis MG1363, which yielded the promoter regions of ccpA and pepQ. The PCR product was cut with XbaI and was inserted into the corresponding site upstream of the promoterless lacZ gene in pILORI4 (27), and the ligation mixture was used to transform L. lactis MG1363. Plasmids containing the ccpA-pepQ intergenic region in both orientations were obtained and were introduced into L. lactis MG1363ΔccpA. The plasmid with the ccpA promoter and the plasmid carrying the pepQ promoter upstream of lacZ were designated pILORIAZ and pILORIQZ, respectively.

Northern blotting and primer extension.

RNA was isolated from exponentially growing L. lactis cells at an optical density at 600 nm of 0.5 as previously described (50). Northern blot analysis was performed as described previously (42) with PCR products generated using primers pepq_avrnco and pepq_spe and primers RL16srna1 and RL16srna2 (see Table P1 posted at http://molgen.biol.rug.nl/publication/ccpA_data). A synthetic oligonucleotide (pepQTS2 [see Table P1 posted at http://molgen.biol.rug.nl/publication/ccpA_data]) complementary to pepQ mRNA was used for primer extension analysis. Two picomoles of primer was added to 5 μg of total RNA in a reaction mixture containing 0.5 mM dCTP, 0.5 mM dGTP, 0.5 mM dTTP, 0.05 mM dATP, and α-35S-labeled dATP. cDNA was synthesized using SuperScript transcriptase (Roche Molecular Biochemicals). Following 50 min of incubation at 42°C, the reaction was stopped by heating the mixture at 70°C for 15 min. The primer extension product was compared on a sequencing gel with the products of a sequencing reaction in which the same primer was used.

Expression and purification of H6-CcpA.

His-tagged CcpA from L. lactis IL-1403 (H6-CcpA) was purified from E. coli essentially as described previously (26), with the following modifications. An overnight culture of E. coli strain XL1-Blue with a plasmid expressing H6-CcpA was diluted 1:50 into fresh TY medium supplemented with 100 μg of ampicillin/ml and grown at 37°C with vigorous shaking. At an A600 of 0.6, expression of the recombinant protein was induced with 1 mM isopropyl-β-d-thiogalactoside (IPTG) (Roche Molecular Biochemicals). The culture was incubated for an additional 4 h, after which the cells from 600 ml of the culture were collected by centrifugation (10 min, 8,000 rpm, 4°C) with an Avanti J-20 XP centrifuge (Beckmann Coulter, Mijdrecht, The Netherlands). The pellet was washed with 50 ml of buffer A (50 mM NaHPO4, 300 mM NaCl, 10 mM imidazole, 3.5% glycerol, 1 mM β-mercaptoethanol; pH 8.0) and stored at −80°C until it was used. The pellet was resuspended in 10 ml of buffer A, and the cells were disrupted by sonication. Cellular debris was removed by centrifugation (30 min, 20,000 g, 4°C), and the supernatant fraction was purified as described previously (26). The purified protein sample (1 ml) was dialyzed three times in 1 liter of a buffer containing 10% glycerol, 100 mM NaCl, and 20 mM Tris-HCl (pH 8) at 0°C to remove excess salts. The purified protein was examined to determine its protein content and purity by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and to determine its DNA content by ethidium bromide staining on agarose gels. The protein was quantified using an RC/DC protein determination kit according to the instructions of the supplier (Bio-Rad Laboratories, Richmond, CA).

EMSA.

DNA fragments containing the ccpA and pepQ promoters were prepared by PCR using primers ccpA-pepQ-fw and ccpA-pepQ-rev (see Table P1 posted at http://molgen.biol.rug.nl/publication/ccpA_data). Electrophoretic mobility shift assays (EMSAs) were performed essentially as described previously (18). The PCR products were end labeled with T4 polynucleotide kinase (Roche Molecular Biochemicals) and [γ-32P]ATP. The protein and probe were mixed on ice and subsequently incubated for 20 min at 30°C. Samples were loaded onto 6% nondenaturing polyacrylamide gels prepared in TAE buffer (40 mM Tris acetate [pH 8.0], 2 mM EDTA) and electrophoresed in a 0.5× to 2.0× gradient of TAE buffer at 100 V for 60 min in a Mini Protean electrophoresis unit (Bio-Rad Laboratories). The gels were dried with a vacuum dryer (model 583; Bio-Rad Laboratories), and signals were recorded using phosphoscreens and a Cyclone PhosphorImager (Packard Instruments, Meridien, CT).

DNA microarray experimental procedures.

DNA microarrays containing amplicons of 2,457 annotated genes in the genome of L. lactis subsp. cremoris MG1363 were designed and made as described previously (54). Slide spotting, slide treatment after spotting, and slide quality control were performed as described previously (53). Samples used for RNA isolation were obtained by rapid sampling of early- and mid-exponential-phase, transition-phase, and stationary-phase cultures of L. lactis. Cell disruption, RNA isolation, RNA quality control, cDNA (target) synthesis, indirect labeling, hybridization, and scanning were performed as described by van Hijum et al. (53).

Statistical procedures.

DNA microarray data were processed as previously described (9, 53, 55), with the following modifications. The minimum and maximum numbers of measurements for each gene were five and eight (i.e., one experimental condition for which four independent RNA isolations were performed), respectively.

Differential expression tests were performed with the Cyber-T implementation of a variant of the t test (30). False discovery rates were calculated as described previously (53). A gene was considered differentially expressed when the P value was <0.001, the false discovery rate was <0.05, and ratio was >2 or <0.55. The DNA microarray data are available at http://molgen.biol.rug.nl/publication/ccpa_data.

Promoter predictions.

Locations of SigmaA binding sites in the genome sequence of L. lactis MG1363 were predicted using hidden Markov models of the SigmaA binding site, allowing 15 to 19 bp of space between the canonical −35 and −10 promoter elements. The models were based on known Sigma A binding sites (22, 51) (see the data at http://molgen.biol.rug.nl/publication/ccpa_data). The presence of cre sites was examined using a weight matrix based on known cre sites (2) with the MotifLocator tool (1). Promoter searches were performed for sequences up to 400 bp upstream of the translational start site of each gene and for the sequences of all open reading frames present in the L. lactis MG1363 genome. Locations of cre sites were calculated on the basis of the position of the hexameric −10 region. When possible, the predicted −35 and −10 regions were compared with previously published data for transcriptional start site (TSS) determinations and were adjusted accordingly.

Enzyme assays.

β-Galactosidase activity assays were performed using cell suspensions from exponentially growing L. lactis cultures. Cells were permeabilized with chloroform as described previously (20). For prolidase activity assays cell extracts were prepared as described previously (44), and prolidase enzyme activity was measured essentially as described previously (39).

RESULTS

Global analysis of the L. lactis MG1363ΔccpA transcriptome using functional categories.

To identify the genes whose expression in rich medium with glucose (GM17) changed when the ccpA gene was deleted, the transcriptional profile of L. lactis MG1363 was compared to that of L. lactis MG1363ΔccpA in four distinct phases of growth, the early exponential growth phase, the mid-exponential growth phase, the transition phase between the exponential and stationary growth phases, and the stationary phase of growth. Although the final turbidities of L. lactis MG1363 and L. lactis MG1363ΔccpA cultures were identical and the optical densities at 600 nm were as high as 2.2, deletion of the gene encoding the CcpA protein had a significant effect on the rate of growth of L. lactis in GM17. Therefore, samples used for RNA isolation were taken from the cultures at comparable growth phases (Fig. 1). The results of the analysis of the transcriptomes of the two strains at the four times during growth are shown in Table 2, which shows that repression by CcpA occurred more frequently than activation occurred. The strongest effect of deletion of ccpA was observed in the transition phase since most genes were affected by the ccpA mutation in this growth phase.

FIG. 1.

FIG. 1.

Growth of L. lactis and its isogenic ccpA mutant in GM17: growth curves for L. lactis MG1363 (⧫) and L. lactis MG1363ΔccpA (▪). Times at which samples were collected for RNA isolation in the early exponential phase (E), the mid-exponential phase (M), the transition phase between the exponential and stationary phases (T), and the stationary phase (S) are circled. OD600, optical density at 600 nm.

TABLE 2.

Numbers of genes significantly affected by deletion of ccpA in L. lactis in different COG categoriesa

Functional category No. of genes affected
Early exponential phase
Mid-exponential phase
Transition phase
Stationary phase
Up- regulation Down- regulation Up- regulation Down- regulation Up- regulation Down- regulation Up- regulation Down- regulation
J. Translation, ribosomal structure, and biogenesis 0 2 1 2 6 2 0 5
K. Transcription 3 2 3 2 7 3 1 2
L. DNA replication, recombination, and repair 1 0 0 0 4 3 0 1
D. Cell division and chromosome partitioning 0 0 0 0 0 0 0 0
V. Defense mechanisms 2 0 2 0 0 3 0 0
O. Posttranslational modification and protein turnover 0 0 1 1 1 2 2 4
M. Cell envelope biogenesis, outer membrane 2 0 1 2 1 0 1 0
P. Inorganic ion transport and metabolism 1 5 2 0 5 2 0 3
U. Intracellular trafficking and secretion 0 0 0 1 0 2 0 1
N. Cell motility 0 0 0 0 0 0 0 0
T. Signal transduction mechanisms 3 0 3 0 2 2 0 2
F. Nucleotide transport and metabolism 0 9 0 1 15 0 0 1
G. Carbohydrate transport and metabolism 28 10 22 1 12 9 2 10
E. Amino acid transport and metabolism 11 4 16 2 9 11 0 8
H. Coenzyme metabolism 2 2 3 1 3 4 0 2
I. Lipid metabolism 2 0 2 0 2 3 0 0
C. Energy production and conversion 8 0 3 0 4 3 3 7
Q. Secondary metabolite transport and metabolism 1 0 1 0 2 0 0 0
W. Extracellular structures 0 0 1 0 1 0 0 0
R. General function prediction only 7 2 7 2 12 1 1 3
S. Function unknown 3 2 3 0 3 4 1 4
X. No prediction 16 0 11 1 5 9 1 8
Totalb 85 33 70 16 88 60 12 58
a

For upregulation there was at least a 2-fold increase and for downregulation there was at least a 1.8-fold decrease in the level of expression, and the data met the statistical criterion of a Bayesian P value of less than 0.001 according to the Cyber-t test.

b

Some genes are assigned to multiple categories.

So that we could interpret the results more globally, the genes were grouped on the basis of the putative functions of the encoded proteins (48). Most of the affected genes were in the COG functional category “carbohydrate transport and metabolism.” A large number of genes in the COG functional category “amino acid transport and metabolism” were also affected by the absence of CcpA, suggesting that the protein also has an effect on the regulation of nitrogen metabolism and proteolysis (Table 2).

It is clear that CcpA activity occurred mainly in and around the exponential growth phase (early exponential phase, mid-exponential phase, and transition phase), while the role of CcpA in the stationary phase of growth was reduced. This observation is in accordance with the absence of ccpA mRNA in L. lactis MG1363 growing in the stationary phase, which is clear from the absolute levels of expression of ccpA on the DNA microarrays (see Table S1 posted at http://molgen.biol.rug.nl/publication/ccpA_data).

Growth phase-dependent regulation by CcpA.

Although there was a major overlap between the transcriptome in the exponential growth phase and the transcriptomes in other growth phases, a large number of genes were regulated exclusively in one growth phase (Fig. 2). Deletion of ccpA changed the expression of 49 genes exclusively in the early exponential phase, 24 genes exclusively in the mid-exponential growth phase, 114 genes exclusively in the transition phase, and 50 genes exclusively in the stationary growth phase. Some examples of regulation over time are discussed below.

FIG. 2.

FIG. 2.

Venn diagram of genes significantly differentially expressed in L. lactis MG1363ΔccpA and its parent during growth, as generated by Vennmaster (23). The numbers of genes in the intersection sets are indicated. E, early exponential growth phase, M, mid-exponential growth phase, T, transition phase; S, stationary phase.

The strongest repression by CcpA was observed for the galPMKTE and mtlARFD operons, both of which are involved in the uptake of carbon sources (the monosaccharide galactose [14] and the polyol mannitol [10], respectively). Repression of both of these operons by CcpA occurred throughout the first three growth phases (early exponential phase, mid-exponential phase, and transition phase), as shown in Table 3, and part of the mtl operon, mtlARD, was repressed even in the stationary phase. Repression of the trehalose utilization operon, llmg0453, llmg0454, trePP, and pgmB also occurred in the first three growth phases (early exponential phase, mid-exponential phase, and transition phase), although the level of repression was lower than that for galPMKTE and mtlARFD. Repression of a putative cellobiose utilization system, llmg0431, llmg0432, ptcB, ptcA, llmg0439, ptcC, and bglA occurred only in the first two growth phases. The genes for utilization of glucose (pfk, pyk, ldh, and pgiA) and fructose (fruACR) were activated mainly in the early exponential phase.

TABLE 3.

Genes with significantly altered expression as a result of the ccpA mutation

Gene Upregulation or downregulationa
COG Postion 1b Position 2c cre sequence Putative −35 and −10 sequence
E M T S
C. Energy production and conversion
    pdhD −3.2 −2.3 C
    pdhC −6.7 C
    pdhB −6.7 C
    nifJ −2.6 C
    llmg0559 1.8 C
    glpD −5.4 −6.4 C
    glpK −2 C −43 −1 AGTAACCGTTTACA TTGACATCTTTCTGTTATCATACTATAAT
    llmg1127 −2.2 C −273 0 AGAAATCGCTAACA ATGCAATCTTAATAAAAATATTGATAAAAA
    llmg1726 −3.1 C
    noxB 2.1 C −76 −38 TGTAACAGTTTACA TTTACAAATTGCTCTAAAAAGGATATAAT
    noxA −3 C
    cydB 1.8 2.1 C
    cydA 1.8 C 207 AGTAACCGGTATTA
    llmg1915 −3 C −61 −2 TGAAAGAGCATACA TTGAAAATCTAAATGAATCGGCTTATAAT
    llmg1916 −8.8 2.9 C 215 TGACAGAGTTTTCA
    atpD 2.8 C
    atpG 2.2 C
    atpA 3.3 C
    ackA1 −3.4 C 218 TTAAAACGTTTGAA
    ackA2 −2 C −22 6 ATAAAACGCATACA ATGAAATCAACTCTAAAGTATGATATAAT
    adhE −2.5 −2.1 −2.5 C −127 22 ATAAAGCGATTTCT TTGCCAAATCTTTAAAAGGATTGGCAATAT
    gntK −2.3 C
    trxH 3.3 OC
E. Amino acid transport and metabolism
    argG −4.4 −10.1 E −305 −37 AGTAAGCGTATTCA TATTCAATACTATCATTTTTCTTATATAAT
    argH −3.2 −16.9 5.3 E
    llmg0184 −3.2 E
    phnC −3.1 E
    phnB −2.1 E
    llmg0376 1.8 E
    lysQ 2.2 E
    llmg0507 −2.6 E
    argE −2.2 −6.8 E
    glyA −2.3 E
    oppA 2.4 E
    pepQ 1.7 −1.5 1.3 E −127 −66 TGTAAACCTTTTCA GTGATTTTTCAATAAAAATAGCGTAGAAT
    trpD 3 E
    trpF 2.8 E
    trpB 2.6 E
    busAA −2.4 E 1062 TGTAAGAGATATCT
    llmg1299 1.9 E
    telA 2.9 E
    argF −7.4 1.9 E
    argB 2.3 −7.1 1.8 E
    argD −7.2 1.8 E
    argJ −8.1 E
    argC −8.5 E
    cysK −3 E
    metC −4.2 E
    pheA 2 E
    llmg1993 2.3 E
    pepT 6.4 E
    oppA2 2.6 E
    arcC2 −3 −2.5 2 E
    arcC1 −2.1 1.9 E
    arcD1 −2.6 −2 E
    arcB −1.6 −1.5 −1.1 E −155 TGAAAACTTTTACA
    arcA −3.8 −2.9 E −43 4 TGTAAACGATTCCA TTGACAAAAAATATGCATAGATGTATAAT
    llmg2477 3.5 E
    glnA −2.2 E
    carB 2.6 EF
    trpE 3.9 EH 195 TGAAATCATTAGCA
    oppD −2.2 EP
    oppB2 1.9 EP
    llmg1195 −3.5 ER
    butB −3.7 −5 ER
    gltS −2.6 −7 ET
    gntP −4.5 1.9 GE −54 71 TGTAAGCGCAAGCA TTCAAAGAAAATTTGAAAAAGACTAAATT
    pmrB −14.5 GEPR
    llmg0856 1.8 GEPR
    llmg2513 −2.5 GEPR
F. Nucleotide transport and metabolism
    nrdD 1.9 −2.4 F
    udk 2.1 F −85 −66 TGTGAACGCTTAAA ATGACAAAAAGCCCAAAAATTGTGGTAGAAT
    pyrR 1.9 F
    pyrP 2.4 F
    pyrB 1.9 F
    purC −5 F
    purQ −3.2 F 262 TGTAATGGATTTCA
    purl −3.4 F
    purM −4.5 F
    purN −5.9 F
    hprT −3.1 F
    purH −10.2 F
    purD −6.3 F
    purK −2.1 F
    pyrDB 2.1 F
    guaC −4.9 F
    pyrC 2.1 F
    pyrE 2.4 F
    nrdE 2.4 F
    gmk −3.4 F 84 TGAAAGTGATAACA
    purA −3.1 F 309 TGCACACGTTATCT
    adk −2 F
    purR 2 −2 F
    carB 2.6 EF
G. Carbohydrate transport and metabolism
    mtlA −4.9 −10.3 −8.5 −2.5 G −44 −17 TGGTAGCGGTTATA TTTACAGTCTTATTGGTAGCGGTTATAAT
    mtlF −5.3 −7.6 −5.9 G
    mtlD −17.2 −20.9 −15 −2.2 G −81 40 TGTAAAAGCTTACA TTGAAAATTAATCAATAAAATCAAAAAAAT
    ptsH −2.2 G
    glgB −3.3 −2.6 G −58 −28 TGAAAACCTTTGCA TATGAAAACCTTTGCAAAAGTGCTAAAAT
    ptcB −5.6 −4.4 G −62 −16 TGAAAACGTTATAA TTGCATTATGAAAATGAAAACGTTATAAT
    ptcA −5 −3.3 G
    ptcC −4.3 −2 G −96 −40 AGAAACCGCTTTCT TTCTTTACTTTGCCTATTAATGCTATAAT
    bglA −3.1 G
    femD 2.5 G
    llmg0453 −4.2 −2.5 G −64 −26 TGAAAACGTTTTTA TTGCTGAAAACGTTTTTATGTGATACAAT
    llmg0454 −5.7 −3.7 −2.4 G
    trePP −13.5 −2.8 G
    llmg0487 −3.2 G
    llmg0488 −2.8 G
    llmg0489 −2.1 G
    llmg0490 −2.3 G
    malG −2.9 −2.3 2.8 G
    malF −3.4 −2.4 G
    malE −2.8 −2.5 2.6 G −24 13 ATAAACCGTTTTCA TTGACAAAAAGCAAACGGTTGCGTAAAAT
    dexA 2.5 G
    amyY 1.8 G
    agl 4.1 G
    mapA 4 G
    ascB −9 −4.4 G −64 −39 TGAAATCGCTATCA TATCAAAAACAATTAAAAAATGGTAAAAT
    llmg0870 1.9 G
    rpe2 5.5 G −168 −104 AGTAATCGTTATCT TTGACAGGTTGTTTTCCTGATGATATAAT
    rpiB 7.9 G
    llmg0959 8.3 2.1 G 462 TGAAACAGTTATCA
    llmg0960 5.8 G
    glpF2 −5.1 −3.9 G
    pfk 1.9 G −134 −56 TGAAAACGTTT-CA AAGAGATTTTTTTATAAATACGTGATATAAT
    pyk 2.1 G
    ldh 2.4 G
    llmg1468 −3.5 −2.6 G −24 2 ATAAAGCGTTTACA TAAAAAGTAAAGGCCAATTATGTTATAAT
    fruA 2.9 3.3 G
    fruC 3 3.9 G −345 TGAAAAAGGTAACA
    pmi −3.6 G −29 12 TGAAAGCGAATAAA TTGTTCTAGATAAATTTTGTGATATAAT
    gpmC 1.8 G
    chiC −8.1 −4.5 −2.3 G −55 1 AGTTAGCGCTTACA TTTAAGTTAGGGAAAAAAATTGTTAGAAT
    galT −11.3 −8.3 −7 G
    galK −16.9 −10.7 −6.2 G 38 TATCAGCGTTAACA
    galM −15.2 −10.4 −5.5 G
    galP −18.9 −10.3 −5.1 G 360 3 TGCCATCGTATTCA TTGGAAACCCTTTCTTAAACCAAAGTGTTATACT
    bcrA 1.9 G
    glpF3 2 G
    llmg2431 −2.1 G −56 −27 TGAAAACGCTTTTT CTGAAAACGCTTTTTTTGTGATAAAAT
    pgiA 1.9 1.9 2.1 G −139 −56 AATAAGCGCTTACA TTGTTAAAAAGCCGAAAAAGTGATAAAAT
    glcU 2.8 G
    gntP −4.5 1.9 GE
    pmrB −14.5 GEPR
    llmg0856 1.8 GEPR
    llmg2513 −2.5 GEPR
    llmg0961 8.6 KG
    fruR 2.5 KG 440 TGAAAAAGGTAACA
H. Coenzyme metabolism
    lplL −2.2 −2.8 H
    menA 1.8 H
    thiI 2.5 H
    gltD −2 2.5 H
    dltD 1.9 H −375 TGTAAGTATTTTCA
    ribH −4.8 1.9 2.2 H
    ribA −5.2 H
    rib 1.9 H
    ribD −2.7 H
    pnuC2 2.9 H
    folD −3.1 H
    kdtB −2.1 H
    trpE 3.9 EH
I. Lipid metabolism
    mvk −2.9 I
    llmg0431 −2.3 −2.2 I
    llmg1517 1.9 I
    accA 2.3 I
    accC 2.8 I
    butA −4.4 −4.7 IQR
    llmg1762 −2.8 IQR
J. Translation, ribosomal structure, and biogenesis
    llmg0015 2.1 J
    rpmG −2.3 J
    prmA 2 J
    tgt 2.9 J
    rpsD 2.1 J
    tyrS 5.9 J
    thiM −2.2 J
    hisF 1.9 J
    truB −2.5 J
    rplU 2.3 J
    rpsA −3.3 J −169 AGAAAATGTTTTCA
    trmU 2 J 906 TGCAAGCGATTTGA
    pnpA −2.2 J
    thrS 2.4 J
    argS −2.6 J
    rplO −2.2 J
    proS 2.3 J
    valS 2.1 J
K. Transscription
    mtlR −4.2 −11.5 −6.7 −2.4 K
    llmg0141 −3.4 K
    cspE −3.4 K
    llmg0432 −2.5 K
    llmg0439 −10.8 −4.7 K
    lytR −2.6 K
    malR 3.4 K
    ccpA 4.5 3.7 5 K −65 −27 TGATATCGCTTCCA TTGAAAAGGTTTACAGTTCATGATATAAT
    llmg0956 2.5 K −142 −108 GGTAATCGTTTACT TTGCTAAACTTGTTTATATATGAGAGAAT
    rplL 2.3 K
    cspD −5 K
    gidC −2.2 K
    llmg2218 2.6 K −52 TGAAAGCGCAAACA
    glnR −2.1 K
    llmg0961 8.6 KG
    fruR 2.5 KG
    llrB −2.5 TK −215 AAAAAGCGTATTCA
L. DNA replication, recombination, and repair
    llmg0151 3.3 L
    matR −2.9 L
    ltrC 2 L
    tnp-981 2.1 L
    xseB −2.3 L
    xseA −2.2 L
    llmg2007 1.9 L
    llmg2444 −2.1 L
    rnhA −2 L
M. Cell envelope biogenesis, outer membrane
    rgpA −2.1 M
    pbp2B 1.9 M
    mgtA 1.9 M
    galE −2.4 −2.4 −2.3 M
    llmg2320 −3.4 M 1694 TTAATACGATTACA
O. Posttranslational modification and protein turnover
    gcp 1.9 O
    ahpF 1.9 O
    groEL2 −2.7 O
    tig −4.1 O
    clpB 2.4 O
    llmg1129 −2.1 O
    dnaK −2.5 O
    fabD 1.8 O
    pepO2 2 O
    trxH 3.3 OC
    clpP 4.1 OU −169 −101 TGAAAGCGTTAAGA TTGACCTTTTTTGACCAATGAGTTATAAT
P. Inorganic ion transport and metabolism
    phnD −6.5 P −269 −27 TGTAAAGGCTTAAA TTGTAAAGGCTTAAAAAAAGGGTTAGAAT
    phnE −2.6 P
    plpA 2.2 P
    plpB 1.9 P <
    fhuD 2.2 P 821 TTAAAGCGGTTAAA
    llmg0514 −2.1 P
    llmg0661 1.9 P 776 TGAAAACTCTAACA
    fur 1.9 P
    cspD2 −3.5 P
    orf53 2.5 P
    fdhC −2.6 P −20 14 TAAATACGCTTTCA TAGCATTCTAATATAATTTATGATAGAAT
    pstC 2.5 P
    oppD -2.2 EP
    oppB2 1.9 EP
    pmrB −14.5 GEPR
    llmg0856 1.8 GEPR
    llmg2513 −2.5 GEPR
Q. Secondary metabolite transport and metabolism
    llmg1629 −2.1 QR
    butA −4.4 −4.7 IQR
    llmg1762 −2.8 IQR
R. General function prediction only
    llmg0146 −2.5 R
    llmg0167 2.5 R
    llmg0185 −4.3 −2.8 R 8 6 TGAATACGAATACA TTCTTATTTCTACAGTTTTGTGTTAAAAT
    llmg0194 1.8 R −38 84 TGAAATCGTTCACA TTGTCAAAGATTAAAAATTATCGTAGAAT
    pgmB −14 −3.6 −2.1 R
    llmg0481 2.5 R
    llmg0541 −2.2 R −30 2 TGTAAGCGTTGATA TGTTTTTTTTATTAAAAAAATGTTATAAT
    llmg0736 −3.7 R
    llmg0761 −2.3 R −210 TTTAAGCGTTCACA
    llmg0765 −2.9 R
    llmg0876 2.4 R
    llmg0995 −2.1 R 24 TGATATCGATAACA
    bmpA −2 R
    orf18 1.9 R
    cpo −2.6 R
    lrgA 2 R
    llmg1912 −2.4 R
    pbuO 1.9 −3.5 R
    llmg1920 −2 R 487 TTTAAACGTTTACC
    adhA −3.1 R −36 8 AGAATGCGTTTACA GATACAAAACGAGGTGAAAAGTGTTATAAT
    llmg2436 −2.4 R
    llmg1195 −3.5 ER
    butB −3.7 −5 ER
    pmrB −14.5 GEPR
    llmg0856 1.8 GEPR
    llmg2513 −2.5 GEPR
    butA −4.4 −4.7 IQR
    llmg1629 −2.1 QR
    llmg1762 −2.8 IQR
S. Function unknown
    llmg03303 −2.7 −2 S
    llmg0334 −2.9 S
    llmg0343 2 S
    llmg0448 2.4 S
    llmg0476 2.1 S
    llmg0492 −2.6 S
    llmg1202 −2.2 S
    llmg1540 2.1 S
    llmg1666 2.1 1.8 S
    llmg1917 −4.2 S
    llmg1936 1.9 S 428 TGTCAGCATTTTCA
    llmg2164 −2.7 S
    llmg2194 −2.3 S
    chb −10.3 −4.4 S
    llmg2213 1.8 S
    llmg2337 2.2 S
    llmg2338 2.6 S
T. Signal transduction mechanisms
    kinC 3.7 T
    cstA −11 −7.1 −2.8 T −66 5 TGTAATCGGTTACA TTATCTTTTTGATTAAATAGTGCTAAAAT
    kinF 2.3 T
    kinE 1.8 T
    uspA −2.3 −2 T
    llmg2047 1.9 T
    llrB −2.5 TK
    gltS −2.6 −7 ET
U. Intracellular trafficking and secretion
    llmg1391 2.2 U
    cluA 2 UW
    ps457 2.1 UW
    clpP 4.1 OU
V. Defense mechanisms
    hsdS 1.9 V
    llmg0989 −4.8 −2.3 V 1488 1470 TGAAAGCACTGCCA TATTTACTTTTGGAATTTAAATGCTACAAT
    hdiR 2.1 V
    llmg1467 −2.7 −2.2 V
    lmrA 1.9 V
W. Extracellular structures
    cluA 2 UW
    ps457 2.1 UW
X. No prediction
    llmg0183 −2.5 −2.1 X −67 −39 TGAAAGTGCTTGCA TTGCAAAGAATCTTTAATCTTGCTAGAAT
    llmg0311 −2.8 X −29 −31 TGATAACGCTGACA TTGATAACGCTGACAAATTTTCTGCTATAAT
    llmg0379 −2.1 X
    llmg1090 −4.7 −2.8 X −94 −44 AGAAAGCGTTTTAT TAGACTTAAGTTAGAAAATAGGTTATAAA
    llmg1091 −4.5 −3.5 X
    llmg1092 −4.2 −2.6 X 791 TGCGAACGCATTCA
    llmg1093 −3 −2.4 X
    llmg1094 −22 −4.5 2.7 X
    llmg1095 −5.3 −3.1 X
    llmg1096 −8.8 −3.5 2.4 X 470 484 AGAAAGCGGACTCA TCGCAAGAGAGGCTCAAATTTTATTAAAAT
    llmg1108 2.4 X
    panE 1.8 X
    potD 2.4 X
    orf46 2.7 X
    orf30 2.2 X
    orf28 1.8 X
    orf26 1.9 X
    orf22 1.9 X
    orf20 2 X 530 TAGAAGCGATAACA
    llmg1563 −2.2 X
    llmg1750 2.3 X 313 GGCAAACGTTATCA
    llmg1773 1.9 X
    llmg1944 1.8 X
    llmg2036 3.6 2.5 X
    ps431 2.3 X
    ps412 −2 X 19 315 TGTATGCGTTTTAA ATTTCAAATTTTTAGGCATTCGTGGTATAAT
    llmg2144 −2.5 −2.3 X
    llmg2145 −2.3 2.3 X
    llmg2146 −2.3 −2 X
    llmg2211 −2 X −9 33 AGAAAGGGTTTTCT TGTGTTATAAT
    llmg2286 −3.6 −2.4 X −31 −16 AGAAAGCGCTATAA TTGTCATCTATAAAAGAAAGCGCTATAAT
    llmg2482 −2.3 X
    llmgpseudo54 −3.1 −3.2 X
    llmgpseudo69 −2.5 −2.1 X
a

Positive values indicate upregulation, and negative values indicate downregulation. E, early exponential phase; M, mid-exponential phase; T, transition phase; S, stationary phase.

b

Position relative to the (putative) TSS.

c

Position relative to the start of the gene.

The arc cluster, which was repressed by CcpA (Table 3), encodes components of the arginine deiminase (ADI) pathway and is responsible for uptake and degradation of the amino acid arginine (5, 27). Analysis of the promoter region and structural genes of the arc operons revealed the presence of multiple cre sites. The arcABD1C1C2 cluster was repressed during the early exponential and mid-exponential growth phases, and carbon catabolite repression was relieved or overcome in the transition phase (Table 3). Analysis of the normalized gene expression levels, as measured on the DNA microarrays, suggested that the level of expression of arc in the ΔccpA strain was lower during the transition phase than in the exponential phase of growth. Surprisingly, the arginine biosynthetic pathway, represented by the argGH and argCJBDF operons, was also more highly expressed in L. lactis MG1363ΔccpA than in its parent strain during the exponential growth phase, although cre sites could not be detected in the argCJBDF operon.

Another example of growth phase-dependent regulation is the derepression of purine biosynthesis in L. lactis MG1363ΔccpA. Nearly all genes in the genomic region containing the purine biosynthetic operons were upregulated exclusively during the transition phase in L. lactis MG1363ΔccpA (Table 3). It has been suggested previously that CcpA could play a role in the regulation of purine biosynthesis on the basis of an in silico genome analysis, but so far no experimental evidence has been presented to support this claim (15). The presence of cre sites in the promoter regions and in some purine biosynthesis genes indicates that the observed regulation may be direct.

Functional cre sites are preferentially present on one side of the DNA helix relative to the promoter sequence.

To determine whether the changes in gene expression observed after deletion of ccpA were caused by direct interactions of L. lactis CcpA with the affected genes or by indirect effects, the genome sequence of L. lactis MG1363 was searched for the presence of cre sites. In several cases no cre site was detected in the promoter regions or in the open reading frames of the affected genes, suggesting that the effects were indirect. The opposite was also observed: a putative cre site was present without evident regulation. It is possible that the latter genes were not expressed under the conditions used, but it is also possible that the cre site needs to be at a specific location in the promoter region to be functional, as has been described previously for B. subtilis (25). To examine this possibility, the locations of the predicted cre sites were determined relative to the putative TSSs, which were based on the presence of −35 hexameric sequences and/or canonical −10 sequences (Table 3). The results suggest that there is a dependence on the helix side of functional cre sites. The strongest repression was observed when the center of a cre site was located at positions −39, −26, −16, 5, and 15 relative to the TSS, all of which were separated by approximately 10.5-bp increments (i.e., a full helical turn). When the cre box was further upstream, repression was observed only at position −44. Repression also occurred downstream of position 15, but the putative cre sites were not present at 10.5-bp intervals (Table 3). Analysis of the functional cre sites showed that the L. lactis cre consensus sequence is WGWAARCGYTWWMA, which is very similar to the cre consensus sequence found by Miwa and coworkers (WWTGNAARCGNWWWCAWW) (35); although shorter, additional conserved sequence around the 14-bp cre site was not detected.

DNA helix face-dependent activation by CcpA.

Activated genes containing a cre site upstream of the putative −35 sequence in their promoter were observed mainly in the early exponential growth phase, implying that activation by CcpA could be dependent on the growth phase.

To investigate whether the location of a cre site in a promoter region has an effect on activation of expression of the downstream gene, the presence of cre sites was determined for genes that were significantly upregulated in the exponential phase of growth in L. lactis MG1363 compared to the expression in L. lactis MG1363ΔccpA. Subsequently, the locations of the putative cre sites were determined either on the basis of the position of putative −10 and −35 regions or on the basis of the position of transcription start sites determined experimentally. The centers of the putative cre sites were located at position −56 or −66 in the promoter regions of genes which were probably activated by CcpA in the early exponential phase of growth.

Autoregulation of ccpA expression.

We detected a cre site that encompasses the −35 sequence in the promoter of L. lactis ccpA, suggesting that the regulator may be subject to autoregulation. Although previous results obtained using a ccpA disruption strain indicated that CcpA does not regulate its own gene (32), a recent report suggested that the disruption mutant used by Luesink and coworkers does not fit the proper ΔccpA phenotype (12). This would also explain the partial derepression of the gal operon (32), which is not in accordance with the finding that there was complete derepression of gal in L. lactis MG1363ΔccpA (Table 3). To examine whether L. lactis CcpA regulates itself, the promoter of ccpA (PccpA) was cloned upstream of the promoterless E. coli β-galactosidase gene in pILORI4, and enzyme assays were performed (Fig. 3C). The 2.5-fold-lower β-galactosidase activity observed in L. lactis MG136 than in L. lactis MG1363ΔccpA showed that CcpA is subject to autoregulation in L. lactis. To rule out any indirect effects, EMSAs were performed using PccpA as the probe (Fig. 4A). A more slowly migrating band of the probe in the presence of nanomolar concentrations of purified H6-CcpA protein indicated that there was a direct interaction between H6-CcpA and PccpA. As a negative control, EMSAs were performed with the promoter region of a gene not regulated by CcpA, as determined by the DNA microarrays. The probe (Pllmg1650) did not exhibit any binding of H6-CcpA (Fig. 4B).

FIG. 3.

FIG. 3.

(A) Genetic structure of the pepQ-ccpA region. (B) Growth of (dashed lines) and β-galactosidase activities in (solid lines) L. lactis MG1363 (▪) and L. lactis MG1363ΔccpA (▴), both containing pILORIQZ. (C) Growth of (dashed lines) and β-galactosidase activities in (solid lines) L. lactis MG1363 (▪) and L. lactis MG1363ΔccpA (▴), both containing pILORIAZ. All four strains were grown in GM17 at 30°C. OD600, optical density at 600 nm.

FIG. 4.

FIG. 4.

Electrophoretic mobility shift assays of H6-CcpA interactions with PccpA (A) and Pllmg1650 (B) (negative control). DNA fragments from both promoter regions were obtained by PCR (see Materials and Methods) and end labeled with 32P. Lane X contained the probe without added protein. The remaining lanes contained probe samples incubated with increasing concentrations of H6-CcpA (concentrations ranging from 15 nM to 1 μM). For each successive lane from left to right the concentration of H6-CcpA was doubled.

pepQ is activated by CcpA.

pepQ is one of the genes that was downregulated in L. lactis MG1363ΔccpA. In nearly all LAB the pepQ and ccpA genes are in a tail-to-tail orientation (Fig. 3A; see Fig. 1 posted at http://molgen.biol.rug.nl/publication/ccpA_data). The pepQ and ccpA promoters share a cre site, which might have a function in both activation of pepQ and repression of ccpA. Such a phenomenon has been described for Lactobacillus delbrueckii and Lactobacillus pentosus (34, 44). However, activation of pepQ by carbon catabolite control has not been observed in L. lactis (16). L. lactis pepQ is preceded by a putative ribosome binding site (GGAGG) with a ΔG° value of −14.4 kcal/mol (60.2 kJ/mol). Upstream of the ribosome binding site, there is a promoter-like structure consisting of a −35 hexanucleotide (GTGATT), a 17-bp space, and a −10 sequence (TAGAAT). Primer extension analysis showed that transcription starts at the adenine residue 5 bp downstream of the −10 hexanucleotide (data not shown). The putative cre site is located upstream of the −35 sequence of pepQ at position −66 relative to the pepQ transcriptional start and encompasses the −35 sequence of PccpA (see above). Northern blot analysis of 16S rRNA and pepQ mRNA showed that transcription from the pepQ promoter was significantly reduced in L. lactis MG1363ΔccpA (Fig. 5).

FIG. 5.

FIG. 5.

Northern blot analysis of pepQ transcription in L. lactis. A 16S rRNA-specific probe was used to examine the quantity of RNA in samples of L. lactis MG1363ΔccpA (CcpA−) and L. lactis MG1363 (CcpA+). The strains were grown in different media. GM17 and CDM containing 2% Casitone are peptide-rich media, and CDM containing 0.2% Casitone is a nitrogen-poor medium. Exp, exponential phase of growth; Stat, stationary phase. Duplicate samples were used in all analyses.

PepQ activity assays (not shown) and β-galactosidase activity assays (Fig. 3B) showed that both the activity of PepQ and the pepQ promoter activity were twofold lower in L. lactis MG1363ΔccpA than in L. lactis MG1363. These observations complement and confirm the DNA microarray results.

Binding of purified H6-CcpA to the ccpA/pepQ promoter region (Fig. 4A) indicated that CcpA might have been responsible for the positive effect on pepQ transcription and that this might have been caused by direct activation of the promoter of pepQ.

DISCUSSION

The research described in this paper demonstrated the importance of CcpA as a global regulator in L. lactis, as deletion of CcpA from the genome of L. lactis changed the expression of nearly 13% of all the genes in the genome of L. lactis during growth. As we discuss below, CcpA appears to be involved not only in regulation of carbon metabolism but also in regulation of glycolysis, nucleotide metabolism, and nitrogen source uptake and degradation and may have an effect on the intracellular pH because of regulation of the ADI pathway.

Deletion of the ccpA gene resulted in a lower rate of growth of the L. lactis mutant and upregulation of a large number of genes, corroborating the hypothesis that CcpA has a role as a pleiotropic repressor. For a number of genes the level of expression was lower in L. lactis MG1363ΔccpA than in its parent, revealing that expression of these genes is activated by CcpA. The greatest direct effects were observed in and around the exponential phase of growth. Activated genes containing a cre site upstream of the putative −35 sequence in their promoter were observed mainly in the early exponential growth phase, while most repression by CcpA took place in the transition phase between the exponential and stationary phases of growth. The effects of the ccpA mutation on gene expression in the stationary phase were less pronounced. The majority of the effects observed in the stationary phase may have been indirect because cre sites were detected infrequently in the promoter regions of the affected genes in the stationary phase. The change in expression may have been caused by the growth of the bacterium without CcpA-mediated carbon catabolite control, which has an effect on the composition of a cell and also on the composition of the medium. After several hours of growth of L. lactis MG1363ΔccpA the cells likely had taken up and metabolized different compounds (for instance, glucose and arginine) compared to the parent strain, altering the medium composition, which had an effect on the growth of the organism.

An example of differential expression in L. lactis MG1363 and its isogenic ccpA mutant during growth is the expression of the ADI pathway, which was derepressed in L. lactis MG1363ΔccpA during the exponential phase of growth, whereas it is typically more active in the stationary phase in L. lactis MG1363. Normally, ADI is active only when glucose is depleted and arginine is present (27). Perhaps medium arginine was depleted earlier in the ΔccpA strain through derepression of ADI, which, as observed, would decrease the expression of the arc operon in the stationary growth phase, since the activity of the ADI pathway is dependent on the concentration of arginine (27). This hypothesis would explain the overexpression in L. lactis MG1363ΔccpA of the argCJBDF operon in the exponential phase of growth, which is derepressed under low-arginine conditions (17, 27). These two operons, which are required for the biosynthesis of arginine via glutamate, were upregulated during exponential growth of L. lactis MG1363ΔccpA, although in both operons no cre sites could be detected. The ADI pathway protects the cell against acid stress by increasing the internal pH, and it is possible that the different expression of the ADI pathway in L. lactis MG1363ΔccpA had an effect on the internal pH. When arginine is depleted early in growth, which might be the case in L. lactis MG1363ΔccpA, a cell is less protected against acid stress because it is unable to utilize the ADI pathway.

Recently, it has been found that B. subtilis CcpA interacts with RNA polymerase to inhibit transcription (25). Such an interaction might also take place in L. lactis because of the conserved locations of functional cre sites at a specific side of the helix. When the cre box is further upstream of the −35 sequence, repression is observed only at position −44. Repression also occurs downstream of position 15, but the putative cre sites at the locations are not present at 10.5-bp intervals. Regulation by a roadblock mechanism has been suggested to take place in B. subtilis, in which the presence of CcpA on the DNA blocks transcription (6, 19). Since the requirement for cre localization on a specific side of the DNA helix for a functional cre site is eliminated when cre is further downstream than position 15 relative to the TSS, there may also be a mechanism for a roadblock in CcpA regulation in L. lactis.

B. subtilis CcpA activates transcription of the ackA gene when the cre site is present at positions −56.5 and −66 (49), suggesting that activation of transcription by CcpA is helix face dependent, probably because interaction with the alpha subunit of RNAP is necessary for the activating properties of CcpA. It is also possible that CcpA bends the DNA, allowing the α-subunit of RNAP to interact with UP sequences, very rich in AT (8), to enhance transcription. A similar mechanism for transcription activation has been suggested for the E. coli homolog of CcpA, Cra (or FruR) (38, 41). Mutations in the AT-rich region upstream of the −35 sequence in the promoter of B. subtilis ackA eliminated activation by CcpA (36). Highly AT-rich sequences are also present upstream of the (putative) −35 and cre sites of all four activated genes in L. lactis (Table 3), indicating their importance.

There is a conserved cre site encompassing the −35 sequence in the L. lactis ccpA promoter. It has been suggested that autoregulation of ccpA takes place in several other LAB (34). β-Galactosidase activity assays of a strain of L. lactis carrying a fusion of E. coli lacZ to the ccpA promoter showed that the level of activity of PccpA is higher in L. lactis MG1363ΔccpA than in L. lactis MG1363. Furthermore, EMSAs revealed that there is a direct interaction between H6-CcpA and a DNA fragment carrying PccpA, suggesting that L. lactis CcpA regulates its own expression. Autoregulation of CcpA might be a way for the cell to carefully balance the amount of CcpA in the cell.

The cre site encompassing the −35 hexamer of PccpA might have a second function in activation of the divergently transcribed pepQ gene. The highly conserved divergent orientation of pepQ and ccpA in all LAB suggests that there is a link between the regulation of pepQ and the regulation of ccpA. Indeed, such a relationship between pepQ and ccpA has been described for L. delbrueckii and L. pentosus (34, 44). The twofold-lower PepQ activity in L. lactis MG1363ΔccpA than in L. lactis MG1363 and the twofold-lower strength of its promoter, measured using β-galactosidase reporter activity assays, suggest that there is also a ccpA-pepQ link in L. lactis. Binding of H6-CcpA with the DNA fragment carrying the partially overlapping pepQ and ccpA promoters proves that there is a direct interaction. Thus, we concluded that CcpA has a positive effect on the transcription of pepQ, which might be caused by direct activation of PpepQ. One of the substrates of L. lactis PepQ, the dipeptide leucylproline, has an effect on the expression of prtP, pepC, pepN, and the opp-pepO1 operon (16). Recently, it has been found that leucine, one of the products of the hydrolysis of leucylproline by PepQ, enhances binding of the pleiotropic nitrogen regulator CodY to its operator site (7), suggesting that PepQ has a role in regulation of the proteolytic system of L. lactis. The data presented here and the presence of such a conserved genetic organization in many other LAB may indicate that there is a general method used by this group of microorganisms to couple carbon metabolism to nitrogen metabolism. Regulation of pepQ by CcpA in LAB has been suggested by Mahr et al. (34) and has been shown to operate in L. delbrueckii subsp. lactis by Schick et al. (44), but only now with the application of DNA microarray technology can we begin to understand the possible significance pepQ regulation by CcpA and the resulting intertwinement of carbon metabolism and nitrogen metabolism.

Acknowledgments

We thank Jacek Bardowski for supplying the strain carrying the pQE30-ccpA plasmid.

Financial support was received from the IOP Genomics Program of Senter Novem (grant IGE1018).

Footnotes

▿

Published ahead of print on 6 October 2006.

REFERENCES

  • 1.Aerts, S., L. P. Van Loo, G. Thijs, H. Mayer, R. de Martin, Y. Moreau, and B. De Moor. 2005. TOUCAN 2: the all-inclusive open source workbench for regulatory sequence analysis. Nucleic Acids Res. 33:W393-W396. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Baerends, R. J., W. K. Smits, A. de Jong, L. W. Hamoen, J. Kok, and O. P. Kuipers. 2004. Genome2D: a visualization tool for the rapid analysis of bacterial transcriptome data. Genome Biol. 5:R37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Barriere, C., M. Veiga-da-Cunha, N. Pons, E. Guedon, S. A. van Hijum, J. Kok, O. P. Kuipers, D. S. Ehrlich, and P. Renault. 2005. Fructose utilization in Lactococcus lactis as a model for low-GC gram-positive bacteria: its regulator, signal, and DNA-binding site. J. Bacteriol. 187:3752-3761. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Blencke, H. M., G. Homuth, H. Ludwig, U. Mader, M. Hecker, and J. Stulke. 2003. Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways. Metab. Eng. 5:133-149. [DOI] [PubMed] [Google Scholar]
  • 5.Budin-Verneuil, A., E. Maguin, Y. Auffray, D. S. Ehrlich, and V. Pichereau. 2006. Genetic structure and transcriptional analysis of the arginine deiminase (ADI) cluster in Lactococcus lactis MG1363. Can. J. Microbiol. 52:617-622. [DOI] [PubMed] [Google Scholar]
  • 6.Choi, S. K. and M. H. Saier, Jr. 2005. Regulation of sigL expression by the catabolite control protein CcpA involves a roadblock mechanism in Bacillus subtilis: potential connection between carbon and nitrogen metabolism. J. Bacteriol. 187:6856-6861. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.den Hengst, C. D., S. A. van Hijum, J. M. Geurts, A. Nauta, J. Kok, and O. P. Kuipers. 2005. The Lactococcus lactis CodY regulon: identification of a conserved cis-regulatory element. J. Biol. Chem. 280:34332-34342. [DOI] [PubMed] [Google Scholar]
  • 8.Estrem, S. T., W. Ross, T. Gaal, Z. W. Chen, W. Niu, R. H. Ebright, and R. L. Gourse. 1999. Bacterial promoter architecture: subsite structure of UP elements and interactions with the carboxy-terminal domain of the RNA polymerase alpha subunit. Genes Dev. 13:2134-2147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Garcia de la Nava, J., S. van Hijum, and O. Trelles. 2003. PreP: gene expression data pre-processing. Bioinformatics 19:2328-2329. [DOI] [PubMed] [Google Scholar]
  • 10.Gaspar, P., A. R. Neves, A. Ramos, M. J. Gasson, C. A. Shearman, and H. Santos. 2004. Engineering Lactococcus lactis for production of mannitol: high yields from food-grade strains deficient in lactate dehydrogenase and the mannitol transport system. Appl. Environ. Microbiol. 70:1466-1474. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gasson, M. J. 1983. Plasmid complements of Streptococcus lactis NCDO 712 and other lactic streptococci after protoplast-induced curing. J. Bacteriol. 154:1-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Gaudu, P., G. Lamberet, S. Poncet, and A. Gruss. 2003. CcpA regulation of aerobic and respiration growth in Lactococcus lactis. Mol. Microbiol. 50:183-192. [DOI] [PubMed] [Google Scholar]
  • 13.Gosseringer, R., E. Kuster, A. Galinier, J. Deutscher, and W. Hillen. 1997. Cooperative and non-cooperative DNA binding modes of catabolite control protein CcpA from Bacillus megaterium result from sensing two different signals. J. Mol. Biol. 266:665-676. [DOI] [PubMed] [Google Scholar]
  • 14.Grossiord, B. P., E. J. Luesink, E. E. Vaughan, A. Arnaud, and W. M. de Vos. 2003. Characterization, expression, and mutation of the Lactococcus lactis galPMKTE genes, involved in galactose utilization via the Leloir pathway. J. Bacteriol. 185:870-878. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Guedon, E., E. Jamet, and P. Renault. 2002. Gene regulation in Lactococcus lactis: the gap between predicted and characterized regulators. Antonie Leeuwenhoek 82:93-112. [PubMed] [Google Scholar]
  • 16.Guedon, E., P. Renault, S. D. Ehrlich, and C. Delorme. 2001. Transcriptional pattern of genes coding for the proteolytic system of Lactococcus lactis and evidence for coordinated regulation of key enzymes by peptide supply. J. Bacteriol. 183:3614-3622. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Guedon, E., B. Sperandio, N. Pons, S. D. Ehrlich, and P. Renault. 2005. Overall control of nitrogen metabolism in Lactococcus lactis by CodY, and possible models for CodY regulation in Firmicutes. Microbiology 151:3895-3909. [DOI] [PubMed] [Google Scholar]
  • 18.Hamoen, L. W., A. F. Van Werkhoven, J. J. Bijlsma, D. Dubnau, and G. Venema. 1998. The competence transcription factor of Bacillus subtilis recognizes short A/T-rich sequences arranged in a unique, flexible pattern along the DNA helix. Genes Dev. 12:1539-1550. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Inacio, J. M., C. Costa, and I. Sa-Nogueira. 2003. Distinct molecular mechanisms involved in carbon catabolite repression of the arabinose regulon in Bacillus subtilis. Microbiology 149:2345-2355. [DOI] [PubMed] [Google Scholar]
  • 20.Israelsen, H., S. M. Madsen, E. Johansen, A. Vrang, and E. B. Hansen. 1995. Environmentally regulated promoters in Lactococci. Dev. Biol. Stand. 85:443-448. [PubMed] [Google Scholar]
  • 21.Jensen, P. R., and K. Hammer. 1993. Minimal requirements for exponential growth of Lactococcus lactis. Appl. Environ. Microbiol. 59:4363-4366. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Jensen, P. R., and K. Hammer. 1998. The sequence of spacers between the consensus sequences modulates the strength of prokaryotic promoters. Appl. Environ. Microbiol. 64:82-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Kestler, H. A., A. Muller, T. M. Gress, and M. Buchholz. 2005. Generalized Venn diagrams: a new method of visualizing complex genetic set relations. Bioinformatics 21:1592-1595. [DOI] [PubMed] [Google Scholar]
  • 24.Kim, J. H., M. I. Voskuil, and G. H. Chambliss. 1998. NADP, corepressor for the Bacillus catabolite control protein CcpA. Proc. Natl. Acad. Sci. USA 95:9590-9595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Kim, J. H., Y. K. Yang, and G. H. Chambliss. 2005. Evidence that Bacillus catabolite control protein CcpA interacts with RNA polymerase to inhibit transcription. Mol. Microbiol. 56:155-162. [DOI] [PubMed] [Google Scholar]
  • 26.Kowalczyk, M., and J. Bardowski. 2003. Overproduction and purification of the CcpA protein from Lactococcus lactis. Acta Biochim. Pol. 50:455-459. [PubMed] [Google Scholar]
  • 27.Larsen, R., G. Buist, O. P. Kuipers, and J. Kok. 2004. ArgR and AhrC are both required for regulation of arginine metabolism in Lactococcus lactis. J. Bacteriol. 186:1147-1157. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Leenhouts, K., G. Buist, A. Bolhuis, A. ten Berge, J. Kiel, I. Mierau, M. Dabrowska, G. Venema, and J. Kok. 1996. A general system for generating unlabelled gene replacements in bacterial chromosomes. Mol. Gen. Genet. 253:217-224. [DOI] [PubMed] [Google Scholar]
  • 29.Leenhouts, K. J., and G. Venema. 1992. Molecular cloning and expression in Lactococcus. Meded. Fac. Landbouwwet. Univ. Gent 57:2031-2043. [Google Scholar]
  • 30.Long, A. D., H. J. Mangalam, B. Y. Chan, L. Tolleri, G. W. Hatfield, and P. Baldi. 2001. Improved statistical inference from DNA microarray data using analysis of variance and a Bayesian statistical framework. Analysis of global gene expression in Escherichia coli K12. J. Biol. Chem. 276:19937-19944. [DOI] [PubMed] [Google Scholar]
  • 31.Lorca, G. L., Y. J. Chung, R. D. Barabote, W. Weyler, C. H. Schilling, and M. H. Saier, Jr. 2005. Catabolite repression and activation in Bacillus subtilis: dependency on CcpA, HPr, and HprK. J. Bacteriol. 187:7826-7839. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Luesink, E. J., R. E. van Herpen, B. P. Grossiord, O. P. Kuipers, and W. M. de Vos. 1998. Transcriptional activation of the glycolytic las operon and catabolite repression of the gal operon in Lactococcus lactis are mediated by the catabolite control protein CcpA. Mol. Microbiol. 30:789-798. [DOI] [PubMed] [Google Scholar]
  • 33.Maguin, E., P. Duwat, T. Hege, D. Ehrlich, and A. Gruss. 1992. New thermosensitive plasmid for gram-positive bacteria. J. Bacteriol. 174:5633-5638. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Mahr, K., W. Hillen, and F. Titgemeyer. 2000. Carbon catabolite repression in Lactobacillus pentosus: analysis of the ccpA region. Appl. Environ. Microbiol. 66:277-283. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Miwa, Y., A. Nakata, A. Ogiwara, M. Yamamoto, and Y. Fujita. 2000. Evaluation and characterization of catabolite-responsive elements (cre) of Bacillus subtilis. Nucleic Acids Res. 28:1206-1210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Moir-Blais, T. R., F. J. Grundy, and T. M. Henkin. 2001. Transcriptional activation of the Bacillus subtilis ackA promoter requires sequences upstream of the CcpA binding site. J. Bacteriol. 183:2389-2393. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Moreno, M. S., B. L. Schneider, R. R. Maile, W. Weyler, and M. H. Saier, Jr. 2001. Catabolite repression mediated by the CcpA protein in Bacillus subtilis: novel modes of regulation revealed by whole-genome analyses. Mol. Microbiol. 39:1366-1381. [DOI] [PubMed] [Google Scholar]
  • 38.Negre, D., C. Oudot, J. F. Prost, K. Murakami, A. Ishihama, A. J. Cozzone, and J. C. Cortay. 1998. FruR-mediated transcriptional activation at the ppsA promoter of Escherichia coli. J. Mol. Biol. 276:355-365. [DOI] [PubMed] [Google Scholar]
  • 39.Nicholson, J. A., and Y. S. Kim. 1975. A one-step L-amino acid oxidase assay for intestinal peptide hydrolase activity. Anal. Biochem. 63:10-17. [Google Scholar]
  • 40.Postma, P. W., J. W. Lengeler, and G. R. Jacobson. 1993. Phosphoenolpyruvate:carbohydrate phosphotransferase systems of bacteria. Microbiol. Rev. 57:543-594. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Prost, J. F., D. Negre, C. Oudot, K. Murakami, A. Ishihama, A. J. Cozzone, and J. C. Cortay. 1999. Cra-dependent transcriptional activation of the icd gene of Escherichia coli. J. Bacteriol. 181:893-898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Rauch, P. J., and W. M. de Vos. 1992. Transcriptional regulation of the Tn5276-located Lactococcus lactis sucrose operon and characterization of the sacA gene encoding sucrose-6-phosphate hydrolase. Gene 121:55-61. [DOI] [PubMed] [Google Scholar]
  • 43.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor laboratory Press, Cold Spring Harbor, NY.
  • 44.Schick, J., B. Weber, J. R. Klein, and B. Henrich. 1999. PepR1, a CcpA-like transcription regulator of Lactobacillus delbrueckii subsp. lactis. Microbiology 145:3147-3154. [DOI] [PubMed] [Google Scholar]
  • 45.Schumacher, M. A., G. S. Allen, M. Diel, G. Seidel, W. Hillen, and R. G. Brennan. 2004. Structural basis for allosteric control of the transcription regulator CcpA by the phosphoprotein HPr-Ser46-P. Cell 118:731-741. [DOI] [PubMed] [Google Scholar]
  • 46.Schumacher, M. A., G. Seidel, W. Hillen, and R. G. Brennan. 2006. Phosphoprotein Crh-Ser46-P displays altered binding to CcpA to effect carbon catabolite regulation. J. Biol. Chem. 281:6793-6800. [DOI] [PubMed] [Google Scholar]
  • 47.Seidel, G., M. Diel, N. Fuchsbauer, and W. Hillen. 2005. Quantitative interdependence of coeffectors, CcpA and cre in carbon catabolite regulation of Bacillus subtilis. FEBS J. 272:2566-2577. [DOI] [PubMed] [Google Scholar]
  • 48.Tatusov, R. L., N. D. Fedorova, J. D. Jackson, A. R. Jacobs, B. Kiryutin, E. V. Koonin, D. M. Krylov, R. Mazumder, S. L. Mekhedov, A. N. Nikolskaya, B. S. Rao, S. Smirnov, A. V. Sverdlov, S. Vasudevan, Y. I. Wolf, J. J. Yin, and D. A. Natale. 2003. The COG database: an updated version includes eukaryotes. BMC Bioinformatics 4:41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Turinsky, A. J., F. J. Grundy, J. H. Kim, G. H. Chambliss, and T. M. Henkin. 1998. Transcriptional activation of the Bacillus subtilis ackA gene requires sequences upstream of the promoter. J. Bacteriol. 180:5961-5967. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.van Asseldonk, M., A. Simons, H. Visser, W. M. de Vos, and G. Simons. 1993. Cloning, nucleotide sequence, and regulatory analysis of the Lactococcus lactis dnaJ gene. J. Bacteriol. 175:1637-1644. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.van de Guchte, M., J. Kok, and G. Venema. 1992. Gene expression in Lactococcus lactis. FEMS Microbiol. Rev. 8:73-92. [DOI] [PubMed] [Google Scholar]
  • 52.van den Bogaard, P. T., M. Kleerebezem, O. P. Kuipers, and W. M. de Vos. 2000. Control of lactose transport, beta-galactosidase activity, and glycolysis by CcpA in Streptococcus thermophilus: evidence for carbon catabolite repression by a non-phosphoenolpyruvate-dependent phosphotransferase system sugar. J. Bacteriol. 182:5982-5989. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53.van Hijum, S. A., A. de Jong, R. J. Baerends, H. A. Karsens, N. E. Kramer, R. Larsen, C. D. den Hengst, C. J. Albers, J. Kok, and O. P. Kuipers. 2005. A generally applicable validation scheme for the assessment of factors involved in reproducibility and quality of DNA-microarray data. BMC Genomics 6:77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.van Hijum, S. A., A. de Jong, G. Buist, J. Kok, and O. P. Kuipers. 2003. UniFrag and GenomePrimer: selection of primers for genome-wide production of unique amplicons. Bioinformatics 19:1580-1582. [DOI] [PubMed] [Google Scholar]
  • 55.van Hijum, S. A., J. Garcia de la Nava, O. Trelles, J. Kok, and O. P. Kuipers. 2003. MicroPreP: a cDNA microarray data pre-processing framework. Appl. Bioinformatics 2:241-244. [PubMed] [Google Scholar]
  • 56.Warner, J. B., and J. S. Lolkema. 2003. A Crh-specific function in carbon catabolite repression in Bacillus subtilis. FEMS Microbiol. Lett. 220:277-280. [DOI] [PubMed] [Google Scholar]
  • 57.Warner, J. B., and J. S. Lolkema. 2003. CcpA-dependent carbon catabolite repression in bacteria. Microbiol. Mol. Biol. Rev. 67:475-490. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58.Yoshida, K., K. Kobayashi, Y. Miwa, C. M. Kang, M. Matsunaga, H. Yamaguchi, S. Tojo, M. Yamamoto, R. Nishi, N. Ogasawara, T. Nakayama, and Y. Fujita. 2001. Combined transcriptome and proteome analysis as a powerful approach to study genes under glucose repression in Bacillus subtilis. Nucleic Acids Res. 29:683-692. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Zabarovsky, E. R., and G. Winberg. 1990. High efficiency electroporation of ligated DNA into bacteria. Nucleic Acids Res. 18:5912. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES