Skip to main content
PMC home page
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2006 Oct 16;51(2):535–542. doi: 10.1128/AAC.00600-06

Contribution of Target Gene Mutations and Efflux to Decreased Susceptibility of Salmonella enterica Serovar Typhimurium to Fluoroquinolones and Other Antimicrobials▿

Sheng Chen 1,†, Shenghui Cui 1, Patrick F McDermott 2, Shaohua Zhao 2, David G White 2, Ian Paulsen 3, Jianghong Meng 1,*
PMCID: PMC1797773  PMID: 17043131

Abstract

The mechanisms involved in fluoroquinolone resistance in Salmonella enterica include target alterations and overexpression of efflux pumps. The present study evaluated the role of known and putative multidrug resistance efflux pumps and mutations in topoisomerase genes among laboratory-selected and naturally occurring fluoroquinolone-resistant Salmonella enterica serovar Typhimurium strains. Strains with ciprofloxacin MICs of 0.25, 4, 32, and 256 μg/ml were derived in vitro using serovar Typhimurium S21. These mutants also showed decreased susceptibility or resistance to many nonfluoroquinolone antimicrobials, including tetracycline, chloramphenicol, and several β-lactams. The expression of efflux pump genes acrA, acrB, acrE, acrF, emrB, emrD, and mdlB were substantially increased (≥2-fold) among the fluoroquinolone-resistant mutants. Increased expression was also observed, but to a lesser extent, with three other putative efflux pumps: mdtB (yegN), mdtC (yegO), and emrA among mutants with ciprofloxacin MICs of ≥32 μg/ml. Deletion of acrAB or tolC in S21 and its fluoroquinolone-resistant mutants resulted in increased susceptibility to fluoroquinolones and other tested antimicrobials. In naturally occurring fluoroquinolone-resistant serovar Typhimurium strains, deletion of acrAB or tolC increased fluoroquinolone susceptibility 4-fold, whereas replacement of gyrA double mutations (S83F D87N) with wild-type gyrA increased susceptibility >500-fold. These results indicate that a combination of topoisomerase gene mutations, as well as enhanced antimicrobial efflux, plays a critical role in the development of fluoroquinolone resistance in both laboratory-derived and naturally occurring quinolone-resistant serovar Typhimurium strains.

Nontyphoidal salmonellae are one of the principal pathogens implicated in food-borne gastroenteritis worldwide. Antimicrobial agents are not usually essential for the treatment of most cases of salmonellosis but can be lifesaving in cases of severe or systemic infection (16, 24). The use of older antimicrobials such as ampicillin, chloramphenicol, and tetracycline has become limited due to increased resistance to these agents. Fluoroquinolones such as ciprofloxacin or extended-spectrum cephalosporins are now commonly used for adult patients infected with Salmonella enterica and for the treatment of acute gastroenteritis (9, 30). Although the development of high-level fluoroquinolone resistance in Salmonella remains rare, recent reports have documented strains displaying decreased susceptibility to fluoroquinolones. High-level fluoroquinolone resistance in Salmonella was first described in serovar Typhimurium DT204 in the early 1990s in Germany (21). More recently, outbreaks of fluoroquinolone-resistant Salmonella infections were reported in the United States, Taiwan, and Japan (6, 26, 37, 49). Since fluoroquinolones are central to the management of severe salmonellosis, emerging resistance to this antimicrobial class is a paramount concern.

Bacterial resistance to fluoroquinolone is usually mediated by mutations in bacterial DNA gyrase (gyrA and gyrB) and topoisomerase IV (parC and parE) genes, as well as by active efflux (19, 25). Plasmid-mediated resistance to quinolones in gram-negative bacteria has been described. In Salmonella, single GyrA mutations, in either S83 or A87, are associated with nalidixic acid resistance (17, 41, 43), whereas mutations in both S83 and A87 in GyrA are linked with ciprofloxacin-resistant Salmonella isolates from humans and animals (6, 21, 40). Resistance linked to GyrB mutations (S464T) has been reported only in a single clinical isolate (13). Mutations in S80 or G78 of ParC have been found in ciprofloxacin-resistant clinical and laboratory-induced isolates (3, 18, 32). Introducing into the respective mutants the corresponding plasmid-encoded quinolone-susceptible wild-type alleles of either Escherichia coli gyrA, gyrB, or parC resulted in the reduction of quinolone resistance, indicating a role for these mutations in quinolone resistance (2, 20, 22). No mutations in parE have yet been described in quinolone-resistant Salmonella (23).

Bacterial efflux pumps are also important in resistance to many classes of antimicrobial agents, including fluoroquinolones (38, 47). At least six major groups of active drug efflux pump transporters have been identified in prokaryotes to date: ATP-binding cassette (ABC), major facilitator superfamily (MFS), small multidrug resistance (SMR), multi-antimicrobial resistance (MAR), resistance nodulation division (RND), and multidrug and toxic compound extrusion (MATE) (38, 47). Efflux pumps that contribute to antibiotic resistance have been described in a number of clinically important bacteria other than Salmonella, including Campylobacter jejuni (CmeABC), Escherichia coli (AcrAB-TolC, AcrEF-TolC, EmrB, and EmrD), Pseudomonas aeruginosa (MexAB-OprM, MexCD-OprJ, MexEF-OprN, and MexXY-OprM), Streptococcus pneumoniae (PmrA), Staphylococcus aureus (NorA), and others (27, 28, 31, 34, 39, 42). The AcrAB-TolC system in Salmonella consists of the cytoplasmic membrane localized AcrB and the accessory protein AcrA, linking AcrB with the outer membrane protein (OMP) TolC (12). The overexpression of AcrAB-tolC is mediated by the transcriptional activators MarA and SoxS, which are regulated by MarR and SoxR proteins (33, 45, 50).

Although target gene mutations and efflux pumps are two known mechanisms associated with fluoroquinolone resistance in bacteria, the additive or synergistic contribution of the two mechanisms in emerging fluoroquinolone resistance is not clear in Salmonella. In order to better understand the molecular mechanisms associated with fluoroquinolone resistance in Salmonella, we characterized a set of laboratory-induced mutants and naturally occurring fluoroquinolone-resistant strains of serovar Typhimurium to determine the relative contributions of known and putative efflux pumps and topoisomerase target gene mutations.

MATERIALS AND METHODS

Bacterial strains.

Salmonella enterica serovar Typhimurium strain S21 was isolated from a ground beef sample, and Salmonella strain py1 (14028s) was purchased from the American Type Culture Collection (Manassas, VA). Serovar Typhimurium strains CS1, CS3, and CS9 were isolated from diseased pig feces and displayed resistance to ciprofloxacin (MIC = 16 μg/ml), whereas strains CHS14, CHS18, and CHS38 were isolated from retail chicken meat and exhibited nalidixic acid resistance and decreased susceptibility to ciprofloxacin (MIC = 0.06 to 0.12 μg/ml [see Table 3]).

TABLE 3.

Antimicrobial susceptibility phenotypes of deletion and replacement mutants of serovar Typhimurium S21 and wild-type serovar Typhimurium strains CS1, CS3, CS9, CHS14, CHS18, and CHS38a

Strain Amino acid substitution(s)b
Quinolone and fluoroquinolone MICs (μg/ml)
Other antimicrobial MICs (μg/ml)
GyrA ParC NAL CIP DAN DIF ENR GAT LEV ORB SAR AMO AMP CEP CHL COT FOX KAN TET TIO
S21 * * 4 <0.015 0.03 0.25 0.06 0.03 0.03 0.12 0.03 <1/05 2 <2 8 0.25/4.75 4 <8 <4 0.5
S21 gyrA+ * * 4 <0.015 0.03 0.25 0.06 0.03 0.03 0.12 0.03 <1/05 2 <2 8 0.25/4.75 4 <8 <4 0.5
S21 acrAB::Kan * * 1 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <1/0.5 <1 <2 <2 <0.12/2.38 1 >64 <4 <0.12
S21 tolC::Kan * * 1 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <1/0.5 <1 <2 <2 <0.12/2.38 1 >64 <4 <0.12
S21-1 S83F * 256 0.25 0.5 4 0.5 0.5 0.5 2 1 16/8 >32 8 >32 0.25/4.75 2 <8 32 0.5
S21-1 gyrA+ * * 4 0.015 0.03 0.25 0.06 0.03 0.03 0.12 0.03 16/8 >32 8 >32 0.25/4.75 2 <8 32 0.5
S21-1 acrAB::Kan S83F * 32 0.06 0.06 0.25 0.06 0.03 0.06 0.12 0.12 16/8 >32 <2 <2 <0.12/2.38 1 >64 <4 <0.12
S21-1 tolC::Kan S83F * 32 0.06 0.06 0.25 0.06 0.03 0.06 0.12 0.12 16/8 >32 <2 <2 <0.12/2.38 1 >64 <4 <0.12
S21-2 S83F S80I >256 4 4 >16 8 1 1 16 8 16/8 >32 >32 >32 2/38 >16 <8 >32 4
S21-2 gyrA+ * S80I 64 0.25 1 2 1 0.25 0.25 2 0.25 16/8 >32 >32 >32 2/38 >16 <8 >32 4
S21-2 acrAB::Kan S83F S80I 64 0.12 0.12 0.25 0.12 0.06 0.12 0.25 0.5 16/8 >32 8 <2 <0.12/2.38 2 >64 <4 <0.12
S21-2 tolC::Kan S83F S80I 64 0.12 0.12 0.25 0.12 0.06 0.06 0.25 0.5 16/8 >32 8 <2 <0.12/2.38 2 >64 <4 <0.12
S21-3 S83F S80I >256 32 >16 >16 >16 8 >16 16 >16 16/8 >32 >32 >32 >4/76 >16 <8 >32 4
S21-3 gyrA+ * S80I >256 2 2 4 2 1 1 2 1 16/8 >32 >32 >32 >4/76 >16 <8 >32 4
S21-3 acrAB::Kan S83F S80I 64 0.25 0.25 0.5 0.25 0.06 0.12 0.5 0.5 16/8 >32 8 <2 <0.12/2.38 1 >64 <4 <0.12
S21-3tolC::Kan S83F S80I 32 0.25 0.25 0.5 0.12 0.06 0.12 0.5 0.5 16/8 >32 8 <2 <0.12/2.38 1 >64 <4 <0.12
S21-4 S83F S80I >256 256 >16 >16 >16 16 >16 16 >16 16/8 >32 >32 >32 >4/76 >16 <8 >32 4
S21-4 gyrA+ * S80I >256 4 4 4 4 2 2 8 2 16/8 >32 >32 >32 >4/76 >16 <8 >32 4
S21-4 acrAB::Kan S83F S80I >256 0.25 0.25 1 0.12 0.06 0.25 0.12 0.5 16/8 >32 8 <2 <0.12/2.38 1 >64 <4 <0.12
S21-4 tolC::kanC S83F S80I >256 0.25 0.25 1 0.12 0.06 0.25 0.12 0.5 16/8 >32 8 32 <0.12/2.38 2 >64 8 <0.12
S21 * * 4 <0.015 0.03 0.25 0.06 0.03 0.03 0.12 0.03 <1/05 2 <2 8 0.25/4.75 4 <8 <4 0.5
S21 gyrA+ * * 4 <0.015 0.03 0.25 0.06 0.03 0.03 0.12 0.03 <1/05 2 <2 8 0.25/4.75 4 <8 <4 0.5
S21 acrAB::Kan * * 1 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <1/0.5 <1 <2 <2 <0.12/2.38 1 >64 <4 <0.12
S21 tolC::Kan * * 1 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <1/0.5 <1 <2 <2 <0.12/2.38 1 >64 <4 <0.12
CS1 S83F, D87N S80I >256 16 >16 >16 16 4 8 >16 16 32/16 >32 16 >32 >4/76 1 <8 >32 1
CS1 gyrA+ S83F, D87N S80I 4 0.03 0.06 0.5 0.06 0.06 0.06 0.25 0.06 32/16 >32 8 >32 >4/76 2 >64 >32 1
CS1 acrAB::Kan S83F, D87N S80I >256 4 4 16 4 0.5 2 4 4 32/16 >32 8 >32 2/38 1 >64 >32 0.5
CS1 tolC::Kan S83F, D87N S80I 256 2 4 4 4 0.5 1 4 4 32/16 >32 8 >32 2/38 1 >64 32 0.5
CS3 S83F, D87N S80I >256 16 >16 >16 16 4 8 >16 16 32/16 >32 16 >32 >4/76 1 <8 >32 1
CS3 gyrA+ S83F, D87N S80I 4 0.03 0.06 0.5 0.06 0.06 0.06 0.25 0.06 32/16 >32 8 >32 >4/76 2 >64 >32 1
CS3 acrAB::Kan S83F, D87N S80I >256 4 4 16 4 0.5 2 4 4 32/16 >32 8 >32 2/38 1 >64 >32 0.5
CS3 tolC::Kan S83F, D87N S80I 256 2 4 4 4 0.5 1 4 4 32/16 >32 8 >32 2/38 1 >64 32 0.5
CS9 S83F, D87N S80I >256 16 >16 >16 16 4 8 >16 >16 32/16 >32 16 >32 >4/76 1 <8 >32 1
CS9 gyrA+ S83F, D87N S80I 4 0.03 0.06 0.5 0.06 0.06 0.06 0.25 0.03 32/16 >32 8 >32 >4/76 2 >64 >32 1
CS9 acrAB::Kan S83F, D87N S80I >256 4 4 16 4 0.5 2 4 4 32/16 >32 8 >32 2/38 1 >64 >32 0.5
CS9 tolC::Kan S83F, D87N S80I 256 2 4 4 4 0.5 1 4 4 32/16 >32 8 >32 2/38 1 >64 32 0.5
CHS14 D87G * 128 0.12 0.25 1 1 0.25 0.25 1 0.25 2/1 <1 4 8 0.25/4.75 4 <8 >32 1
CHS14 gyrA+ D87G * 4 <0.015 0.03 0.5 0.06 0.03 0.06 0.12 0.03 2/1 <1 <2 8 0.25/4.75 2 >64 >32 1
CHS14 acrAB::Kan D87G * 8 <0.015 0.03 0.03 0.03 <0.015 0.03 0.03 <0.015 2/1 <1 <2 <2 <0.12/2.38 1 >64 >32 <0.12
CHS14 tolC::Kan D87G * 16 <0.015 0.03 0.03 <0.015 <0.015 <0.015 0.03 <0.015 2/1 <1 <2 <2 <0.12/2.38 1 >64 >32 <0.12
CHS18 S83F * 256 0.12 0.5 2 0.5 0.25 0.25 1 0.25 1/0.5 2 4 8 0.12/2.38 2 8 4 1
CHS18 gyrA+ S83F * 32 0.06 0.06 0.25 0.12 0.06 0.06 0.12 0.06 1/0.5 2 4 4 0.12/2.38 2 >64 4 1
CHS18 acrAB::Kan S83F * 16 0.03 0.03 1 0.25 0.12 0.03 0.5 0.03 1/0.5 1 2 2 0.12/2.38 1 >64 4 0.12
CHS18 tolC::Kan S83F * 32 0.03 0.06 0.06 0.03 0.03 0.03 0.06 0.03 1/0.5 1 2 2 0.12/2.38 1 >64 4 0.12
CHS38 D87G * 32 0.06 0.25 1 0.12 0.12 0.12 0.5 0.12 1/0.5 >32 8 32 >4/76 4 8 32 0.5
CHS38 gyrA+ D87G * 8 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.15 <0.015 1/0.5 >32 16 32 >4/76 4 >64 32 0.5
CHS38 acrAB::Kan D87G * 1 0.03 0.03 0.06 0.03 <0.015 0.03 0.06 0.03 1/0.5 >32 8 4 >4/76 0.5 >64 16 0.12
CHS38 tolC::Kan D87G * 0.5 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 <0.015 1/0.5 >32 8 4 >4/76 0.5 >64 16 0.12
Open in a new tab
a

NAL, nalidixic acid; CIP, ciprofloxacin; DAN, danofloxacin; DIF, difloxacin; ENR, enofloxacin; GAT, gatifloxacin; LEV, levofloxacin; ORB, orbifloxacin; SAR, sarafloxacin; AMO, amoxicillin-clavulanate; AMP, ampicillin; CEP, cephalothin; CHL, chloramphenicol; COT, trimethoprim-sulfamethoxazole; FOX, cefoxitin; KAN, kanamycin; TET, tetracycline; and TIO, ceftiofur.

b

*, Wild-type allele (no mutation); S, serine; F, phenylalanine; I, isoleucine; D, aspartic acid; N, asparagine; G, glycine.

Antimicrobial susceptibility testing.

Antimicrobial MICs were determined by using the Sensititre automated antimicrobial susceptibility system (Trek Diagnostic Systems, Westlake, OH) and interpreted according to Clinical and Laboratory Standards Institute (CLSI) standards for broth microdilution methods (7, 8). The following antimicrobials were tested: cefoxitin, ceftiofur, ceftriaxone, cephalothin, amoxicillin-clavulanate, ampicillin, sulfamethoxazole, trimethoprim, ciprofloxacin, difloxacin, enrofloxacin, levofloxacin, gatifloxacin, nalidixic acid, orbifloxacin, sarafloxacin, danofloxacin, chloramphenicol, gentamicin, streptomycin, amikacin, and tetracycline. The susceptibility to ciprofloxacin was also determined by agar dilution in order to expand the tested concentration range from 0.0075 to 128 μg/ml. E. coli ATCC 25922, 35218, Enterococcus faecalis ATCC 29212, S. aureus ATCC 29213, and P. aeruginosa ATCC 27853 were used as quality control organisms.

Selection of nalidixic acid- and ciprofloxacin-resistant mutants in vitro.

The selection of spontaneous Salmonella mutants exhibiting decreased susceptibility or resistance to nalidixic acid and/or ciprofloxacin was performed as described by Heisig and Tschorny (22) with modifications. Briefly, serovar Typhimurium S21 was grown in brain heart infusion broth (Difco, Cockeysville, MD) at 37°C overnight. The overnight culture was spread on Mueller-Hinton agar (MHA) plates (Difco) supplemented with 4 μg of nalidixic acid/ml and incubated for 24 to 48 h at 37°C. Single colonies were selected and incubated in brain heart infusion broth supplemented with the same concentration of the antibiotic used in MHA plates. The overnight culture was spread onto MHA plates supplemented with an increased concentration (8 μg/ml) of nalidixic acid. The procedure was then repeated for the selection of strains exhibiting elevated nalidixic acid MICs (16, 32, 64, and 128 μg/ml). Mutants selected from plates with 128 μg of nalidixic acid/ml were then exposed to ciprofloxacin at concentrations ranging from 0.125 to 256 μg/ml. The in vitro selection procedures were similar to those described for the nalidixic acid resistance selections. Mutants S21-1 (ciprofloxacin MIC = 0.25 μg/ml), S21-2 (ciprofloxacin MIC = 4 μg/ml), S21-3 (ciprofloxacin MIC = 32 μg/ml), and S21-4 (ciprofloxacin MIC = 256 μg/ml) were stored at −80°C until use.

Expression of MDR efflux pumps.

Known and putative efflux Salmonella pumps were identified by using the published genomic sequence database of serovar Typhimurium LT2. Coding regions suggestive of membrane transport proteins were determined by using TransportDB (http://www.membranetransport.org) and an operon prediction database (http://www.tigr.org/tigr-scripts/operons/pairs.cgi?taxon_id =110). The expression of efflux pump genes was determined by reverse transcription-PCR (RT-PCR). Briefly, total RNA was extracted from Salmonella in exponential growth phase by using RNeasy Kit (QIAGEN, Inc., Valencia, CA) and treated with a DNA-free kit (Ambion, Austin, TX) to remove contaminating DNA. The concentration of the RNA was measured by using Smartspect 300 (Bio-Rad, Hercules, CA), and 1 μg of the total RNA was used in RT-PCR assays (Access RT-PCR system; Promega, Madison, WI). The purity of RNA samples was confirmed by PCR using primers in Table 1. The RT-PCR was carried out in a 50-μl reaction containing 10× RT-PCR buffer, 2.0 mM MgSO4, 0.2 mM concentrations of each deoxynucleoside triphosphate, 50 pmol of each primer (Table 1), and 0.1 U each of Tfl DNA polymerase and avian myeloblastosis virus reverse transcriptase/μl. One-step RT-PCR was performed in a thermal cycler (GenAmp PCR system 9600; Perkin-Elmer, Foster City, CA) by incubation at 48°C for 45 min and denaturing at 94°C for 2 min, followed by 25 cycles at 94°C for 30 s, 60°C for 1 min, and 68°C for 2 min, and the further incubation at 68°C for 7 min. RT-PCR products were quantified by using an Agilent 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA) with a DNA 1000 LabChip kit. For the quantification of 16S rRNA, the total RNA was diluted 50-fold before RT-PCR. The relative expression level of the target genes was shown as a ratio of the mRNA concentration of efflux or regulatory genes other than that of the 16S rRNA gene, which was assumed to be maximally transcribed under the experimental growth conditions (11, 29). The relative expression rate was the mean of data derived from three independent experiments.

TABLE 1.

Oligonucleotide primers used for RT-PCR of regulatory and efflux genes, for sequence analysis of the quinolone resistance determining regions (QRDR) of topoisomerase genes, and for knockout, verification, and replacement of topoisomerase and efflux pump genes

Analytic method and gene Familya Oligonucleotide primer sequence
Accession no. Expected size(s) (bp)
Forward Reverse
RT-PCR
    tolC OMP CAGACGCTGATCCTCAATAC TGCTGATGGAGGCGTTAATA AE008846 717
    acrA MFP CGGTCGTTCTGATGCTCTCA GCCCTGTTGTGGAACCAGTA AE008717 885
    acrB RND AAGAGCACGCATCACTACAC CGCTTCGGACATCACGTAAA AE008717 768
    acrE MFP TGCTGGCCGGTTGTAATGAC CGTGCCTTTAATCGGGTAGA AE008856 716
    acrF RND GAGCTTGGCGGTGAAAACTA AACGCAACCAGAACGGATAG AE008856 653
    emrA MFP GCAGCAACCGGCTAAGAAGA ATCCAGACCGACGACTTTAC AE008828 850
    emrB MF ACCGAACGGCGACGTATTGA GTTGGTGCGTCATCCCTAAG AE008828 770
    emrD MF ATCCTCGTCGGCATGTCTAT GTCATCAGCAATCCCAGACT AE008877 863
    mdlB ABC GCTACAGCACGCCGATTGTA TGCCCGACGGACAGCGTATT AE008717 884
    ydhE MATE ATGTTTACGGGGATCGTACA TTAGCCAATGTCGGCCTGAT AE008762 578
    mdtB (yegN) RND CCGAATCCGCCGATTTACAG GCCATCAGCGTCAGGTTATT AE008794 803
    mdtC (yegO) RND GCCGTTCCCGTTTCGCTCAT ATCCTGTACCGCCATCAGAA AE008794 855
    marA AraC ATCCGCAGCCGTAAAATGAC TGGTTCAGCGGCAGCATATA AE008766 180
    soxS AraC AAATCGGGCTACTCCAAGTG CTACAGGCGGTGACGGTAAT AE008750 217
    16SrRNA AAAGCGTGGGGAGCAAACAG CCGCTGGCAACAAAGGATAA
Amplification of QRDR
    gyrA ACGTATTGGGCAATGACTGG GGAGTCGCCGTCAATAGAAC AE008801 180
    gyrB CAAACTGGCGGACTGTCAGG AGCCCAGCGCGGTGATCAGC AE008878 204
    parC CGTCTATGCGATGTCAGAGC TAACAGCAGCTCGGCGTATT AE008846 277
    parE GTCAATGTGCGGCATTTGTT ATCCCCTTCCACAAGGAACA AE008846 234
Gene knockout and verificationb
    tolC (A) GCCCTGCTAGCAATAATGATTAAATGATGAATTTCAAGGGTGGTGTGTAGGCTGGAGCTGCTTC GCGCCGCGCTTACCAGACCTACAAGGGCACAGGTCTGATAAGCGATGGGAATTAGCCATGGTCC 828
    tolC (B) GATCTGCTGGCTTGAACACA AAATCAGCGACGCAATCTT 1,401, 824
    acrAB (A) GTAAAAAAGGCCGCTTGCGCGGCCTTATCAACAGTGAGCAAATCAGGTGTAGGCTGGAGCTGCTTC CCTCGAGTGTCCGATTTCAAATTGGTCAATGGTCAAAGGTCCTATGGGAATTAGCCATGGTCC 828
    acrAB (B) CAGGAGAAAATAGCCAGGAA AGCGACACAGAAAATGTCCA 439, 451
    acrEF (A) CCAGGTTTTCACTCCTGCCCTCATTCATCATATTCTCTGCTGCGGTGTAGGCTGGAGCTGCTTC ATCGGCGTTTTACAACAACGAAGAATACCGGCACGAAGAAGATAATGGGAATTAGCCATGGTCC 828
    acrEF (B) CGCACAATATCGCCAAATCA ACCGCTGCGAAAACGAGAGT 854, 1,150
    emrAB (A) AGCGCAAATGCGGAGATCCAAACCCCGCAGCAACCGGCTAAGAAGTGTAGGCTGGAGCTGCTTC AGAAGATTTCGTTGGCGGAAATAATCAGCCCCTGATTCGTGATTATGGGAATTAGCCATGGTCC 828
    emrAB (B) TCCGCCTCAGCATCATTGTC GGCGGTTTGGCGAACCACAC 814, 1,063
    emrEF (A) AGCGCAAATGCGGAGATCCAAACCCCGCAGCAACCGGCTAAGAAGTGTAGGCTGGAGCTGCTTC AGAAGATTTCGTTGGCGGAAATAATCAGCCCCTGATTCGTGATTATGGGAATTAGCCATGGTCC 828
    emrEF (B) TCCGCCTCAGCATCATTGTC GGCGGTTTGGCGAACCACAC 914, 1,063
    mdlAB (A) CTTGGCGCAGTGGCCCTGCTTATGCTTATTGCGATGCTACAGCTGTGTAGGCTGGAGCTGCTTC CGTGTACGCTGGCGGCTAACTCCTCGCCAACTAACTGTAATTGAATGGGAATTAGCCATGGTCC 828
    mdlAB (B) CTCCCCCTGGTGTCTTAGTA ACAGCGAACCCAGCGTGAAC 915, 1,288
    kan TCATAGCCGAATAGCCTCTC AGCTGGCGAGCGAGGAAAAG 748
Gene replacement and verificationc
    gyrA+ (A1) CGAATAAAGCATTGTCTGGCTGCATTCCGTTTACCAGTACGTGTAGGCTGGAGCTGCTTC CCCGGATTCAAAGGTCGCAAATTATAACACATTCGCCCACATGGGAATTAGCCATGGTCC 828
    gyrA+ (B1) CACTGGCGAGCGTTCCTACA GAACAGCGCTTGCGCTAACC 1,133, 633
Open in a new tab
a

OMP, outer membrane protein; MFP, membrane fusion protein; RND, resistance nodulation-cell division; MF, major facilitator; ABC, ATP-binding cassette; MATE, multidrug and toxic compound extrusion; AraC, bacterial transcriptional activators.

b

A, used to amplify kan from plasmid pKD4 for gene knockout; B, used to verify the deletion of target genes.

c

A1, used to amplify kan gene from plasmid pKD4 for insertion into upstream of target genes; B1, used to verify the insertion of kan upstream of target genes.

Deletion of efflux pumps.

To determine the roles of multidrug resistance efflux pumps in antimicrobial resistance, efflux pump genes acrAB, acrEF, mdtABC (yegMNO), emrAB, and mdlAB and OMP gene tolC were deleted from S21 strain by using a standard chromosomal gene disruption procedure (10). Briefly, PCR products were generated by using a pair of long (60-nucleotide [nt]) primer sets A (Table 1) and special template plasmids (pKD4) carrying a kanamycin resistance gene (kan) flanked by flippase (FLP) recombinase target sites. The primers included 20 nt for template plasmids and 40-nt homologous extensions for targeting genes. The PCR products were introduced into Salmonella strain py1-competent cells expressing the phage λ Red recombinase (pKD46), which allows recombination in short homologous regions (10).

Gene deletion mutants of S21-1, S21-2, S21-3, and S21-4 were constructed by using phage P1 transduction by S21 deletion mutants. All mutations were confirmed by three PCR assays: the loss of PCR products by using primer sets A corresponding to the deleted gene sequence and two PCRs using locus-specific primer sets B and kan primers (Table 1). For each target gene, more than three independent P1-sensitive mutants were selected and tested for antimicrobial susceptibilities.

Phenotypic microarray analysis.

Ciprofloxacin-resistant serovar Typhimurium S21-3 mutant and its efflux pump deletion mutants (S21-3 ΔacrAB, S21-3 ΔtolC, S21-3 ΔmdlAB, and S21-3 ΔmdtABC [ΔyegMNO]) were examined for cellular phenotypes by using Biolog phenotype arrays (Biolog, Inc., Hayward, CA). Phenotypic microarray (PM) tests were performed in 96-well microtiter plates containing different nutrients or antimicrobials in which cell respiration was measured with a redox indicator (51). Tested compounds included antimicrobials, detergents, toxic cations, and oxidizing agents. PM tests were performed according to the manufacturer's instructions. Briefly, bacteria were grown overnight at 37°C on blood agar. Cells were picked from the agar surface with a sterile cotton swab and suspended in 15 ml of IF-0 broth (Biolog), and the cell densities were adjusted to 85% transmittance (T) on a Biolog turbidometer. A total of 600 μl of the 85% T suspension were diluted 200-fold into 120 ml of IF-10 broth (Biolog). All PM plates were inoculated with the cell suspensions at 100 μl per well, followed by incubation at 36°C in an OmniLog, and then monitored for color change in the wells. Readings were recorded for 48 h for all PMs. Kinetic data were analyzed with OmniLog-PM software (OL_PM_109M).

DNA sequence analysis of gyrA, gyrB, parC, and parE.

Amplification of the quinolone resistance determining regions (QRDRs) of gyrA, gyrB, parC, and parE, were performed using the primers in Table 1. PCR was performed in 50 μl of distilled water with 0.25 mM deoxynucleoside triphosphate, 1.5 mM MgCl2, 0.2 U of Taq enzyme, and 50 pmol each primer, using the following temperature profiles: incubation at 95°C for 10 min; followed by 90°C 30 s, 55°C 45 s, and 72°C 45 s for 30 cycles; with one final cycle of 72°C for 7 min. The PCR products were sequenced at the University of Maryland Center for Biosystems Research, and the predicted amino acid sequences of these genes were analyzed for amino acid changes by comparison with wild-type gyrA, gyrB, parC, and parE using the Sequencher program (Gene Codes Corp., Ann Arbor, MI).

Conversion of mutated gyrA to wild-type alleles.

In order to measure the relative contributions of gyrA mutations to fluoroquinolone resistance in Salmonella, the gyrA of fluoroquinolone-resistant mutants were replaced with wild-type alleles by homologous recombination. Briefly, primer sets A1 were designed to amplify a portion of the target gene and the FRT-flanked kan from template plasmid pKD46. Each primer contained 40 bp of the upstream sequence of gyrA, and 20 bp of kan. PCR products amplified using these primers were transformed to Salmonella strain py1 containing the Red helper plasmid. The transformants were selected on kanamycin plates and purified as previously described (10).

The replacement of gyrA in other fluoroquinolone-resistant Salmonella with wild-type gyrA gene was conducted by phage transduction. The replacement of mutated gyrA with wild-type allele was confirmed by PCR using primer sets B1 (Table 1) and sequencing the QRDR of gyrA.

RESULTS AND DISCUSSION

Phenotypic and genotypic characterization of serovar Typhimurium mutants.

The ciprofloxacin MICs of serovar Typhimurium S21 and derived mutants S21-1, S21-2, S21-3, and S21-4 were 0.015, 0.25, 4, 32, and 256 μg/ml, respectively (see Table 3). In addition to displaying resistance to nalidixic acid and/or ciprofloxacin, which were used in the stepwise selection process, mutants showed reduced susceptibility or resistance to other fluoroquinolones, including danafloxacin, difloxacin, enrofloxacin, gatifloxacin, levofloxacin, orbifloxacin, and sarafloxacin, and to antimicrobials of other classes such as β-lactams (amoxicillin-clavulanate, ampicillin, cephalothin, cefoxitin, and ceftiofur), chloramphenicol, tetracycline, and trimethoprim-sulfamethoxazole (see Table 3). The observation that S21 mutants not only exhibited decreased susceptibility or resistance to nalidixic acid and ciprofloxacin but other antimicrobial classes as well suggested the involvement of broad substrate efflux pumps, in particular AcrAB (11, 15, 36, 42).

Point mutations in the QRDRs of gyrA, gyrB, parC, and parE genes in S21 and its mutants were further characterized. As expected, no topoisomerase gene mutations were detected in the wild-type serovar Typhimurium S21 strain. A single gyrA mutation (S83F) was detected in all S21-derived mutants (ciprofloxacin MIC ≥ 0.25 μg/ml), and an additional point mutation in parC (S80I) was identified in fluoroquinolone-resistant mutants displaying ciprofloxacin MICs of ≥4 μg/ml. Our results confirmed that specific stepwise point mutations in topoisomerase target genes were associated with nalidixic acid and ciprofloxacin resistance, as has been previously described (6, 18, 37, 46).

Since efflux pumps have been shown to be important in bacterial resistance to many antimicrobials, 12 known and putative multidrug efflux pump and regulatory genes belonging to six families (OMP, MFP, RND, MF, ABC, and MATE) were selected to examine changes in mRNA expression in the presence of fluoroquinolone. The genes selected for study were acrA, acrB, acrE, acrF, emrA, emrB, emrD, mdlB, tolC, ydhE, mdtB (yegN), and mdtC (yegO). The relative expression levels of efflux genes and two known efflux regulatory genes (marA and soxS) in S21 and its mutants were determined by using semiquantitative RT-PCR. Several efflux genes including acrA, acrB, emrA, ydhE, and tolC showed high levels of expression (ratio over 16S rRNA of ≥0.30) in S21, compared to those of acrE, acrF, emrB, and emrD (ratio over 16S rRNA between 0.01 to 0.08) (Table 2). No expression was detected among mdlB, mdtB (yegN), and mdtC (yegO). In general, all efflux genes displayed greater relative expression levels in mutants with increased ciprofloxacin MICs. For example, in S21-3 and S21-4 with ciprofloxacin MICs of ≥32 μg/ml, acrE and mdlB showed >30-fold increased expression compared to those in S21. Increased expression of acrF was also significant among S21-3 and S21-4, but to a lesser extent (approximately 8- and 15-fold, respectively). This is the first report of a putative ABC antibiotic efflux transporter in Salmonella (mdlAB) that may be associated with fluoroquinolone resistance. Although serovar Typhimurium S21 MdlB homologue is 85% similar to E. coli MdlB, no phenotype has yet been associated with its expression in E. coli (35).

TABLE 2.

Comparison of expression levels of efflux pump and regulator genes in serovar Typhimurium S21 and its fluoroquinolone-selected mutants S21-1, S21-2, S21-3, and S21-4a

Efflux pump/regulatory genes Expression ratio over the 16S rRNA gene in S21 Relative expression level compared to its counterpart of parent strain S21
S21-1 S21-3 S21-3 S21-4
tolC 0.52 1.2 1.2 1.3 1.7
acrA 0.34 1.5 1.6 2.0 2.1
acrB 0.54 1.3 1.6 2.0 2.1
acrE 0.01 4.2 5.6 30.0 36.0
acrF 0.01 1.3 3.0 7.6 15.6
emrA 0.31 1.0 1.0 1.1 1.4
emrB 0.08 1.1 1.2 1.3 2.0
emrD 0.01 1.5 1.7 1.4 4.1
mdlB ND ND ND >34.0 >33.0
ydhE 0.40 1.0 1.0 1.0 1.1
mdtB (yegN) ND ND ND >1.3 >1.8
mdtC (yegO) ND ND ND >1.8 >1.8
marA 0.15 1.0 1.0 1.3 1.5
soxS 0.02 1.6 1.9 2.5 4.4
Open in a new tab
a

Data were derived from three independent experiments. ND, expression could not be determined.

marA was overexpressed to a greater extent than soxS (>9-fold) in wild-type S21. Some baseline expression of marA in uninduced wild-type cells has been previously seen in E. coli (1, 29). However, the highest levels of expression of both marA and soxS was observed in the high-level fluoroquinolone S21-4 strain (ciprofloxacin MIC = 256 μg/ml) (Table 2). The S21-4 mutant also had greater relative expression levels for tolC, acrA, acrB, acrE, emrA, emrB, and mdlB. The data support that of Eaves et al. (11), who postulated that the increased level of marA expression, rather than soxS, most likely explains the general increases in the levels of acrB, acrF, and acrD expression in their clinical fluoroquinolone-resistant serovar Typhimurium strains.

Role of AcrAB-TolC in fluoroquinolone-resistant serovar Typhimurium.

The efflux pump genes that showed increased expression in fluoroquinolone-resistant Salmonella mutants were selected for further analysis using deletion mutation analysis. Five deletions in efflux loci, representing 11 individual genes, were constructed in serovar Typhimurium S21 and its mutants, consisting of ΔacrAB, ΔacrEF, ΔmdtABC (ΔyegMNO), ΔemrAB, and ΔmdlAB. In addition, a deletion mutation, ΔtolC, was also created to measure the contribution of this OMP to fluoroquinolone and multidrug resistance.

Most ΔacrAB mutants showed significantly increased susceptibility to fluoroquinolones (Table 3), although the change in susceptibility to ciprofloxacin in the S21 ΔacrAB mutant could not be determined due to the high susceptibility to ciprofloxacin in S21 (MIC < 0.0015 μg/ml). The MIC of ciprofloxacin in S21-1 ΔacrAB mutant decreased from 0.25 to 0.06 μg/ml. An 8- to 16-fold reduction in MICs of other fluoroquinolones was also observed (Table 3). ΔacrAB in S21-2, S21-3, and S21-4 reduced the ciprofloxacin MICs from 4, 32, and 256 μg/ml to 0.12, 0.25 and 0.25 μg/ml, respectively. The MICs of other fluoroquinolones were also decreased by 16- to 256-fold. The deletion of TolC showed a similar effect on MICs changes of these antimicrobials, as seen in ΔacrAB mutants (Table 3). However, the deletion of other efflux pumps—ΔacrEF, ΔmdtABC (ΔyegMNO), ΔemrAB, and ΔmdlAB—were not associated with significant changes in susceptibility to fluoroquinolones (data not shown), suggesting that these efflux pumps played a limited role on the fluoroquinolone resistance in Salmonella. Interestingly, although these efflux pumps did not appear to correlate well with fluoroquinolone resistance in Salmonella, their expression was enhanced in mutants selected by exposure to fluoroquinolone (Table 2). The lack of correlation between the overexpression of efflux pumps acrEF, mdtABC (yegMN), emrAB, and mdlAB and antimicrobial susceptibility could probably be explained by the fact that all of these efflux pumps share the same regulatory system. Our results in acrF were consistent with the findings by Ricci et al., who showed that the deletion of acrF in serovar Typhimurium had no effect upon fluoroquinolone resistance (44). However, Olliver et al. (36) identified IS1 or IS10 elements integrated upstream of acrEF, which was associated with a 8- to 10-fold increase in acrF transcription that correlated well with the increased MICs of fluoroquinolone, florfenicol, and erythromycin among in vitro fluoroquinolone-selected serovar Typhimurium. Although it is difficult to evaluate the role of acrF by deleting acrF in strains such as S21-3 and S21-4 with overexpressed acrAB, the deletion of acrF in S21 did not change its susceptibility to any fluoroquinolones tested, suggesting that acrF played a limited or no role in fluoroquinolone resistance in serovar Typhimurium.

In addition to mediating fluoroquinolone susceptibility, the ΔacrAB or ΔtolC mutations also significantly increased the susceptibility of serovar Typhimurium to several other antimicrobials, including cephalothin, cefoxitin, chloramphenicol, ceftiofur, tetracycline, and trimethoprim-sulfamethoxazole (Table 2). Deletion of acrAB or tolC rendered wild-type cells hypersusceptible to chloramphenicol, trimethoprim-sulfamethoxazole, tetracycline, and ceftiofur. These results further substantiate the reports by other investigators that AcrAB-TolC is the central multiple antimicrobial resistance efflux pump in serovar Typhimurium (3, 11, 15, 44). The association of AcrAB-TolC with trimethoprim-sulfamethoxazole resistance among serovar Typhimurium S21-2, S21-3, and S21-4 mutants was unexpected, since trimethoprim resistance has been associated with the overexpression of ramA, which confers a MAR phenotype in Klebsiella pneumoniae (14), and has recently been identified in Salmonella (44, 48). However, since we did not include ramA in our expression analysis and neither Salmonella study tested for trimethoprim susceptibility, the role of this transcriptional activator in the development of resistance to trimethoprim and other antimicrobials remains unclear and warrants further analysis.

Phenotypic microarray analysis of fluoroquinolone-resistant serovar Typhimurium and isogenic deletion mutants.

Ciprofloxacin-resistant serovar Typhimurium S21-3 (MIC = 32 g/ml) and its efflux pump deletion mutants (S21-3 ΔacrAB, S21-3 ΔtolC, S21-3 ΔmdlAB, and S21-3 ΔmdtABC [ΔyegMNO]) were selected for analysis by PM. This technology can be used to identify new functions of genes by testing mutants for a large number of phenotypes simultaneously and provides a simple way to determine mutational effects on a genomewide scale (5). PM analysis showed that the deletion of acrAB or tolC substantially increased susceptibility to 53 antimicrobial drugs and other chemicals, including tetracycline, cephalosporins (cefotaxime, cefoxitin, cefuroxime, and cephalothin), fluoroquinolone, lincomycin, and macrolides (erythromycin, oleandomycin, tylosin, and josamycin). In addition to these antimicrobials, TolC was also important in intrinsic resistance to 35 agents, including toxic cations (creatinine, sodium cyanide, and sodium tungstate), detergents (cetylpyridinium chloride, and benzethonium chloride), oxidizing agents (6-mercaptopurine and lawsone), and the antibacterial flavone. Unlike acrAB and tolC, the deletion of mdlAB or yegOMN had little effect on intrinsic resistance to most of these agents. However, mdlAB and mdtABC (yegMNO) deletions were associated with increased susceptibility to 11 agents including 2,2′-dipyridyle (an Fe2+ chelator), 2-hydroxybenzoic acid, and coumarin (a DNA intercalator). In addition, PM analysis suggested an association between deletion of mdtABC (yegMNO) with intrinsic resistance to the antifungal agent patulin, and the aminoglycoside sisomicin. These findings further confirm our findings and those of other investigators that the AcrAB-TolC system is the predominant pump involved in the efflux of common antimicrobial agents and that TolC is required for AcrAB function in serovar Typhimurium (4, 44). In addition, our data suggest that mdlAB and mdtABC (yegMNO) may contribute to intrinsic resistance in serovar Typhimurium to several less commonly tested antimicrobial compounds.

Target gene mutation(s) in fluoroquinolone-resistant serovar Typhimurium.

The mechanism of nalidixic acid resistance or reduced fluoroquinolone susceptibility in our serovar Typhimurium strains was most often attributed to a single mutation in the gyrA gene, leading to an amino acid substitution either at Ser83 or Asp87. In high-level fluoroquinolone-resistant serovar Typhimurium strains, double mutations leading to an amino acid substitution in both of the 83 and 87 positions were only detected in the gyrA gene. In order to test the role of topoisomerase target gene mutations in Salmonella fluoroquinolone resistance, the mutated gyrA gene in fluoroquinolone-resistant serovar Typhimurium strains were converted to wild-type alleles in Salmonella chromosome. The conversion of gyrA in S21 and S21-1 that had no point mutations to a wild-type allele did not alter antimicrobial susceptibilities, indicating that the conversion procedure per se had no effect on their antimicrobial susceptibility (Table 3). However, the conversion of mutated gyrA S83F to gyrA+ in S21-1 reduced the nalidixic acid MIC and the ciprofloxacin MIC from 256 and 0.25 to 4 and 0.015 μg/ml, respectively. This conversion also decreased MICs to other fluoroquinolones by ∼16-fold, indicating the importance of the gyrA S83F mutation in the decreased susceptibility of fluoroquinolones in Salmonella. Although the conversion of gyrA S83F to gyrA+ in S21-2, S21-3, and S21-4 substantially lowered the MICs to nalidixic acid and fluoroquinolones, the MICs of ciprofloxacin remained relatively high in S21-2 (ciprofloxacin MIC = 0.25 μg/ml), S21-3 (ciprofloxacin MIC = 2 μg/ml), and S21-4 (ciprofloxacin MIC = 4 μg/ml). These results were in contrast to those of the ΔarcAB or ΔtolC mutants, which became fully susceptible to fluoroquinolones (MICs of between 0.12 and 0.25 μg/ml).

Increasing fluoroquinolone MICs (ciprofloxacin MICs of 4, 32, or 256 μg/ml) among the laboratory-selected serovar Typhimurium strains was associated with increasing expression of the AcrAB-TolC efflux pump, as evidenced in the deletion and replacement studies. The deletion of acrAB or tolC in S21-2, S21-3, and S21-4 mutants resulted in fluoroquinolone hypersusceptibility phenotypes (ciprofloxacin MICs ≤ 0.25 μg/ml). Conversion of gyrA (S83F) with wild-type gyrA+ in S21-2, S21-3, and S21-4 mutants lowered the ciprofloxacin MICs to between approximately 0.25 and 4 μg/ml, respectively (Table 3). Furthermore, these data add to the growing body of evidence that the AcrAB-TolC efflux pump, rather than the traditional topoisomerase gene mutations, plays a more significant role in both intrinsic susceptibility and increased resistance to fluoroquinolones in serovar Typhimurium (3, 11, 15, 36, 44).

Predominance of target mutations in naturally occurring serovar Typhimurium with decreased susceptibility and/or resistance to fluoroquinolones.

Naturally occurring serovar Typhimurium strains either displaying resistance to ciprofloxacin (CS1, CS2, and CS3; MIC = 16 μg/ml) or decreased susceptibility (CS14, CS18, and CS38; MICs = 0.06 to 0.12 μg/ml) were also subjected to gene deletion and target gene mutation conversion testing (Table 3). The CHS14, CHS18, and CHS38 strains exhibiting decreased susceptibility to ciprofloxacin each had single mutations in gyrA at D87G, S83F, and D87G, respectively, with no mutations detected in parC (Table 3). Similar to the laboratory-induced strains, ΔacrAB or ΔtolC in CHS18 caused a decrease in ciprofloxacin MIC from 0.12 to 0.03 μg/ml. The conversion of gyrA (S83F or D87G) to wild-type gyrA restored ciprofloxacin susceptibility to levels similar to those observed in ΔacrAB or ΔtolC mutants. Ciprofloxacin-resistant serovar Typhimurium CS1, CS2, and CS3 strains possessed two mutations in gyrA (S83F and D87N) and one mutation in parC (S80I) (Table 3). The deletion of acrAB or tolC in CS1, CS3, and CS9 strains reduced the MIC of ciprofloxacin by 4-fold (4- to 16-fold for other tested fluoroquinolones). The conversion of mutated gyrA to the wild-type allele reduced the MIC of ciprofloxacin by ∼500-fold (from 16 to 0.03 μg/ml) in these strains.

In contrast to laboratory mutants, the deletion of acrAB or tolC of CS1, CS3, and CS9 did not affect the susceptibility of chloramphenicol, tetracycline, and β-lactam (Table 3). The maintenance of the resistance to these drugs was due to the presence of other mechanisms of resistance in these strains. The cat1 and cat2 genes (which confer resistance to chloramphenicol), the tetB and tetA genes (which confer resistance to tetracycline), a dhfrI gene (which confers resistance to trimethoprim), and a blaOXA-1 gene (which confers resistance to ampicillin and shows decreased susceptibility to cephalothin and cefoxitin) were present in these strains. The maintenance of tetracycline resistance in CH14 and tetracycline, trimethoprim, and ampicillin resistance in CH38 strains was due to the presence of the tetA in both strains and the presence of blaTEM-1 and dhfrI in CHS38. Similar to laboratory-induced strains, the deletion of acrEF, emrAB, mdlAB, and yegMNO in these field strains did not affect the susceptibility to any of the drugs tested.

In summary, our findings indicate a combination of topoisomerase mutations and enhanced antimicrobial efflux in the development of fluoroquinolone resistance among both laboratory-derived and naturally occurring quinolone-resistant serovar Typhimurium strains. Single gyrA mutations that were acquired under laboratory-induced high-level fluoroquinolone selective pressure conferred reduced susceptibility to fluoroquinolones in serovar Typhimurium, whereas enhanced expression of the AcrAB-TolC efflux pump played a more important role in conferring high-level fluoroquinolone resistance. However, in naturally occurring fluoroquinolone-resistant serovar Typhimurium strains, gyrA double mutations appeared to contribute to a greater extent to fluoroquinolone resistance than AcrAB-TolC. Therefore, increased expression of the AcrAB-TolC system may be the initial step in allowing serovar Typhimurium to survive environmental exposures to fluoroquinolone selection pressures, followed by subsequent mutation(s) in the topoisomerase target gene(s), which contribute to high-level fluoroquinolone resistance.

Acknowledgments

This study was supported in part by grants from the Maryland Agricultural Experimental Station and the Joint Institute for Food Safety and Applied Nutrition (JIFSAN) of the University of Maryland and the U.S. Food and Drug Administration.

Footnotes

▿

Published ahead of print on 16 October 2006.

REFERENCES

  • 1.Alekshun, M. N., and S. B. Levy. 1997. Regulation of chromosomally mediated multiple antibiotic resistance: the mar regulon. Antimicrob. Agents Chemother. 41:2067-2075. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bagel, S., V. Hullen, B. Wiedemann, and P. Heisig. 1999. Impact of gyrA and parC mutations on quinolone resistance, doubling time, and supercoiling degree of Escherichia coli. Antimicrob. Agents Chemother. 43:868-875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Baucheron, S., E. Chaslus-Dancla, and A. Cloeckaert. 2004. Role of tolC and parC mutation in high-level fluoroquinolone resistance in Salmonella enterica serotype Typhimurium DT204. J. Antimicrob. Chemother. 53:657-659. [DOI] [PubMed] [Google Scholar]
  • 4.Baucheron, S., S. Tyler, D. Boyd, M. R. Mulvey, E. Chaslus-Dancla, and A. Cloeckaert. 2004. AcrAB-TolC directs efflux-mediated multidrug resistance in Salmonella enterica serovar Typhimurium DT104. Antimicrob. Agents Chemother. 48:3729-3735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Bochner, B. R., P. Gadzinski, and E. Panomitros. 2001. Phenotype microarrays for high-throughput phenotypic testing and assay of gene function. Genome Res. 11:1246-1255. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Chiu, C. H., T. L. Wu, L. H. Su, C. Chu, J. H. Chia, A. J. Kuo, M. S. Chien, and T. Y. Lin. 2002. The emergence in Taiwan of fluoroquinolone resistance in Salmonella enterica serotype Choleraesuis. N. Engl. J. Med. 346:413-419. [DOI] [PubMed] [Google Scholar]
  • 7.CLSI. 2002. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. Approved Standard, 2nd ed. CLSI document M31-A2. Clinical and Laboratory Standards Institute, Wayne, PA.
  • 8.CLSI. 2004. Performance standards for antimicrobial susceptibility testing. CLSI document M100-S14. Clinical and Laboratory Standards Institute, Wayne, PA.
  • 9.Cohen, M. L., and R. V. Tauxe. 1986. Drug-resistant Salmonella in the United States: an epidemiologic perspective. Science 234:964-969. [DOI] [PubMed] [Google Scholar]
  • 10.Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad. Sci. USA 97:6640-6645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Eaves, D. J., V. Ricci, and L. J. Piddock. 2004. Expression of acrB, acrF, acrD, marA, and soxS in Salmonella enterica serovar Typhimurium: role in multiple antibiotic resistance. Antimicrob. Agents Chemother. 48:1145-1150. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Elkins, C. A., and H. Nikaido. 2003. 3D structure of AcrB: the archetypal multidrug efflux transporter of Escherichia coli likely captures substrates from periplasm. Drug Resist. Update 6:9-13. [DOI] [PubMed] [Google Scholar]
  • 13.Gensberg, K., Y. F. Jin, and L. J. Piddock. 1995. A novel gyrB mutation in a fluoroquinolone-resistant clinical isolate of Salmonella Typhimurium. FEMS Microbiol. Lett. 132:57-60. [DOI] [PubMed] [Google Scholar]
  • 14.George, A. M., R. M. Hall, and H. W. Stokes. 1995. Multidrug resistance in Klebsiella pneumoniae: a novel gene, ramA, confers a multidrug resistance phenotype in Escherichia coli. Microbiology 141:(Pt. 8)1909-1920. [DOI] [PubMed] [Google Scholar]
  • 15.Giraud, E., A. Cloeckaert, D. Kerboeuf, and E. Chaslus-Dancla. 2000. Evidence for active efflux as the primary mechanism of resistance to ciprofloxacin in Salmonella enterica serovar Typhimurium. Antimicrob. Agents Chemother. 44:1223-1228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Glynn, M. K., C. Bopp, W. Dewitt, P. Dabney, M. Mokhtar, and F. J. Angulo. 1998. Emergence of multidrug-resistant Salmonella enterica serotype Typhimurium DT104 infections in the United States. N. Engl. J. Med. 338:1333-1338. [DOI] [PubMed] [Google Scholar]
  • 17.Hakanen, A., P. Kotilainen, J. Jalava, A. Siitonen, and P. Huovinen. 1999. Detection of decreased fluoroquinolone susceptibility in Salmonella and validation of nalidixic acid screening test. J. Clin. Microbiol. 37:3572-3577. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Hansen, H., and P. Heisig. 2003. Topoisomerase IV mutations in quinolone-resistant salmonellae selected in vitro. Microb. Drug Resist. 9:25-32. [DOI] [PubMed] [Google Scholar]
  • 19.Hawkey, P. M. 2003. Mechanisms of quinolone action and microbial response. J. Antimicrob. Chemother. 51:(Suppl. 1)29-35. [DOI] [PubMed] [Google Scholar]
  • 20.Heisig, P. 1996. Genetic evidence for a role of parC mutations in development of high-level fluoroquinolone resistance in Escherichia coli. Antimicrob. Agents Chemother. 40:879-885. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Heisig, P. 1993. High-level fluoroquinolone resistance in a Salmonella Typhimurium isolate due to alterations in both gyrA and gyrB genes. J. Antimicrob. Chemother. 32:367-377. [DOI] [PubMed] [Google Scholar]
  • 22.Heisig, P., and R. Tschorny. 1994. Characterization of fluoroquinolone-resistant mutants of Escherichia coli selected in vitro. Antimicrob. Agents Chemother. 38:1284-1291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Hirose, K., A. Hashimoto, K. Tamura, Y. Kawamura, T. Ezaki, H. Sagara, and H. Watanabe. 2002. DNA sequence analysis of DNA gyrase and DNA topoisomerase IV quinolone resistance-determining regions of Salmonella enterica serovar Typhi and serovar Paratyphi A. Antimicrob. Agents Chemother. 46:3249-3252. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Hohmann, E. L. 2001. Nontyphoidal salmonellosis. Clin. Infect. Dis. 32:263-269. [DOI] [PubMed] [Google Scholar]
  • 25.Hooper, D. C. 2001. Emerging mechanisms of fluoroquinolone resistance. Emerg. Infect. Dis. 7:337-341. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Izumiya, H., K. Mori, T. Kurazono, M. Yamaguchi, M. Higashide, N. Konishi, A. Kai, K. Morita, J. Terajima, and H. Watanabe. 2005. Characterization of isolates of Salmonella enterica serovar Typhimurium displaying high-level fluoroquinolone resistance in Japan. J. Clin. Microbiol. 43:5074-5079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Jumbe, N. L., A. Louie, M. H. Miller, W. Liu, M. R. Deziel, V. H. Tam, R. Bachhawat, and G. L. Drusano. 2006. Quinolone efflux pumps play a central role in emergence of fluoroquinolone resistance in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 50:310-317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Kaatz, G. W., S. M. Seo, and C. A. Ruble. 1993. Efflux-mediated fluoroquinolone resistance in Staphylococcus aureus. Antimicrob. Agents Chemother. 37:1086-1094. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Kern, W. V., M. Oethinger, A. S. Jellen-Ritter, and S. B. Levy. 2000. Non-target gene mutations in the development of fluoroquinolone resistance in Escherichia coli. Antimicrob. Agents Chemother. 44:814-820. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lee, L. A., N. D. Puhr, E. K. Maloney, N. H. Bean, and R. V. Tauxe. 1994. Increase in antimicrobial-resistant Salmonella infections in the United States, 1989-1990. J. Infect. Dis. 170:128-134. [DOI] [PubMed] [Google Scholar]
  • 31.Lin, J., L. O. Michel, and Q. Zhang. 2002. CmeABC functions as a multidrug efflux system in Campylobacter jejuni. Antimicrob. Agents Chemother. 46:2124-2131. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Ling, J. M., E. W. Chan, A. W. Lam, and A. F. Cheng. 2003. Mutations in topoisomerase genes of fluoroquinolone-resistant salmonellae in Hong Kong. Antimicrob. Agents Chemother. 47:3567-3573. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Miller, P. F., and M. C. Sulavik. 1996. Overlaps and parallels in the regulation of intrinsic multiple-antibiotic resistance in Escherichia coli. Mol. Microbiol. 21:441-448. [DOI] [PubMed] [Google Scholar]
  • 34.Morita, Y., N. Kimura, T. Mima, T. Mizushima, and T. Tsuchiya. 2001. Roles of MexXY- and MexAB-multidrug efflux pumps in intrinsic multidrug resistance of Pseudomonas aeruginosa PAO1. J. Gen. Appl. Microbiol. 47:27-32. [DOI] [PubMed] [Google Scholar]
  • 35.Nishino, K., and A. Yamaguchi. 2001. Analysis of a complete library of putative drug transporter genes in Escherichia coli. J. Bacteriol. 183:5803-5812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Olliver, A., M. Valle, E. Chaslus-Dancla, and A. Cloeckaert. 2005. Overexpression of the multidrug efflux operon acrEF by insertional activation with IS1 or IS10 elements in Salmonella enterica serovar Typhimurium DT204 acrB mutants selected with fluoroquinolones. Antimicrob. Agents Chemother. 49:289-301. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Olsen, S. J., E. E. DeBess, T. E. McGivern, N. Marano, T. Eby, S. Mauvais, V. K. Balan, G. Zirnstein, P. R. Cieslak, and F. J. Angulo. 2001. A nosocomial outbreak of fluoroquinolone-resistant Salmonella infection. N. Engl. J. Med. 344:1572-1579. [DOI] [PubMed] [Google Scholar]
  • 38.Paulsen, I. T. 2003. Multidrug efflux pumps and resistance: regulation and evolution. Curr. Opin. Microbiol. 6:446-451. [DOI] [PubMed] [Google Scholar]
  • 39.Paulsen, I. T., J. Chen, K. E. Nelson, and M. H. Saier, Jr. 2001. Comparative genomics of microbial drug efflux systems. J. Mol. Microbiol. Biotechnol. 3:145-150. [PubMed] [Google Scholar]
  • 40.Piddock, L. J. 2002. Fluoroquinolone resistance in Salmonella serovars isolated from humans and food animals. FEMS Microbiol. Rev. 26:3-16. [DOI] [PubMed] [Google Scholar]
  • 41.Piddock, L. J., V. Ricci, I. McLaren, and D. J. Griggs. 1998. Role of mutation in the gyrA and parC genes of nalidixic-acid-resistant Salmonella serotypes isolated from animals in the United Kingdom. J. Antimicrob. Chemother. 41:635-641. [DOI] [PubMed] [Google Scholar]
  • 42.Piddock, L. J., D. G. White, K. Gensberg, L. Pumbwe, and D. J. Griggs. 2000. Evidence for an efflux pump mediating multiple antibiotic resistance in Salmonella enterica serovar Typhimurium. Antimicrob. Agents Chemother. 44:3118-3121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Reche, M. P., J. E. Garcia de los Rios, P. A. Jimenez, A. M. Rojas, and R. Rotger. 2002. gyrA mutations associated with nalidixic acid-resistant salmonellae from wild birds. Antimicrob. Agents Chemother. 46:3108-3119. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Ricci, V., P. Tzakas, A. Buckley, and L. J. Piddock. 2006. Ciprofloxacin-resistant Salmonella enterica serovar Typhimurium strains are difficult to select in the absence of AcrB and TolC. Antimicrob. Agents Chemother. 50:38-42. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Rosner, J. L., and J. L. Slonczewski. 1994. Dual regulation of inaA by the multiple antibiotic resistance (mar) and superoxide (soxRS) stress response systems of Escherichia coli. J. Bacteriol. 176:6262-6269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Threlfall, E. J., and L. R. Ward. 2001. Decreased susceptibility to ciprofloxacin in Salmonella enterica serotype Typhi, United Kingdom. Emerg. Infect. Dis. 7:448-450. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Van Bambeke, F., E. Balzi, and P. M. Tulkens. 2000. Antibiotic efflux pumps. Biochem. Pharmacol. 60:457-470. [DOI] [PubMed] [Google Scholar]
  • 48.van der Straaten, T., R. Janssen, D. J. Mevius, and J. T. van Dissel. 2004. Salmonella gene rma (ramA) and multiple-drug-resistant Salmonella enterica serovar Typhimurium. Antimicrob. Agents Chemother. 48:2292-2294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Varma, J. K., K. D. Greene, J. Ovitt, T. J. Barrett, F. Medalla, and F. J. Angulo. 2005. Hospitalization and antimicrobial resistance in Salmonella outbreaks, 1984-2002. Emerg. Infect. Dis. 11:943-946. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Webber, M. A., and L. J. Piddock. 2001. Absence of mutations in marRAB or soxRS in acrB-overexpressing fluoroquinolone-resistant clinical and veterinary isolates of Escherichia coli. Antimicrob. Agents Chemother. 45:1550-1552. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Zhou, L., X. H. Lei, B. R. Bochner, and B. L. Wanner. 2003. Phenotype microarray analysis of Escherichia coli K-12 mutants with deletions of all two-component systems. J. Bacteriol. 185:4956-4972. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES