An epistatic effect of the female specific loci on the development of autoimmune vasculitis and antinuclear autoantibody in murine lupus

Abstract

Objective

To identify the genetic loci regulating the incidence and severity of renal autoimmune vasculitis developed in murine lupus.

Methods

Vasculitis of renal arteries was histopathologically evaluated in MRL/Mp‐Fas^lpr (MRL/lpr), C57BL/6‐ Fas^lpr (B6/lpr), (MRL/lpr×B6/lpr) F₁, and MRL/lpr×(MRL/lpr×B6/lpr) F₁ backcross mice. Using genomic DNA samples of the backcross mice, genome‐wide scans, association studies, and linkage analyses were carried out based on genotypes of polymorphic microsatellite markers. Correlations of vasculitis grade and levels of various autoantibodies were also evaluated.

Results

Two recessive susceptibility loci of the MRL allele were identified on chromosomes 4 and 1, which had previously been defined as the autoimmune related loci termed Arvm1 and Sle‐1/Nba2, respectively. The former was epistatic to the latter in a female specific manner. The titre of antinuclear autoantibody (ANA) in IgG class, but not ANA in IgM class or anti‐dsDNA in either IgG or IgM class, correlated significantly with vasculitis grade.

Conclusions

The present loci have been reported in previous studies using a different set of murine strains, suggesting that they are of importance in the development of autoimmune vasculitis in murine models. The concomitance of autoimmune vasculitis and IgG ANA suggests a shared genetic factor regulating these traits.

Several studies have shown a significant genetic predisposition towards developing common autoimmune diseases, including systemic lupus erythematosus (SLE). Taking advantage of inbred genetic composition and high genetic penetrance to disease onset, murine autoimmune models have provided not only evidence to support a genetic predisposition, but also valuable clues to the genetic interpretation of human diseases—that is, polygenic modes of inheritance, candidate genes, and genetic interactions.

The MRL/lpr mice spontaneously develop a spectrum of autoimmunity resembling human SLE. These mice stably develop glomerulonephritis, systemic vasculitis, arthritis, and sialadenitis in parallel with serum autoimmune traits and remarkable lymphoproliferation.¹ MRL/lpr is the mutant strain defective in expression of the cd95 gene.² As cd95 encodes the receptor CD95 which mediates the apoptosis signal in lymphocytes,³ its defective mutation (lpr) may explain lymphoproliferation and a defect in activation‐induced cell death of T cells.²,⁴,⁵ The cd95 sufficient mice MRL/+ are known to develop glomerulonephritis and pancreatitis with serum autoimmune traits very late in life,⁶ but the severity of glomerulonephritis and the levels of autoantibodies are much reduced in comparison with MRL/lpr, indicating that the lpr is primarily associated with the accelerated pathogenesis of autoimmunity in MRL/lpr mice. Importantly, the lpr congenic mouse B6/lpr barely develops autoimmune diseases.¹ This further indicates that MRL specific genetic factors other than the lpr are a prerequisite for the development of autoimmune diseases in MRL/lpr mice.⁷,⁸ Serum autoimmune traits such as ANA and anti‐dsDNA antibody are also known to depend on a genetic background other than the lpr.⁸ It is unknown what strain specific genetic factors are critically involved in the development of autoimmune traits.

We previously reported that renal vasculitis and glomerulonephritis were genetically segregated in the MRL/lpr×(MRL/lpr×B6/lpr) F₁ backcross mouse.⁹ The results suggested a differential genetic control for the development of each disease. However, this remains to be substantiated. Our primary aim in the present study was to examine the genetic loci associated with vasculitis. To achieve this, we prepared a large number of MRL/lpr×(MRL/lpr×B6/lpr) F₁ backcross mice (MBN₂). In all, 458 MBN₂ mice were subjected to genetic study to define the susceptibility loci to renal vasculitis. Quantitative trait locus (QTL) analysis finally showed two significant loci explaining the pathogenesis in female mice. The two loci were on chromosomes 4 and 1 in a recessive susceptibility mode of inheritance, and the former locus had an epistatic effect on the latter. As the latter locus overlapped the common interval previously represented as Sle‐1 or Nba2—which was known to be crucially associated with ANA production¹⁰—we sought for a correlation between vasculitis and autoantibody emergence in MBN₂ female mice. We present new evidence for epistatic interaction of the known loci and a serum autoimmune trait indicative of autoimmune vasculitis.

Methods

Mice

MRL/lpr and B6/lpr mice were originally purchased from the Jackson Laboratory (Bar Harbor, Maine, USA) and bred under specific‐pathogen‐free condition in the Integrated Centre for Sciences (INCS) in Ehime University. Using (MRL/lpr×B6/lpr) F₁ (MBF₁) and MRL/lpr×(MRL/lpr×B6/lpr) F₁, backcross mice (MBN₂) were prepared and housed in the same centre and in the laboratory animal centre of Kawashima Co, Gifu, Japan. For all animal experiments, we observed the Ehime University guidelines for animal experimentation.

Histological examination and grading criteria of vasculitis lesion

Mice were killed under ether anaesthesia at 19 to 20 weeks of age. Serum samples were collected and stored at −80°C until use. The kidneys were fixed with 10% formalin in 0.01 M phosphate buffer (pH 7.2), and embedded in paraffin. Tissue sections were stained with haematoxylin and eosin (H&E) or elastica‐Masson (EM) for histological examination by light microscopy. Histopathological grading for renal vasculitic lesions was done as described elsewhere.¹¹ In brief, the severity of vasculitis was graded as: 0, normal to minimal perivascular lymphocyte infiltration; 1, moderate perivascular cell infiltration associated with destruction of external elastic lamina; 2, intimal thickening with the destruction of internal elastic lamina in addition to the findings of grade 1. We observed more than 20 arteries in six sections prepared from bilateral kidneys, and defined the vasculitis grade of the animal with the maximum grade in those observations. An animal with one or more vasculitic lesions diagnosed as grade 1 or 2 was considered to have vasculitis.

Measurements of autoantibodies

The ANA titre was measured by immunoreactivity to normal murine hepatocytes as described previously.¹² Nuclear samples were prepared by stamping minced liver tissue on a glass slide, drying it completely, and fixing it in ice cold acetone for 10 minutes. Before co‐incubation of serum samples and nuclear samples, serum samples were incubated with 5 μg/ml dsDNA for two hours at 4°C to adsorb possible cross reactivity to dsDNA. After masking nuclear samples with 10% normal goat serum, serial dilutions of the serum samples were incubated on nuclear samples for two hours at 4°C. After washing with phosphate buffered saline, they were further incubated with the secondary antibody, either FITC conjugated γ chain specific anti‐mouse IgG (Zymed, South San Francisco, California, USA) or μ chain specific anti‐mouse IgM (Zymed).

The titre of the ANA index was determined as the maximum dilution point at which the nuclear signal could still be identified: 0, no staining with 1/100 dilution; 1, faintly stained with 1/100 dilution; 2, strongly stained with 1:100 dilution; 3, stained with 1:10³ dilution; 4, stained with 1:10⁴ dilution; 5, stained with 1:3×10⁴ dilution; 6, stained with 1:9×10⁴ dilution. Anti‐dsDNA titres were measured by enzyme linked immunosorbent assay (ELISA) as described previously.¹³ A unit for anti‐dsDNA titre was defined as an equivalent titre in the serum of female MRL/lpr mice.

Mapping of vasculitis susceptibility loci

Genotypes of the MBN₂ mice were determined by microsatellite analyses. We first carried out selective mapping using 48 samples consisting of 24 non‐affected mice (grade 0) and 24 affected mice (grade 2). In all, 126 microsatellite markers were used, which provided full coverage of the mouse autosomes, with an average of 12.9 cM and a maximum distance of 23 cM. The candidate chromosomes were determined using a statistical index (p<0.05) given by the χ² test. Second, QTL analysis was undertaken on candidate chromosomes using whole MBN₂ samples. We determined the polymorphism of the cd72 gene (forward 5′‐CAGCGGCTTAGAGTTGC‐3′ and reverse 5′‐GCAGGGCTTATGGAAGTAAT‐3′) and the fcgr2b gene, for which primers was kindly provided by Dr S Hirose (Juntendo University School of Medicine, Tokyo, Japan). The genetic positions of microsatellite markers and genes were based on information from the Mouse Genome Informatics (MGI), Jackson Laboratory.

Statistical analysis

In the association study, p<0.0034 (χ² >8.58, 1df) and p<0.0001 (χ² >15.13, 1df) were accepted as suggestive and significant linkages, respectively.¹⁴ The QTL analysis was undertaken using Windows QTL Cartographer (V2.5) software developed by Zeng et al with histopathological grades of vasculitis as the indicator for the phenotype.¹⁵ In detail, composite interval mapping of model 6 was adopted, and the control marker number and window size was 5 and 10 cM, respectively. The walk speed was 2 cM, and the forward regression method was selected. The threshold level of statistical significance for QTL was determined by the permutation test (1000 times permutation at p = 0.05) developed by Churchill and Doerge.¹⁶ The Kruskal–Wallis test was used to determine the association between the autoantibody titre and vasculitis. We regarded p<0.05 as significant in the Kruskal–Wallis test and the χ² test, and p<0.01 in the paired comparison in three groups.

Results

Incidence of renal vasculitis

In MBF₁, MBN₂, and MRL/lpr, renal vasculitis was characterised by a granulomatous arterial lesion associated with mononuclear cell infiltration in the perivascular region and destruction of the external elastic lamina. In addition, some mice showed intimal thickening accompanied by destruction of the internal elastic lamina. In an affected mouse with vasculitis, we were able to identify one or at most only a few lesions in 20 arteries studied, suggesting a sporadic incidence of vasculitis in the kidney. Irrespective of the severity, vasculitis generally affected a larger artery such as an interlobar or arcuate artery in the kidney. The pathological characteristics were very similar to those observed in MRL/lpr mice and intercrosses of MRL/lpr and C3H/HeJ‐Fas^lpr (C3H/lpr) strains.¹¹ The histological evaluation of the severity of vasculitis in B6/lpr, MBF₁ and MBN₂ groups of mice is summarised in table 1. No vasculitis was observed in the B6/lpr group. On the other hand, the MBF₁ and MBN₂ groups showed a 20.4% and a 39.1% incidence of vasculitis, respectively. These rates were much lower than that of the parental MRL/lpr group (82.9%; p<0.01 for MBF₁ and MBN₂). Vasculitis seemed inherited from MRL/lpr in an incompletely recessive manner. A sex difference in vasculitis incidence was not evident in all affected groups.

Table 1 Incidence of vasculitis in MRL/lpr, B6/lpr, MBF1, and MBN2 mice.

Strain	Sex	Vasculitis grade			Incidence‡
		0	1	2
MRL/lpr	Female	10	26	20	46/50 (82.1%)
	Male	4	9	13	22/26 (84.6%)
	Total	14	35	33	68/82 (82.9%)
B6/lpr	Female	10	0	0	0/10 (0%)
	Male	10	0	0	0/10 (0%)
	Total	10	0	0	0/10 (0%)
MBF1*	Female	25	7	1	8/33 (24.2%)
	Male	18	3	0	3/21 (14.3%)
	Total	43	10	1	11/54 (20.4%)
MBN2†	Female	124	49	37	86/210 (41.0%)
	Male	155	64	29	93/248 (37.5%)
	Total	279	113	66	179/458 (39.1%)

*(MRL/lpr×B6/lpr)F1.

†MRL/lpr×(MRL/lpr×B6/lpr)F1.

‡Grades 1 and 2 were regarded as positive for vasculitis.

Mapping of vasculitis susceptibility loci

We first determined four candidate chromosomes in a genome‐wide search using 126 informative microsatellite markers. Then, in an association study with all samples, we defined two markers, D4Mit271 (20.8 cM) and cd72 (22.5 cM), on chromosome 4 with statistically suggestive linkage (p<0.0034) (table 2A). Of particular importance, significant linkage to these markers was shown only in the female group (p<0.0001). These results were supported by QTL analysis, in which the highest LOD (logarithm of odds) score (2.083) was given at D4Mit271 only by the female group (fig 1A).

Figure 1 Plots of the logarithm of odds (LOD) scores of the quantitative trait locus (QTL) for renal vasculitis on (A) chromosome 4 and (B) chromosome 1. We adopted composite interval mapping of model 6 in the Windows QTL Cartographer (V2.5) software. The control marker number and window size were 5 and 10 cM, respectively. Horizontal lines indicate the threshold levels of statistic significance, which were determined by the permutation test (1000 times permutations, p = 0.05). Genetic positions with MIT markers are indicated on the horizontal axis.

Epistasis of the two loci associated with the incidence and severity of vasculitis

The distal region of mouse chromosome 1 has often been reported as a susceptibility locus for autoimmune traits, including glomerulonephritis and autoantibody emergence.¹⁰,¹⁷,¹⁸,¹⁹ The present results showed a trace linkage of this region to vasculitis, though this was not supported by the statistics (table 2B). We then sorted a large panel of mice into two groups by cd72 genotype, thereafter termed the MM group (MRL homozygote) and the MB group (MRL/B6 heterozygote), and each group was analysed in the way described above. We were able to identify a suggestive linkage of fcgr2b (92.3 cM) and D1Mit356 (95.8 cM) in the MM group (p<0.0034), but no linkage in the MB group (table 3). In QTL analysis, the MM group but not the MB group again showed a significant linkage (LOD = 3.408) at D1Mit356 (fig 1B).

Table 2 Association of microsatellite genotype and incidence of renal vasculitis in MBN2 mice.

Chromosome/sex (marker in italics)	Position (cM)	Vasculitis				χ2, 1 df	p Value‡
		Negative*		Positive*
		MM†	MB	MM	MB
A
Chr 4/Female
D4Mit319	12.1	47	77	54	32	12.6	0.00039
D4Mit271	20.8	47	77	58	28	17.7	<0.0001¶
cd72	22.5	46	78	56	30	16.0	<0.0001¶
D4Mit17	31.4	52	72	58	28	13.2	0.00027
Chr 4/Male
D4Mit319	12.1	70	85	48	45	0.97	0.32
D4Mit271	20.8	74	81	49	44	0.57	0.45
cd72	22.5	71	84	49	44	1.10	0.29
D4Mit17	31.4	65	90	44	49	0.68	0.41
Chr 4/Total
D4Mit319	12.1	116	163	102	77	10.4	0.0013
D4Mit271	20.8	120	159	107	72	12.3	0.0005§
cd72	22.5	116	163	105	74	12.7	0.0004§
D4Mit17	31.4	116	163	102	77	10.4	0.0013
B
Chr 1/Female
D1Mit268	83.4	56	68	47	39	1.83	0.18
fcgr2b	92.3	54	70	50	36	4.32	0.04
D1Mit356	95.8	56	68	51	35	4.06	0.04
D1Mit291	101.5	60	64	44	42	0.16	0.69
Chr 1/Male
D1Mit268	83.4	68	87	48	45	1.40	0.24
fcgr2b	92.3	69	86	48	45	1.17	0.28
D1Mit356	95.8	69	86	49	44	1.56	0.21
D1Mit291	101.5	69	86	49	44	1.56	0.21
Chr 1/Total
D1Mit268	83.4	124	155	95	84	3.25	0.07
fcgr2b	92.3	123	156	98	81	4.96	0.03
D1Mit356	95.8	125	154	100	79	5.34	0.02
D1Mit291	101.5	129	150	93	86	1.43	0.23

*Grades 1 and 2 were regarded as positive for vasculitis.

†Genotypes of MM and MB indicate MRL/MRL homozygote and MRL/B6 heterozygote, respectively

‡χ² test (df, degrees of freedom).

§Significant linkage.

¶Suggestive linkage.

Table 3 Association of microsatellite genotype and incidence of renal vasculitis in the CD72MM group* of MBN2 mice.

Chromosome/sex (marker in italics)	Position (cM)	Vasculitis				χ2, 1 df	p Value
		Negative†		Positive†
		MM‡	MB	MM	MB
Chr 1/Female
D1Mit268	83.4	17	28	32	24	3.75	0.05
fcgr2b	92.3	13	32	32	24	8.06	0.005
D1Mit356	95.8	13	32	32	24	8.06	0.005
D1Mit291	101.5	15	30	28	28	2.83	0.09
Chr 1/Male
D1Mit268	83.4	25	46	24	25	2.27	0.13
fcgr2b	92.3	24	47	24	25	2.78	0.10
D1Mit356	95.8	24	47	25	24	3.56	0.06
D1Mit291	101.5	24	47	24	25	2.78	0.10
Chr 1/Total
D1Mit268	83.4	42	74	56	49	6.55	0.01
fcgr2b	92.3	37	79	56	49	10.4	0.0013§
D1Mit356	95.8	37	79	57	48	11.3	0.0008§
D1Mit291	101.5	39	77	52	53	5.75	0.02

*CD72MM group includes MRL/MRL homozygotes at the cd72 locus.

†Grades 1 and 2 were regarded as positive individuals for vasculitis.

‡Genotypes of MM and MB indicate MRL/MRL homozygote and MRL/B6 heterozygote, respectively.

§Suggestive linkage (χ² test).

Next, we evaluated a combined effect of the two susceptibility loci, D1Mit356 and cd72, on the incidence or the severity of vasculitis (table 4). The two susceptibility loci showed an additive effect on the incidence and the severity of vasculitis in a female specific manner. An additive effect was not proven statistically in the male group. Importantly, a susceptible contribution of the D1Mit356 locus to the incidence and the severity of vasculitis was highly influenced by the cd72 locus. These findings indicate epistasis of the cd72 locus to the D1Mit356 locus.

Table 4 Epistatic interaction of the Arvm1 locus (cd72) and D1Mit356.

Sex		Genotype			Incidence* (%)		Mean grade
		cd72	D1Mit356
Female		MM †	MM		71.1‡		1.04§
		MM	MB		42.9‡		0.57§
		MB	MM		30.6		0.47
		MB	MB		23.4		0.32
Male		MM	MM		51.0		0.65
		MM	MB		33.8		0.42
		MB	MM		34.8		0.48
		MB	MB		33.9		0.46
Total		MM	MM		60.6‡		0.84§
		MM	MB		37.8‡		0.49§
		MB	MM		32.8		0.47
		MB	MB		29.2		0.40

*Percentage positive for vasculitis (grades 1and 2).

†Genotypes of MM and MB indicate MRL/MRL homozygote and MRL/B6 heterozygote, respectively.

‡p<0.01 (χ² test).

§p<0.01 (Mann–Whitney test).

Autoantibody correlated with vasculitis

It has often been reported that autoantibody emergence is linked to a genetic interval in the distal region of chromosome 1 in murine lupus models.¹⁰,¹⁷,¹⁸,¹⁹ Because the present results proved a genetic linkage of this region to vasculitis in the female group, we looked for a quantitative correlation between vasculitis and autoantibody in the female group. ANA titres and anti‐dsDNA were measured in serum samples collected from the 181 MBN₂ female mice. The results showed a significant correlation between ANA titre in the IgG class and vasculitis in the MM group of the cd72 locus (p = 0.00064), but no correlation in the MB group (p = 0.31). Neither ANA titre in the IgM class nor anti‐dsDNA in either class was significantly associated with vasculitis (table 5).

Table 5 Correlation of autoantibody titre and vasculitis grade in MBN2 female mice.

Genotype of cd72 and autoantibody	Vasculitis grade†			p Value
	0	1	2
CD72‐MM*	n = 37	n = 31	n = 19
ANA‐IgM	1.81 (0.97)	1.77 (1.15)	2.11 (0.88)	0.46
ANA‐IgG	3.27 (0.84)	4.06 (1.09)	4.31 (1.11)	0.00064‡
dsDNA‐IgM	0.47 (0.53)	0.44 (0.38)	0.51 (0.48)	0.41
dsDNA‐IgG	0.19 (0.26)	0.23 (0.24)	0.14 (0.09)	0.59
CD72‐MB*	n = 70	n = 13	n = 11
ANA‐IgM	1.91 (1.11)	2.08 (1.19)	2.00 (0.77)	0.74
ANA‐IgG	3.78 (1.23)	4.08 (1.32)	4.45 (1.37)	0.31
dsDNA‐IgM	0.56 (0.54)	0.55 (0.49)	0.67 (0.48)	0.66
dsDNA‐IgG	0.37 (0.56)	0.18 (0.19)	0.68 (1.15)	0.29

*Genotypes of CD72‐MM and CD72‐MB indicate MRL/MRL homozygous and MRL/B6 heterozygous at the cd72 locus, respectively.

†Mean titre (SD) of autoantibody.

‡Significant difference in autoantibody titres by the three vasculitis grades (Kruskal–Wallis test).

Discussion

The two loci identified in this study are in agreement with previous studies that revealed similar autoimmune loci. The chromosome 4 locus in our study was found to overlap the Arvm1 locus identified in the previous study.¹¹ The Arvm1 locus was shown to be a significant susceptibility locus for renal vasculitis when a group of differently backcrossed mice—MRL/lpr×(MRL/lpr×C3H/lpr) F₁ (MCN₂)—was analysed. That study further suggested that an allelic variant of the cd72 gene was a candidate genetic factor for vasculitis in the Arvm1 locus. Indeed, the primary structure of CD72 is highly polymorphic between MRL/lpr and C3H/lpr.¹¹ CD72 is an inhibitory receptor influencing B cell antigen receptor signalling.²⁰,²¹,²² It is possible that this allelic difference in CD72 affects B cell antigen receptor signalling, and somehow causes the development of autoimmunity. As the primary structure of CD72 in B6/lpr is exactly same as that of C3H/lpr, the cd72 gene is highly polymorphic between MRL/lpr and B6/lpr.¹¹,²³ Again, our study supports the candidacy of the Arvm1 locus. We would like to emphasise the significance of the Arvm1 locus on an MRL/lpr genetic background for the development of autoimmune vasculitis.

Our findings showed a female specific efficacy for the Arvm1 locus in MBN₂ mice. This is not found in previous studies with MCN₂ mice. Three possible reasons come to mind to explain this discrepancy. First, there could be a suppressive effect of minor loci in B6/lpr on the susceptibility of the Arvm1 locus in the male. We might have overlooked such minor loci in our study. Second, there could be an epistatic effect of the B6/lpr Y chromosome on the Arvm1 locus. The Y chromosome of MCN₂ male mouse originated from C3H/lpr, while that of MBN₂ male mouse originated from B6/lpr. To prove this point, experiments are necessary with reciprocal breeding to generate BMN₂ mice. Third, there might be a difference in the genes involved in the genesis of vasculitis in MCN₂ and MBN₂ cases. In this case, the function of the susceptibility gene could be controlled in a sex sensitive manner. Further studies are needed to explore these possible reasons.

The distal region of chromosome 1 defined in this study overlaps the loci previously defined as autoimmune susceptibility ones. Several lines of studies with different combinations of mouse strains and the congenic strains harbouring this region have emphasized the significance of this region in the development of autoimmunity, including glomerulonephritis and emergence of ANA.¹⁰,²⁴,²⁵ It is a new finding that this region is a potent susceptibility locus to renal vasculitis in a sensitive mode to the Arvm1 locus. This region is known to consist of many genes of immunological importance—for example, the inhibitory Fc receptor gene (fcgr2b),²⁶,²⁷,²⁸ the signalling lymphocyte activation molecule (SLAM) family genes,²⁹,³⁰,³¹,³²,³³,³⁴ and interferon inducible protein genes (Ifi).³⁵,³⁶ There is recent evidence for genetic polymorphism of this region in relation to mouse autoimmunity. According to the latest evidence, B6/lpr belongs to the group III of fcgr2b gene and the haplotype 1 of SLAM family genes, typical of non‐autoimmune prone haplotypes. On the other hand, MRL/lpr and C3H/lpr can be defined as the group I or autoimmune fcgr2b promoter haplotype (AIH) of fcgr2b gene, and the haplotype 2 of SLAM family genes, typical of autoimmune prone haplotypes.³⁷,³⁸,³⁹ It is possible that this haplotypic difference between B6/lpr and MRL/lpr is also involved in the development of vasculitis in association with ANA production. It is of particular interest to identify the genes in this region that are commonly involved in a broad spectrum of autoimmunity. In the previous study using MCN₂ mice, this region was not shown to be susceptible to vasculitis. This may reflect an overall correspondence of this region between C3H/lpr and MRL/lpr.

Our current data show an epistatic effect of the Arvm1 locus on the susceptibility of the chromosome 1 locus. Further studies should be carried out to determine the mechanism of the epistatic interaction of the two loci. Interestingly, a recent study on human SLE has shown that cd72 polymorphisms associated with alternative splicing modify the susceptibility to human SLE through epistatic interaction with fcgr2b.⁴⁰ The human loci, including the cd72 and fcgr2b genes, are syntenic of the Arvm1 locus and the distal region of chromosome 1, respectively. Although it is unclear whether or not the epistatic effect in human SLE is related to vasculitis, epistatic modes of complex loci may be important in understanding the genetic basis of the pathogenesis of SLE.

SLE usually develops a variety of disorders, including glomerulonephritis, vasculitis, dermatitis, interstitial pneumonia, and so on. There is increasing evidence from genetic studies on mouse SLE model to show that the development of each type of SLE disorder is controlled by a different set of genetic factors.⁹ This provides a possible interpretation for the pathogenic mechanism whereby human SLE has such a varied spectrum. Increased serum levels of autoantibodies are a universal feature of SLE in both human and murine models. Many kinds of autoantibody are detectable, but the genetic basis for the link between autoantibodies and SLE disease manifestations is unclear. Although the present study was not designed to address this issue fully, our findings indicate a correlation between ANA of IgG type and vasculitis. Moreover, the difference in the contribution of each class of autoantibody to vasculitis suggests differential genetic regulation of the development of these antibodies, as suggested previously.⁸,⁴¹ ANA and anti‐dsDNA are known to be correlated with the onset of glomerulonephritis; thus a single specificity of ANA for vasculitis is unlikely. Combined evaluation of two or more autoantibodies may be useful for the specific diagnosis of SLE variants.

Conclusions

We have identified a female specific vasculitis locus on chromosome 4 using MRL/lpr×(MRL/lpr×B6/lpr) F₁ backcross mice. Epistasis of this locus to the major autoimmune related locus on chromosome 1 was demonstrated. Taking advantage of the murine autoimmune model, we should make further efforts to uncover the genetic interactions of the complex loci associated with polygenic diseases. Improvements in our understanding of this field will provide new insights into the pathogenic mechanisms of human SLE.

Abbreviations

ANA - antinuclear autoantibody

QTL - quantitative trait locus

SLE - systemic lupus erythematosus