Skip to main content
Annals of the Rheumatic Diseases logoLink to Annals of the Rheumatic Diseases
. 2005 Oct 25;65(6):775–780. doi: 10.1136/ard.2005.041103

Finnish HLA studies confirm the increased risk conferred by HLA‐B27 homozygosity in ankylosing spondylitis

E Jaakkola 1,2,3,4, I Herzberg 1,2,3,4, K Laiho 1,2,3,4, M C N M Barnardo 1,2,3,4, J J Pointon 1,2,3,4, M Kauppi 1,2,3,4, K Kaarela 1,2,3,4, E Tuomilehto‐Wolf 1,2,3,4, J Tuomilehto 1,2,3,4, B P Wordsworth 1,2,3,4, M A Brown 1,2,3,4
PMCID: PMC1798178  PMID: 16249228

Abstract

Objective

To determine the influence of HLA‐B27 homozygosity and HLA‐DRB1 alleles in the susceptibility to, and severity of, ankylosing spondylitis in a Finnish population.

Methods

673 individuals from 261 families with ankylosing spondylitis were genotyped for HLA‐DRB1 alleles and HLA‐B27 heterozygosity/homozygosity. The frequencies of HLA‐B27 homozygotes in probands from these families were compared with the expected number of HLA‐B27 homozygotes in controls under Hardy–Weinberg equilibrium (HWE). The effect of HLA‐DRB1 alleles was assessed using a logistic regression procedure conditioned on HLA‐B27 and case–control analysis.

Results

HLA‐B27 was detected in 93% of cases of ankylosing spondylitis. An overrepresentation of HLA‐B27 homozygotes was noted in ankylosing spondylitis (11%) compared with the expected number of HLA‐B27 homozygotes under HWE (4%) (odds ratio (OR) = 3.3 (95% confidence interval, 1.6 to 6.8), p = 0.002). HLA‐B27 homozygosity was marginally associated with reduced BASDAI (HLA‐B27 homozygotes, 4.5 (1.6); HLA‐B27 heterozygotes, 5.4 (1.8) (mean (SD)), p = 0.05). Acute anterior uveitis (AAU) was present in significantly more HLA‐B27 positive cases (50%) than HLA‐B27 negative cases (16%) (OR = 5.4 (1.7 to 17), p<0.004). HLA‐B27 positive cases had a lower average age of symptom onset (26.7 (8.0) years) compared with HLA‐B27 negative cases (35.7 (11.2) years) (p<0.0001).

Conclusions

HLA‐B27 homozygosity is associated with a moderately increased risk of ankylosing spondylitis compared with HLA‐B27 heterozygosity. HLA‐B27 positive cases had an earlier age of onset of ankylosing spondylitis than HLA‐B27 negative cases and were more likely to develop AAU. HLA‐DRB1 alleles may influence the age of symptom onset of ankylosing spondylitis.

Keywords: ankylosing spondylitis, HLA‐B27, homozygosity, HLA‐DRB1


Ankylosing spondylitis is a chronic inflammatory rheumatic disease with a strong genetic component determining both susceptibility to, and severity of, the disease.1,2 Genes of the human major histocompatibility complex (MHC), in particular HLA‐B27, are major genetic factors influencing the familial clustering of ankylosing spondylitis, as evidenced by linkage and association studies.3 The strong association between ankylosing spondylitis and HLA‐B27 has been known since 19734,5; however, the exact genetic mechanism of the pathogenic link remains enigmatic. Whether homozygosity for HLA‐B27 contributes any additional effect on the disease is unclear. Contradictory reports on the effect of homozygosity for HLA‐B27 have been published,6,7 and there is no consensus as to whether HLA‐B27 homozygosity increases the susceptibility to, or severity of, ankylosing spondylitis.

Several haplotypic and association studies suggest that more than one gene within the human MHC may influence the susceptibility to ankylosing spondylitis. An association between HLA‐DRB1*01 and spondyloarthropathy has been reported in British and Mexican populations,8,9 while a recent Sardinian study reported an association between HLA‐DRB1*15‐B27 haplotype and ankylosing spondylitis.10,11

The objective of this study was to clarify the HLA associations in ankylosing spondylitis in a Finnish population. The Finnish population has a restricted gene pool,12 a property which can be useful in dissecting the relevant disease causing polymorphisms.13 We have investigated the influence of HLA‐DRB1 alleles and HLA‐B27 homozygosity/heterozygosity in susceptibility to, and clinical manifestations of, ankylosing spondylitis in a Finnish population.

Methods

Ankylosing spondylitis families and controls

Fifty three cases of sporadic ankylosing spondylitis and 620 persons (237 affected with ankylosing spondylitis and 383 unaffected family members) from 208 families with the disease were recruited to the study from the Rheumatism Foundation Hospital in Heinola, Finland. Of the affected families, 181 (87%) were single case families, 25 (12%) had two affected individuals, and two (1%) had three affected individuals. Ankylosing spondylitis was defined according to the modified New York Criteria for the disease,14 and all cases were assessed by a qualified rheumatologist. The data for all patients for the present study were evaluated and coded by one physician (KL). A structured questionnaire was used to assess the presence of acute anterior uveitis (AAU), inflammatory bowel disease, psoriasis, and peripheral arthritis, and to define the age of symptom onset, age at diagnosis, diagnostic delay, disease duration, and disease severity scores, including the Bath ankylosing spondylitis disease activity index (BASDAI)15 and Bath ankylosing spondylitis functional index (BASFI).16 Of the ankylosing spondylitis cases, 270 (93%) completed the questionnaire, and these cases were used to assess the clinical manifestations of the disease.

HLA‐B/DRB1 untransmitted parental haplotypes of Finnish parent–case trios with children with type 1 diabetes mellitus were used as a control sample set (n = 1763, of whom 183 were B27 positive).17

Genotyping of HLA‐DRB1 and HLA‐B

HLA‐DRB1 genotyping was carried out using either direct sequencing (see the appendix for details), the primer extension method developed in this laboratory,18 or the polymerase chain reaction–sequence specific primer (PCR‐SSP) approach.19 All the probands (n = 261) were genotyped using both the primer extension method and either direct sequencing or the PCR‐SSP; the consistency between the genotypes was checked. All the family members (n = 412) were genotyped using the primer extension approach; Mendelian segregation of HLA‐DRB1 alleles was confirmed. The control samples were typed for the HLA‐DRB1 alleles *01 to *10, using serological methods.17

Limited HLA‐B locus genotyping was undertaken by PCR‐SSP to assess HLA‐B27 homozygosity and heterozygosity.19 One PCR reaction was carried out to determine the HLA‐B27 carrier status, and five group specific PCR reactions were done to determine all the other HLA‐B alleles. PCR amplification was achieved as described by Bunce.19 Control primers amplifying a 796 base pair (bp) fragment from the third intron of HLA‐DRB1 were included in the PCR reactions. Positive controls with known HLA‐B genotypes and negative H2O controls were used in all the reactions. Mendelian segregation of HLA‐B alleles was confirmed.

Statistical analysis

The expected number of HLA‐B27 homozygotes was calculated assuming Hardy–Weinberg equilibrium (HWE) with regard to HLA‐B27. The antigen frequency of HLA‐B27 was determined from a previously published source of Finnish Bone Marrow Donor Registry based on 10 000 samples.12 Of the 10 000 individuals, 1444 were HLA‐B27 positive, corresponding to an antigen frequency of 14.4%. The expected frequency of homozygotes for HLA‐B27 in healthy controls was calculated using HWE, as follows:

Let the HLA‐B27 allele frequency be a and non‐HLA‐B27b, such that a+b = 1. The likelihood of being HLA‐B27‐antigen positive is given by:

P (B27/B27 or B27/nonB27) = a2 + 2ab

 = a2 + 2a (1‐a) = 0.144.

a2 + 2ab +b2 = 1; b2 = 1−0.144; b = 0.925;

a = 1−b =  0.0748.

The probability of being HLA‐B27 homozygote in individuals known to be HLA‐B27 positive is given by:

P (B27/B27 | B27/B27 or B27/nonB27)

 = a2/(a2 + 2ab) = a2/(a2 + 2a (1−a)) = 0.07482/0.144

 = 0.039 (3.9%)

The SIMWALK2 program (version 2.83) was used for haplotype reconstruction in all the ankylosing spondylitis families.20 Only families where at least two individuals were fully genotyped for HLA‐DRB1 and HLA‐B27 heterozygosity/homozygosity were included in the analysis. In order to assess independent effects, only one affected individual per family (proband) was chosen as a case for the case–control analysis. The HLA‐DRB1 results from the sequencing, the primer extension reactions and the PCR‐SSP were pooled to correspond to the classic HLA‐DRB1 specificities *01 to *10, as this was the typing resolution in the control population. Haplotype frequencies in ankylosing spondylitis cases and the control population were compared by χ2 analysis. The relative predispositional effect (RPE) method was used to evaluate the relative effects of HLA‐DRB1 alleles.21 A stepwise conditional logistic regression procedure was applied to further assess the relative importance of HLA‐DRB1 alleles in disease susceptibility, controlling for the effect of linkage disequilibrium (LD) with HLA‐B27.22

The quantitative transmission disequilibrium test (QTDT)23 was used to calculate the significance of differences in continuous variables between different HLA groups. QTDT incorporates variance components methodology in the analysis of family data and includes exact estimation of p values for analysis of small samples and non‐normal data. It also estimates the magnitude of the reduction or increase in the continuous variables resulting from a particular allelic transmission. Disease duration and sex correlated with BASFI and BASDAI in this dataset and they were treated as covariates in the analysis. A 2×2 contingency table using χ2 analysis was constructed to analyse the clinical manifestations of the disease. All the p values shown are two tailed and uncorrected for multiple comparisons; p values less than 0.05 were considered significant.

The LD between HLA‐B27 and HLA‐DRB1 alleles was calculated using Lewontin's standardised disequilibrium coefficient D′,24 calculated employing the program 2BY2.25 The founder haplotypes estimated using the program SIMWALK2 (version 2.83) were used as the input.20 The statistical significance of the finding was assessed using the χ2 test.

Results

In this dataset, the male to female ratio was 2.1:1. One hundred and twenty six subjects (47%) also had AAU, 18 (7%) had inflammatory bowel disease, six (2%) had psoriasis, and 210 (78%) had peripheral arthritis. The mean (SD) age at symptom onset was 27 (9) years; age at diagnosis, 35 (10) years; diagnostic delay, 8 (8) years; disease duration, 24 (11) years; age at study, 51 (11) years; BASDAI, 5.2 (1.9); and BASFI, 3.9 (2.3).

HLA class I

Table 1 gives the clinical characteristics of the ankylosing spondylitis cases stratified according to their HLA‐B27 genotype status. HLA‐B27 antigen was detected in 251 of the 270 cases (93%). Of the 126 ankylosing spondylitis cases with AAU, 123 (98%) were HLA‐B27 positive—a significant increase compared with the 122 (88%) of the 138 ankylosing spondylitis cases without AAU (χ2 = 8.4, p = 0.004; odds ratio (OR) = 5.4 (95% confidence interval (CI), 1.7 to 17)). No significant differences were noted between ankylosing spondylitis associated with IBD, psoriasis, or peripheral arthritis and the carriage status of HLA‐B27.

Table 1 Clinical description of the ankylosing spondylitis cases stratified according to their HLA‐B27 genotype and allele status.

Variable HLA‐B27 genotypes p Value
B27 +/+ cases B27 +/− cases B27−/− cases
(n = 31) (n = 220) (n = 19)
AAU (n (%)) 19 (61%) 104 (47%) 3 (16%) 0.004
IBD (n (%)) 0 15 (7%) 3 (16%) NS
Psoriasis (n (%)) 2 (6%) 4 (2%) 0 NS
Peripheral arthritis (n (%)) 21 (68%) 176 (80%) 13 (68%) NS
BASDAI (mean (SD)) 4.5 (1.6) 5.4 (1.8) 5.1 (2.4) 0.05
BASFI (mean (SD)) 3.5 (2.6) 4.0 (2.3) 4.4 (2.3) NS
Age of symptom onset (mean (SD)) 25.9 (7.3) 26.8 (8.1) 35.7 (11.2) p<0.0001
 (range) (15 to 44) (14 to 55) (18 to 54)
Age at diagnosis (mean (SD)) 32.5 (9.1) 35.1 (9.7) 43.4 (10.0) p<0.0001
 (range) (21 to 52) (18 to 73) (25 to 55)
Diagnostic delay (mean (SD)) 6.1 (6.6) 8.4 (10.9) 6.9 (6.8) NS
 (range) (0 to 24) (0 to 53) (0 to 26)
Disease duration (mean (SD)) 23.8 (10.2) 23.9 (10.3) 18.3 (12.0) NS
 (range) (8 to 48) (3 to 60) (3 to 49)

The statistical significances of differences in categorical and continuous variables were calculated using χ2 analysis (comparing B27 antigen positive and negative cases) and the quantitative transmission disequilibrium test (total association within families), respectively. All the HLA‐B27 positive ankylosing spondylitis cases were used in the data analysis.

AAU, acute anterior uveitis; BASDAI, Bath ankylosing spondylitis disease activity index; BASFI, Bath ankylosing spondylitis functional index; IBD, inflammatory bowel disease.

HLA‐B27 positive cases had a significantly younger age of symptom onset (by 5.3 years, p<0.0001) and younger age at diagnosis (by 5.5 years, p<0.0001). HLA‐B27 was associated with a marginal decrease in BASDAI (p = 0.05) by QTDT analysis. This was primarily because HLA‐B27 homozygotes had a lower mean BASDAI, while no difference was apparent comparing HLA‐B27 antigen positive and negative cases (table 1). No significant associations were noted between other clinical characteristics and HLA‐B27.

Twenty seven probands with ankylosing spondylitis were homozygotes for HLA‐B27, 213 probands were heterozygotes, and 19 probands were HLA‐B27 negative (table 2). Clear HLA‐B27 homozygote/heterozygote genotyping could not be obtained from two probands, who were therefore not considered in further analysis. Assuming HWE with regard to HLA‐B27, among the HLA‐B27 positive cases the expected number of HLA‐B27 homozygotes of 259 probands was 9 (0.039×240) and the expected number of heterozygotes, 231 (240−9). There was an overrepresentation of HLA‐B27 homozygotes among the probands (χ2 = 9.7, p = 0.002; OR = 3.3 (95% CI, 1.6 to 6.8)).

Table 2 The expected and observed number of HLA‐B27 homozygotes of the 240 HLA‐B27 positive probands.

Observed Expected
HLA‐B27 homozygote 27 (11%) 9 (4%)
HLA‐B27 heterozygote 213 (89%) 231 (96%)
Total 240 240

The expected number of homozygotes was calculated using Hardy–Weinberg equilibrium. To assess independent effects, only probands were used in the analysis.

HLA class II

The frequencies of HLA‐DRB1‐B27 haplotypes between cases and controls are presented in table 3. HLA‐B27 positive case and control haplotypes were compared. A marginal increase in the HLA‐DRB1*07‐B27 haplotype frequency was observed compared with the controls (OR = 11.1, p = 0.02), but the sample size was very small (6 v 0). No other statistically significant differences were noted.

Table 3 The number of HLA‐DRB1‐B27 haplotypes in ankylosing spondylitis cases and controls.

HLA‐B27 positive HLA‐B27 positive OR p Value
AS haplotypes control haplotypes
(n (%)) (n (%))
DRB1*01 57 (26) 45 (25) 0.9 0.82
DRB1*02 10 (5) 12 (7) 0.7 0.38
DRB1*03 5 (2) 4 (2) 0.9 0.91
DRB1*04 50 (23) 37 (20) 1.0 0.98
DRB1*05 9 (4) 11 (6) 0.7 0.41
DRB1*06 15 (7) 11 (6) 1.0 0.98
DRB1*07 6 (3) 0 11.1 0.02
DRB1*08 66 (30) 60 (33) 0.8 0.42
DRB1*09 1 (0.5) 2 (1) 0.5 0.45
DRB1*10 2 (1) 1 (0.5) 1.3 0.73
Total 221 183

221 independent ankylosing spondylitis haplotypes were reliably obtained using a family based haplotype reconstruction program SIMWALK2 (see Methods for details). The control sample set consists of HLA‐B27 positive untransmitted parental haplotypes of Finnish parent–case trios with children with type 1 diabetes mellitus.

AS, ankylosing spondylitis; OR, odds ratio.

Conditioning on HLA‐B27 within‐family analysis showed no independent associations between HLA‐DRB1 alleles and ankylosing spondylitis susceptibility (logistic regression transmission disequilibrium test: χ2 = 0.42, p = 0.52; genotype relative risk analysis: χ2 = 3.9, p = 0.70).

Several weak associations were noted between quantitative traits and HLA‐DRB1‐B27 haplotypes or HLA‐DRB1 alleles. The HLA‐DRB1*09‐B27 haplotype was associated with a 2.8 decrease in BASDAI (χ2 = 5, p = 0.03), HLA‐DRB1*04‐nonB27 with a 0.7 increase in BASFI (χ2 = 5, p = 0.03), HLA‐DRB1*08‐nonB27 with a 0.8 decrease in BASFI (χ2 = 5, p = 0.02), and the HLA‐DRB1*12 haplotype with a 1.5 decrease in BASFI (χ2 = 5, p = 0.03). Associations noted between HLA‐DRB1 alleles or haplotypes and the age of disease onset are presented in table 4. The disease severity scores did not correlate with the age of symptom onset. No significant associations between HLA‐DRB1 alleles and ankylosing spondylitis complicated by AAU, inflammatory bowel disease, or peripheral arthritis were seen.

Table 4 The associations between the age of symptom onset and HLA‐DRB1 alleles and haplotypes, calculated using the quantitative transmission disequilibrium test (QTDT).

HLA allele or haplotype Direction of association Magnitude (years) p Value
HLA‐DRB1*08 allele Younger age of symptom onset 2 0.05
HLA‐DRB1*03 allele Older age of symptom onset 6 0.001
HLA‐DRB1*13 allele Older age of symptom onset 2 0.05
HLA‐DRB1*03‐non‐B27 haplotype Older age of symptom onset 6 0.006

The estimated magnitude of the reduction or increase of the age of onset associated with a particular allelic or haplotypic transmission is presented in column 3.

LD between HLA‐B27 and HLA‐DRB1 alleles

In the probands a significantly positive LD was noted between HLA‐B27 and HLA‐DRB1*01 (D′ = 0.19, p = 0.05), and HLA‐DRB1*08 (D′ = 0.53, p = 2×10−7). A negative LD was noted between HLA‐B27 and HLA‐DRB1*02 (D′ = −0.6, p = 9×10−5), HLA‐DRB1*03 (D′ = −0.47, p = 0.03), HLA‐DRB1*11 (D′ = −0.43, p = 0.04), and HLA‐DRB1*13 (D′ = −0.42, p = 0.002).

Discussion

Previous studies on the influence of HLA‐B27 homozygosity in the development of ankylosing spondylitis have been contradictory. A significant excess of HLA homozygotes among cases of ankylosing spondylitis has been reported,6 but this has not been confirmed by others.7 The contribution of HLA‐B27 homozygosity is likely to be modest and large samples sizes are required to investigate this issue. In other studies, homozygosity for HLA has been reported to be associated with susceptibility to autoimmune diseases,26 common variable immunodeficiency,27 and an increased difficulty in clearing infections.28

In our family based cohort, HLA‐B27 homozygosity was significantly increased from that expected under HWE. There are genetic theories that could explain our findings. The increased susceptibility associated with HLA‐B27 homozygosity could be explained by the threshold model of polygenic disease, where the presence of increased number of susceptibility alleles increases the likelihood of developing the disease. Another explanation could be the possibility that some non‐HLA‐B27 alleles are relatively protective. There are also theoretical molecular mechanisms that could explain the findings. First, HLA‐B27 homozygotes may be more likely to carry abnormal HLA‐B27 molecules such as homodimers or misfolded proteins. Second, HLA‐B27 homozygotes may express an increased level of HLA‐B27 molecules. The latter is supported by the observation of greater expression of HLA‐B27 molecules in patients with ankylosing spondylitis than in healthy controls.29 However, it is also possible that the genotyping method employed failed to detect some HLA‐B alleles, which would subsequently increase the number of apparent homozygotes. This could be overcome by performing full HLA‐B locus genotyping for all the homozygous cases. It is estimated that the frequency of the alleles that are not detected by this method is very low. This is supported by the fact that no Mendelian inconsistencies were detected in these families.

A previous report has suggested that HLA‐B27 homozygosity may influence disease severity.7 A greater frequency of involvement of peripheral joints has been reported among the HLA‐B27 homozygotes.6 Surprisingly, this study noted a significant, albeit marginal, decrease in BASDAI among the HLA‐B27 homozygotes, suggesting that HLA‐B27 homozygote patients may have milder disease than HLA‐B27 heterozygotes. It is of note that BASDAI aims to measure the actual disease activity, which may have been decreased by more aggressive disease modifying drug treatment in patients with most severe disease. None of the other disease severity indices showed significant differences. These findings are consistent with the whole genome disease severity screen, in which no linkage between the disease severity indices and the MHC region was observed.30

It has been proposed that HLA‐B27 positive and HLA‐B27 negative ankylosing spondylitis represent a heterogeneous group of phenotypically similar diseases that may have different aetiopathogenic mechanisms. HLA‐B27 negative ankylosing spondylitis is rarely familial and is associated with a later age of disease onset.31,32 The current study showed a significant association between HLA‐B27 and an earlier age of symptom onset and diagnosis in ankylosing spondylitis patients, confirming the previously reported associations. However, HLA‐B27 positivity may be used as a diagnostic tool and therefore cases will be detected earlier. A recent report suggested that HLA‐B27 is also associated with an earlier onset of psoriatic arthritis.33HLA‐B27 appears to alter the threshold for developing the disease at an earlier age, but the pathogenic mechanism of this process remains unclear. The large difference between the average ages of onset suggests that the underlying disease process between the HLA‐B27 positive and negative patients may be different. In sub‐Saharan Africa the epidemic of HIV infection has been associated with a dramatic increase in the prevalence of HLA‐B27 negative spondyloarthritis,34 suggesting that environmental factors may play a crucial role in the development of HLA‐B27 negative spondyloathropathy. HLA‐B27 negative patients could merely represent phenocopies of classical HLA‐B27 associated disease. Certainly, it should not be assumed that HLA‐B27 positive and negative ankylosing spondylitis is homogeneous with regard to their aetiology or pathogenesis.

Previous studies have found several distinct associations between HLA‐DRB1 alleles. Our case–control analysis showed that HLA‐DRB1*07‐B27 haplotype frequency was marginally increased compared with the controls, but this may merely be a reflection of small sample size and random statistical fluctuation. The logistic regression analysis on HLA‐DRB1 alleles conditioned on HLA‐B27 noted no statistically significant difference between distinct HLA‐DRB1 alleles and ankylosing spondylitis susceptibility. Because of the significant LD within the MHC, HLA‐DRB1 alleles were conditioned on HLA‐B27. Owing to the extreme polymorphic nature of the HLA‐DRB1 locus and the expected modest effects of HLA class II genes on susceptibility to ankylosing spondylitis, large scale studies are required to dissect these effects. Because of limited sample size this study was underpowered to detect weak effects.

An association between HLA‐DRB1*08 and juvenile ankylosing spondylitis has been reported in Norwegian and Mexican cases.35,36 A weak association between HLA‐DRB1*08 and early age at symptom onset is reported here, supporting these previous findings. Such findings strongly suggest that both HLA‐B27 and HLA‐DRB1*08, either independently or as a haplotype, contribute to the genetic susceptibility of early onset disease. Significant positive LD between HLA‐B27 and HLA‐DRB1*08 was observed, raising the possibility that the observed association is caused by linkage disequilibrium with HLA‐B27. In this dataset neither the HLA‐DRB1*08‐B27 haplotype or HLA‐DRB1*08‐nonB27 haplotypes were associated with an earlier age of symptom onset, and thus it is unlikely that HLA‐B27 alone is responsible for the observed association.

Early onset of symptoms did not correlate with BASDAI or BASFI, suggesting that even if disease occurs earlier in the presence of predisposing genes, it is not more severe. This is consistent with previous studies, indicating that although cases with juvenile onset of ankylosing spondylitis are more likely to develop hip arthritis, their disease is otherwise similar in character to cases with adult onset disease ankylosing spondylitis.37HLA‐DRB1*03 allele and HLA‐DRB1*03‐nonB27 haplotype were associated with a later age of symptom onset, suggesting HLA‐DRB1*03—or another gene on the HLA‐B27 negative chromosomal strand—may be involved in determining this. Overall, these findings suggest that HLA‐DRB1 alleles may influence the age of symptom onset of ankylosing spondylitis. However, the reported p values are not corrected for multiple comparisons made, and the associations reported here may merely be attributable to stochastic statistical fluctuations.

AAU is more common in HLA‐B27 positive than HLA‐B27 negative cases with ankylosing spondylitis,38,39 confirmed by this study. There is no consensus among previous studies concerning the association between HLA‐DRB1*08 and AAU. An association has been reported in a Japanese population,40 and negative findings have been reported in Norwegian and Mexican studies.35,36 A possible explanation is that the juvenile ankylosing spondylitis may increase AAU. However, a recent study noted that the prevalence of iritis correlates positively with disease duration, but not with age of symptom onset.41 The present study noted no significant association between HLA‐DRB1*08 and AAU, and thus does not support the Japanese finding. The discrepant associations may be due to different ethnic background of the populations.

The disease severity was assessed using a structured questionnaire, which imposes limitations on the method. Peripheral arthritis and other extra‐articular manifestations of the disease were defined merely using the questionnaire. Systematic radiographic disease severity indices such as BASRI were not available. However, BASDAI and BASRI are closely correlated (Calin A, personal communication). Also, BASDAI and BASFI are highly heritable,2 suggesting that the random fluctuation does not significantly reduce their accuracy. Future studies using radiographic disease severity indices are warranted for a better assessment of the effect of HLA genes on disease severity.

The complexity of the LD and the density of genes make the detection of the causative variants a challenging task in the HLA region. In the healthy Finnish population HLA‐B27 has previously been reported to be in LD with HLA‐DRB1*01, *04, and *08.42 Positive LD between HLA‐B27 and HLA‐DRB1*01 and *08, and negative LD between HLA‐B27 and HLA‐DRB1*02, *03, *11, and *13 was observed. The British and Finnish populations have a similar overall LD pattern.8 The finding of this study of a significant overrepresentation of HLA‐B27‐homozygotes—and of previous studies of overrepresentation of HLA‐B60 in HLA‐B27 positive and negative cases1,43—have major implications for studies of MHC genes other than HLA‐B in ankylosing spondylitis. The past practice of matching cases and controls for HLA‐B27 antigen status is clearly not adequate, and future studies must match at least for HLA‐B27 at the allelic level.

Conclusions

HLA‐B27 homozygosity is associated with a moderately increased risk of ankylosing spondylitis compared with HLA‐B27 heterozygosity, but otherwise does not significantly affect clinical manifestations. HLA‐B27 positive cases have an earlier age of onset than HLA‐B27 negative cases and are more likely to develop acute anterior uveitis. HLA‐DRB1 alleles may influence the age of symptom onset of ankylosing spondylitis, but otherwise do not play a major role in susceptibility to the disease in Finns.

Acknowledgements

This study was supported by the Arthritis Research Campaign (United Kingdom). This study was partly funded by the Academy of Finland (grant No 46558) and EVO funds from the Rheumatism Foundation Hospital, Heinola, Finland. We would like to thank Arja Lyytikäinen for her help in recruiting the families and all the participants of the study.

Abbreviations

AAU - acute anterior uveitis

BASDAI - Bath ankylosing spondylitis disease activity index

BASFI - Bath ankylosing spondylitis functional index

HWE - Hardy–Weinberg equilibrium

LD - linkage disequilibrium

MHC - major histocompatibility complex

QTDT - quantitative transmission disequilibrium test

Appendix

The sequence based method involved eight group specific PCR amplifications with the primers HLA‐DRB1*01 (5′CAGTGTCTTCTCAGGTGGCT), HLA‐DRB1*15/16 (5′GGCCGCCTTGTGACCGGATG), HLA‐DRB1*03/08/11/13/14 (5′GCCTCAGGAAGACAGAGGAG), HLA‐DRB1*04 (5′CTTGGGATCAGAGGTAGATTTT), HLA‐DRB1*07 (5′CGGCGTCGCTGTCAGTGTT), HLA‐DRB1*09 (5′CAGTTAAGGTTCCAGTGCCA), HLA‐DRB1*10 (5′CCCACAGCGTTCTTGGAGG), and HLA‐DRB1*12 (5′AGTGTCTTCTCAGGACGCCA) prepared in a 50:50 mix with a generic reverse primer with an M13‐21 sequencing tag (5′TGTAAAACGACGGCCAGTGCCGCTGCACTGTGAAGCTCTC). Amplification was carried out in a 10 μl reaction mixture containing 50 ng DNA, 10 mM Tris‐HCl pH 8.3, 50 mM KCl, 1.5 mM MgCl2 (for HLA‐DRB1*01 and HLA‐DRB1*03/08/11/13/14) or 2.5 mM MgCl2, 25 μM of each dNTP, 0.25 U AmpliTaq Gold polymerase (Applied Biosystems, Warrington, UK), and 0.4 μM primers. The cycling conditions were as follows: 94°C for 14 minutes; 35 cycles of 94°C for 30 seconds, 55°C (for HLA‐DRB1*15/16, HLA‐DRB1*04 and HLA‐DRB1*10) or 60°C for 30 seconds, and 72°C for 30 seconds. PCR products were separated on a 3% agarose gel stained with ethidium bromide and visualised under ultraviolet light. PCR products were subsequently sequenced using M13‐21 Big Dye dye primer sequencing kit (Applied Biosystems) using following conditions: 15 cycles of 96°C for 10 seconds, 55°C for 5 seconds, 70°C for one minute, and 15 cycles of 96°C for 10 seconds and 70°C for one minute. The products were separated on 4.75% polyacrylamide gels using ABI 373 semiautomated sequencer (Applied Biosystems) and analysed using Sequencing Analysis version 3.0 and Factura version 2.0.1 (PE Applied Biosystems).

References

  • 1.Brown M A, Kennedy L G, MacGregor A J, Darke C, Duncan E, Shatford J L.et al Susceptibility to ankylosing spondylitis in twins: the role of genes, HLA, and the environment. Arthritis Rheum 1997401823–1828. [DOI] [PubMed] [Google Scholar]
  • 2.Hamersma J, Cardon L R, Bradbury L, Brophy S, van der Horst‐Bruinsma I, Calin A.et al Is disease severity in ankylosing spondylitis genetically determined? Arthritis Rheum 2001441396–1400. [DOI] [PubMed] [Google Scholar]
  • 3.Laval S H, Timms A, Edwards S, Bradbury L, Brophy S, Milicic A.et al Whole‐genome screening in ankylosing spondylitis: evidence of non‐MHC genetic‐susceptibility loci. Am J Hum Genet 200168918–926. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Brewerton D A, Hart F D, Nicholls A, Caffrey M, James D C, Sturrock R D. Ankylosing spondylitis and HL‐A 27. Lancet . 1973;i904–907. [DOI] [PubMed]
  • 5.Schlosstein L, Terasaki P I, Bluestone R, Pearson C M. High association of an HL‐A antigen, W27, with ankylosing spondylitis. N Engl J Med 1973288704–706. [DOI] [PubMed] [Google Scholar]
  • 6.Khan M A, Kushner I, Braun W E, Zachary A A, Steinberg A G. HLA‐B27 homozygosity in ankylosing spondylitis: relationship to risk and severity. Tissue Antigens 197811434–438. [DOI] [PubMed] [Google Scholar]
  • 7.Suarez‐Almazor M E, Russell A S. B27 homozygosity and ankylosing spondylitis. J Rheumatol 198714302–304. [PubMed] [Google Scholar]
  • 8.Brown M A, Kennedy L G, Darke C, Gibson K, Pile K D, Shatford J L.et al The effect of HLA‐DR genes on susceptibility to and severity of ankylosing spondylitis. Arthritis Rheum 199841460–465. [DOI] [PubMed] [Google Scholar]
  • 9.Vargas‐Alarcon G, Londono J D, Hernandez‐Pacheco G, Pacheco‐Tena C, Castillo E, Cardiel M H.et al Effect of HLA‐B and HLA‐DR genes on susceptibility to and severity of spondyloarthropathies in Mexican patients. Ann Rheum Dis 200261714–717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.La Nasa G, Mathieu A, Mulargia M, Carcassi C, Vacca A, Ledda A.et al Association of the HLA‐A2, CW2, B27, S31, DR2 haplotype with ankylosing spondylitis. A possible role of non‐B27 factors in the disease. Dis Markers 199311191–203. [DOI] [PubMed] [Google Scholar]
  • 11.Fiorillo M T, Cauli A, Carcassi C, Bitti P P, Vacca A, Passiu G.et al Two distinctive HLA haplotypes harbor the B27 alleles negatively or positively associated with ankylosing spondylitis in Sardinia: implications for disease pathogenesis. Arthritis Rheum 2003481385–1389. [DOI] [PubMed] [Google Scholar]
  • 12.Siren M K, Sareneva H, Lokki M L, Koskimies S. Unique HLA antigen frequencies in the Finnish population. Tissue Antigens 199648703–707. [DOI] [PubMed] [Google Scholar]
  • 13.Varilo T, Savukoski M, Norio R, Santavuori P, Peltonen L, Jarvela I. The age of human mutation: genealogical and linkage disequilibrium analysis of the CLN5 mutation in the Finnish population. Am J Hum Genet 199658506–512. [PMC free article] [PubMed] [Google Scholar]
  • 14.van der Linden S, Valkenburg H A, Cats A. Evaluation of diagnostic criteria for ankylosing spondylitis. A proposal for modification of the New York criteria. Arthritis Rheum 198427361–368. [DOI] [PubMed] [Google Scholar]
  • 15.Garrett S, Jenkinson T, Kennedy L G, Whitelock H, Gaisford P, Calin A. A new approach to defining disease status in ankylosing spondylitis: the Bath Ankylosing Spondylitis Disease Activity Index. J Rheumatol 1994212286–2291. [PubMed] [Google Scholar]
  • 16.Calin A, Garrett S, Whitelock H, Kennedy L G, O'Hea J, Mallorie P.et al A new approach to defining functional ability in ankylosing spondylitis: the development of the Bath Ankylosing Spondylitis Functional Index. J Rheumatol 1994212281–2285. [PubMed] [Google Scholar]
  • 17.Tuomilehto‐Wolf E, Tuomilehto J, Cepaitis Z, Lounamaa R. New susceptibility haplotype for type 1 diabetes. DIME Study Group. Lancet . 1989;ii299–302. [DOI] [PubMed]
  • 18.Jaakkola E, Herzberg I, Crane A M, Pointon J J, Laiho K, Kauppi M.et al A novel human leucocyte antigen‐DRB1 genotyping method based on multiplex primer extension reactions. Tissue Antigens 20046488–95. [DOI] [PubMed] [Google Scholar]
  • 19.Bunce M, O'Neill C M, Barnardo M C, Krausa P, Browning M J, Morris P J.et al Phototyping: comprehensive DNA typing for HLA‐A, B, C, DRB1, DRB3, DRB4, DRB5 & DQB1 by PCR with 144 primer mixes utilizing sequence‐specific primers (PCR‐SSP). Tissue Antigens 199546355–367. [DOI] [PubMed] [Google Scholar]
  • 20.Sobel E, Lange K. Descent graphs in pedigree analysis: applications to haplotyping, location scores, and marker‐sharing statistics. Am J Hum Genet 1996581323–1337. [PMC free article] [PubMed] [Google Scholar]
  • 21.Payami H, Joe S, Farid N R, Stenszky V, Chan S H, Yeo P P.et al Relative predispositional effects (RPEs) of marker alleles with disease: HLA‐DR alleles and Graves disease. Am J Hum Genet 198945541–546. [PMC free article] [PubMed] [Google Scholar]
  • 22.Cordell H J, Clayton D G. A unified stepwise regression procedure for evaluating the relative effects of polymorphisms within a gene using case/control or family data: application to HLA in type 1 diabetes. Am J Hum Genet 200270124–141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Abecasis G R, Cardon L R, Cookson W O. A general test of association for quantitative traits in nuclear families. Am J Hum Genet 200066279–292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lewontin R C. On measures of gametic disequilibrium. Genetics 1988120849–852. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Lathrop G M, Lalouel J M. Easy calculations of lod scores and genetic risks on small computers. Am J Hum Genet 198436460–465. [PMC free article] [PubMed] [Google Scholar]
  • 26.Skarsvag S, Hansen K E, Holst A, Moen T. Distribution of HLA class II alleles among Scandinavian patients with systemic lupus erythematosus (SLE): an increased risk of SLE among non[DRB1*03,DQA1*0501,DQB1*0201] class II homozygotes? Tissue Antigens 199240128–133. [DOI] [PubMed] [Google Scholar]
  • 27.De La Concha E G, Fernandez‐Arquero M, Martinez A, Vidal F, Vigil P, Conejero L.et al HLA class II homozygosity confers susceptibility to common variable immunodeficiency (CVID). Clin Exp Immunol 1999116516–520. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pollicino T, Pernice F, Campo S, Mesiti O, Misefari V, Pernice M.et al Severe outcome of hepatitis B virus (HBV) infection and lack of HBV e antigen‐defective virus emergence in patients homozygous for HLA class I alleles. J Gen Virol 1996771833–1836. [DOI] [PubMed] [Google Scholar]
  • 29.Cauli A, Dessole G, Fiorillo M T, Vacca A, Mameli A, Bitti P.et al Increased level of HLA‐B27 expression in ankylosing spondylitis patients compared with healthy HLA‐B27‐positive subjects: a possible further susceptibility factor for the development of disease. Rheumatology (Oxford) 2002411375–1379. [DOI] [PubMed] [Google Scholar]
  • 30.Brown M A, Brophy S, Bradbury L, Hamersma J, Timms A, Laval S.et al Identification of major loci controlling clinical manifestations of ankylosing spondylitis. Arthritis Rheum 2003482234–2239. [DOI] [PubMed] [Google Scholar]
  • 31.Saraux A, de Saint‐Pierre V, Baron D, Valls I, Koreichi D, Youinou P.et al The HLA B27 antigen‐spondylarthropathy association. Impact on clinical expression. Rev Rhum Engl Ed 199562487–491. [PubMed] [Google Scholar]
  • 32.Feldtkeller E, Khan M A, Van Der Heijde D, Van Der Linden S, Braun J. Age at disease onset and diagnosis delay in HLA‐B27 negative vs. positive patients with ankylosing spondylitis. Rheumatol Int 20032361–66. [DOI] [PubMed] [Google Scholar]
  • 33.Queiro R, Torre J C, Gonzalez S, Lopez‐Larrea C, Tinture T, Lopez‐Lagunas I. HLA Antigens may influence the age of onset of psoriasis and psoriatic arthritis. J Rheumatol 200330505–507. [PubMed] [Google Scholar]
  • 34.Mijiyawa M, Oniankitan O, Khan M A. Spondyloarthropathies in sub‐Saharan Africa. Curr Opin Rheumatol 200012281–286. [DOI] [PubMed] [Google Scholar]
  • 35.Ploski R, Flato B, Vinje O, Maksymowych W, Forre O, Thorsby E. Association to HLA‐DRB1*08, HLA‐DPB1*0301 and homozygosity for an HLA‐linked proteasome gene in juvenile ankylosing spondylitis. Hum Immunol 19954488–96. [DOI] [PubMed] [Google Scholar]
  • 36.Maksymowych W P, Gorodezky C, Olivo A, Alaez C, Wong C, Burgos‐Vargas R.et al HLA‐DRB1*08 influences the development of disease in Mexican Mestizo with spondyloarthropathy. J Rheumatol 199724904–907. [PubMed] [Google Scholar]
  • 37.Calin A, Elswood J. The relationship between pelvic, spinal and hip involvement in ankylosing spondylitis – one disease process or several? Br J Rheumatol 198827393–395. [DOI] [PubMed] [Google Scholar]
  • 38.Khan M A, Kushner I, Braun W E. Comparison of clinical features in HLA‐B27 positive and negative patients with ankylosing spondylitis. Arthritis Rheum 197720909–912. [DOI] [PubMed] [Google Scholar]
  • 39.Saari M, Vuorre I, Kaila J, Lahti R. Family studies of ocular manifestations in arthritis. Can J Ophthalmol 197813144–151. [PubMed] [Google Scholar]
  • 40.Monowarul Islam S M, Numaga J, Fujino Y, Masuda K, Ohda H, Hirata R.et al HLA‐DR8 and acute anterior uveitis in ankylosing spondylitis. Arthritis Rheum 199538547–550. [DOI] [PubMed] [Google Scholar]
  • 41.Brophy S, Calin A. Ankylosing spondylitis: interaction between genes, joints, age at onset, and disease expression. J Rheumatol 2001282283–2288. [PubMed] [Google Scholar]
  • 42.Westman P, Partanen J, Leirisalo‐Repo M, Koskimies S. Different DRB1*04 alleles predominate in the Finnish random population and in HLA‐B27‐positive subpopulations. Tissue Antigens 199444329–331. [DOI] [PubMed] [Google Scholar]
  • 43.Robinson W P, van der Linden S M, Khan M A, Rentsch H U, Cats A, Russell A.et al HLA‐Bw60 increases susceptibility to ankylosing spondylitis in HLA‐B27+ patients. Arthritis Rheum 1989321135–1141. [DOI] [PubMed] [Google Scholar]

Articles from Annals of the Rheumatic Diseases are provided here courtesy of BMJ Publishing Group

RESOURCES