Skip to main content
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2003 Feb;131(2):280–286. doi: 10.1046/j.1365-2249.2003.02077.x

Molecular characterization of homozygous hereditary factor I deficiency

G V BARACHO *, V NUDELMAN †, L ISAAC *
PMCID: PMC1808620  PMID: 12562389

Abstract

We have studied the molecular basis of factor I (fI) deficiency in two Brazilian sisters from a consanguineous family. By reverse transcription-polymerase chain reaction we observed that all fI cDNA amplified products from one sister had the same size as those of normal cDNA, however, they were significantly less intense. Sequencing analysis of subcloned cDNA revealed a dinucleotide insertion (AT) between positions 1204 and 1205 in the 11th exon that creates a stop codon 13 bp downstream of the insertion site. Genomic DNA sequencing and heteroduplex analysis confirmed that both probands are homozygous for this mutation, whereas their parents are heterozygous. The stop codon and the diminished amounts of fI cDNA could indicate increased fI mRNA instability, perhaps due to a mechanism of nonsense-mediated decay. This hypothesis is consistent with our observation that treatment with the translation inhibitor cycloheximide stabilized fI mRNA expression in proband's fibroblasts.

Keywords: complement system, immunodeficiency, factor I, mRNA decay, stop codon

Introduction

The glycoprotein factor I (fI) is a major regulatory protein of the complement system. fI cleaves the α′-chain of C3b (and C4b) in the presence of co-factors such as membrane co-factor protein (MCP), C4b binding-protein (C4 BP), factor H or CR1 (CD35). This limits the formation of C3- and C5-convertases and the consumption of complement components, especially those of the alternative pathway. This regulatory action also results in the generation of an array of catabolic fragments including iC3b, C3dg and C4d. These peptides remain covalently linked to micro-organism membranes and bind to complement receptors CR1, CR2 (CD21) and CR3 (CD11b, CD18) to induce pro-immune and pro-inflammatory responses [1–4].

C3 plays a major role in the activation by alternative, classical and lectin pathways. When fI fails to regulate the formation of C3 convertases, the serum concentrations of C3, factor B and sometimes factor H are markedly reduced. Clinical manifestations of fI deficiency are similar to those observed for primary C3 deficiencies and include higher susceptibility to pyogenic infections by Neisseria meningitidis, Streptococcus pneumonia and Haemophilus influenzae and increased incidence of immune complex diseases due to impaired complement-mediated functions [5].

Factor I is synthesized as an 88-kDa precursor by hepatocytes [6], monocytes [7], endothelial cells [8], Raji cells [9] and fibroblasts [10]. The mature protein, an active 583 amino-acid serine protease composed of two disulphide-linked polypeptide chains, is present in normal human serum at an approximate concentration of 35 µg/ml. The heavy chain (50 kDa) is composed of a number of modules (FI/C6/C7, CD5 and LDLr) while the light chain (38 kDa) is comprised of a single catalytic serine protease domain [11].

The human fI gene spans 63 kb on chromosome 4q25 [12] and consists of 13 exons which encode a 2·4-kb mRNA [11]. The 5′-flanking region of this gene has recently been mapped and its promoter activity was characterized [13]. In vitro fI expression is up-regulated by IL-6 [14] and IFN-g [8]. These cytokines probably trigger the protein kinase C-mediated signalling pathway which leads to the activation of transcription factors such as NF-κB and AP-1, whose binding to promoter results in transcriptional activation of several acute phase protein genes, including fI[15].

Complete fI deficiency is a rare autosomal recessive disorder and only 33 cases have so far been described [reviewed in 5,16–18]. Molecular characterization of the deficiency has been published in only one complete study in which the deficiencies in two unrelated families were found to be caused by distinct mutations [10]. We recently characterized a homozygous fI deficiency in two sisters from a Brazilian family [18] and here we describe the molecular basis responsible that explains the lack of this important protein of the complement system.

Materials And Methods

Patients

The probands [C.A.S. (20 years old) and L.R.S. (3 years old)] present complete absence of fI and low levels of serum fH, C3 and fB [18]. Their parents are first-degree cousins and have another daughter (healthy) with normal concentration of fI in her serum. In addition, most of the C3 molecules were converted into C3b fragment, consistent with impairment in regulation of the complement alternative pathway C3 convertases. C.A.S. developed systemic lupus erythematosus, glomerulonephritis and had several infectious episodes during her childhood. L.R.S. was asymptomatic until 3 years old when she developed a severe intestinal infection that evolved to sepsis, which was fatal. Both the classical and alternative hemolytic activities and the generation of complement-derived opsonins and chemotactic factors were strongly reduced in sera of both fI-deficient sisters.

Southern blotting

Genomic DNA (10 µg) from blood leukocytes was digested with EcoRI or PstI. The fragments were separated and blotted as previously described [19]. A pSP64FI plasmid containing 1·9 kb fI cDNA (kindly provided by Dr B. Morley, Rheumatology Unit, Hammersmith Hospital, Imperial College School of Medicine, London, UK) was radiolabelled and used as probe. Hybridization was performed as described [19]. Membranes were prepared for autoradiography and exposed at − 70°C for 2–5 days.

Total RNA extraction and reverse transcription-polymerase chain reaction (RT-PCR)

Human fibroblasts were obtained from skin [10]. Cells (105) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat inactivated foetal bovine serum (FBS), 2 mm l-glutamine, 50 U/ml penicillin G and 50 mg/ml streptomycin sulphate at 37°C in a humidified atmosphere containing 5% CO2. After 24 h, cell culture medium was replaced with FBS-free medium containing 1 mg/ml of lipopolysaccharide (LPS) from E. coli, 300 U/ml of recombinant human IFN-g (Calbiochem-Novabiochem Co., La Jolla, CA, USA), and 200 or 300 U/ml of recombinant human IL-6 (Calbiochem-Novabiochem Co.). Total RNA was extracted 24 h later using the Reagents Total RNA Isolation System (Promega Co., Madison, WI, USA), following manufacturer's instructions. Fibroblast RNA was only available from L.R.S. and control individuals to perform experiments using RT-PCR.

RT-PCR was performed in 50 µl reactions containing 200 ng of total RNA, 0·6 µm of each primer, reaction buffer 1 X and 5 U RT/Taq mix (SuperScript One-Step RT-PCR System, Life Technologies, Galthersburg, MD, USA). cDNA first strand was synthesized by incubation for 30 min at 50°C. Next, the amplification reaction was performed at 94°C for 2 min and 40 cycles as follows: 30 s at 94°C, 30 s at 48–55°C (depending on the combination of primers) and 1 min at 72°C. A final extension was carried out for another 7 min at 72°C. Human glyceraldeyde 3-phosphate dehydrogenase (GAPDH), C3 and factor H (fH) cDNAs were amplified as internal controls to assess the mRNA quantity and integrity. cDNA signals were quantified by densitometric analysis using an Alpha Scan Imaging Densitometer (Alpha Innotech Corporation – San Leandro, CA, USA) and normalized with respect to the GAPDH cDNA signals. The following oligonucleotide pairs (written 5′-to 3′) were used for RT-PCR: for C3 [20] GGTCAAGCAGGACTCCTTGTC and CCCTTGTTCATGA TGAGGTAGG; for fH [21] TTCTGACAGGTTCCTGGTCTG and CCATCTGTGTCACATTCACGG; for GAPDH TCTCT GCTCCTCCTGTTCGAC and GGATCTCGCTCCTGGAAG ATG; for fI [22,10] 1F2* GAGACAAAGACCCCGAACAC and 3R606 AACTGGTCTCTAATCCTCG; 1F58* TTCTGTGCT TCCACTTAAGG and 5R753* CACAGGCTTTCATCTGAG; 4F699* GATGACTTCTTTCAGTGT and 11R1443* AGCCAG AAACGATGCATG; 11F1233 CCCGACCTTAAACGTATAG and 13R1929 TGGCATAAACTCTGTGGA. The numbers before F (forward) or R (reverse) refer to the exon where the sequence is located and the numbers after refer to position within the cDNA. Asterisk designates oligonucleotides obtained from [10].

Subcloning and DNA sequencing

RT-PCR products were purified and subcloned in pGEM-T Easy Vector System (Promega Co.) according to the manufacturer's instructions. Plasmid DNA was purified from E. coli (DH10B) colonies and the DNA inserts were sequenced using the ABI PRISM BigDye Terminator Cycle Sequencing Ready Reaction (Perkin-Elmer Applied Biosystems, Foster City, CA, USA). The nucleotide sequences were compared with that of normal human fI cDNA (GenBank access number Y00318·1 [22]). To confirm the presence of mutations found in the proband's cDNA we also sequenced the PCR products (see below) obtained from the proband's and parents’ genomic DNA as well as that of a normal (control).

Polymerase chain reaction

Reactions (50 µl) contained 50 ng of genomic DNA, 20 mm Tris-HCl (pH 8·4), 50 mm KCl, 1·5 mm MgCl2, 200 mm dNTPs, 0·2 mm of each primer and 2·5 U of Taq DNA polymerase (Life Technologies). PCR reactions were performed for 40 cycles as follows: 1 min at 95°C, 1 min at 50°C and 2 min at 72°C. Final extension at 72°C was carried out for 7 min. Products were analysed after electrophoresis in agarose gels and staining with ethidium bromide. The following fI oligonucleotide pairs (written 5′-to 3′) were used for PCR: 11F1215 GTAGTAGACTGGATACAC and 11R1443; 11F1180 CCAGTAAAACTCATCGTTAC and 11R1443.

Heteroduplex analysis

PCR products were diluted (1 : 2) in denaturing solution (95% formamide, 0·05% xylene cyanole and 0·05% bromophenol blue), heated to 98°C for 5 min and kept on ice for 20 min. The total sample (6 µl) was applied to a 12·5% denatured polyacrylamide gel [Gene Gel Exel (12·5/24) – Amersham Biosciences, Buckinghamshire, UK] in which the DNA strands were separated at 7°C (80 min, 600 V, 25 mA and 15 W) in the GenePhor Electrophoresis system (Amersham Biosciences). Bands were visualised using the PlusOne DNA Silver Staining reagent on the Hoefer Automated Gel Stainer (Amersham Biosciences).

Results

Southern blotting analysis, using a 1·9-kb fI cDNA probe, did not reveal any differences in the restriction patterns of the normal controls, C.A.S., her mother and her healthy sister (D.S.) (data not shown). This indicates that this fI deficiency does not result from gross rearrangements, insertions or deletions in the fI gene. Previous molecular studies identified two point mutations in the fI genes of fI-deficient individuals, which could be identified by specific restriction site digestions. A point mutation, which abolishes a NlaIII site in the patient's fI gene, was found in that study [10]. To determine whether the same alteration could explain the lack of fI in our probands, we amplified proband and normal control genomic DNA using fI primers 11F1215 and 11R1443. The PCR products (228 bp) from both probands and the normal control were completely digested with NlaIII, generating fragments of 162 and 66 bp (data not shown). In addition, the proband and control genomic DNA were also amplified using primers 8IntF 5′-ACTTTAAACATTGGAATC-3′ and 8R 5′-AGCTTATGTAT GATTGGAGTA-3′, followed by digestion with MboII. Again, no size differences were observed in the digested PCR products between our fI-deficient patients and the normal control (data not shown) as opposed to what was observed in another fI-deficient family [23].

In light of our inability to explain the fI deficiency of our probands by previously characterized mutations, we proceeded to generate and amplify the fI cDNA from one of the probands (L.R.S.) for more detailed characterization. Shaved skin biopsies were taken from L.R.S. and a normal control in order to provide fibroblasts as RNA source. By RT-PCR, we could detect fI mRNA constitutively expressed at low levels in unstimulated cultures. Incubation of cells with LPS (1 µg/ml), human recombinant IFN-γ (300 U/ml) or IL-6 (200 and 300 U/ml) for 24 h resulted in an approximately 2–2·5-fold increase in fI cDNA production while control fI cDNA augmented approximately 1·5–2-fold increase by densitometry analysis (Fig. 1). A segment of GAPDH (337 bp) cDNA was used to normalize the reactions and densitometry analysis demonstrated that similar amounts of total RNA were analysed in each RT-PCR reaction (Fig. 1). The observed stimulation suggested that fI gene expression in L.R.S.′s fibroblasts is not affected by significant alterations in the fI promoter, at least in IFN-γ, IL-6 and LPS responsive regions.

Fig 1.

Fig 1

RT-PCR analysis of fI mRNA isolated from fibroblasts after a 24-h stimulation with LPS (1 µg/ml), IFN-γ (300 U/ml) or IL-6 (200 or 300 U/ml). Exons 11–13 were amplified with fI specific oligonucleotides 11F1233 and 13R1929 generating a 696-bp fragment. GAPDH-specific oligonucleotides were used to amplify a 337-bp fragment. NT, untreated cells; N, normal control cDNA; P, proband L.R.S. cDNA. This figure was taken from a representative experiment.

The complete extension of L.R.S.′s fI cDNA was amplified from RNA extracted from LPS-stimulated fibroblasts using the following combination of oligonucleotide primers: 1F2-3R606, 1F58-5R753, 4F699-11R1443 and 11F1233-13R1929. These four pairs of primers generated products of 604, 695, 744 and 696 bp, respectively (Fig. 2a), corresponding to exons 1–13 of the fI mRNA. RT-PCR products of the proband's fI cDNA exhibited similar sizes to those of a normal control, indicating that no major splicing errors were responsible for the deficiency. However, the intensities of the proband's products were significantly lower (1·7–9-fold lower) than those of normal as certificated by densitometry analysis using a segment of GAPDH (337 bp) cDNA to normalize the RT-PCR reactions. Segments of C3 (971 bp) and fH (323 bp) mRNAs were also amplified as positive controls and no differences were detected between the amounts produced from the proband's and control's RNAs (Fig. 2b and c). These results point to a specific defect in the transcription or stability of fI mRNA in L.R.S.′s fibroblasts. This is not due to any general transcription deficiency as the proband's fibroblasts synthesized normal levels of mRNA for constitutively expressed proteins (GAPDH) and other LPS-stimulated proteins (C3 and fH).

Fig 2.

Fig 2

Comparative RT-PCR analysis between L.R.S.′s and normal's fI mRNA expression after a 24-h LPS-stimulation of fibroblasts. (a) The complete fI cDNA was amplified employing four different oligonucleotide combinations. Numbers in parentheses indicate cDNA positions of forward and reverse primers (see Material and methods). (b) Densitometry analysis of RT-PCR derived fI cDNA products normalized with respect to the amount of a segment of GAPDH cDNA (337 bp). The graph shows reduced fI mRNA expression in the proband's fibroblasts. (c) Segments of C3 (971 bp) and factor H (323 bp) cDNA were also amplified as positive controls and normalized with respect to GAPDH cDNA. N, normal control; P, proband L.R.S.

The fI cDNA fragments obtained from L.R.S. were cloned into plasmid vectors and 10 independent clones for each product were isolated and sequenced. In addition, RT-PCR products of at least two separate RNA extractions were analysed for each fragment. Sequencing analysis of the cDNA from L.R.S. showed the presence of a unique transcript that differs from the published fI wild-type sequence due to a 2-bp insertion (AT) at codon 374 in exon 11. This mutation is designated a.1205insAT according to recommendations of the Nomenclature Working Group [24]. The dinucleotide insertion generated an in-frame premature stop codon (TAG) 13 bp downstream from the point of insertion (Fig. 3). The occurrence of this stop codon most certainly explains the absence of fI in the proband.

Fig 3.

Fig 3

Sequencing analysis of the fI gene from the probands and their family. The complete L.R.S. fI cDNA was sequenced and compared with a normal fI cDNA. An AT insertion in the 11th exon between positions 1204 and 1205 was detected in the proband sequence. This mutation generates a premature stop codon (TAG) 13 nucleotides downstream of the gene. The dinucleotide (AT) insertion was confirmed in a PCR product (263 bp) amplified from genomic DNA of both L.R.S. and her deficient sister C.A.S, using primers 11F1180–11R1443. The same mutation was also detected in approximately half of father's and mother's genomic DNA clones. The healthy daughter D.S. presented only normal fI alleles.

The fact that all independent fI cDNA clones carried the a.1205insAT mutation strongly suggested that the proband was homozygous for the mutation. In order to confirm this, we sequenced a segment of 263 bp (11F1180 and 11R1443) derived from genomic DNAs of both probands (L.R.S. and C.A.S.) as well as their healthy sister (D.S.) and their parents (Fig. 3). The a.1205insAT mutation was observed in every sequenced PCR product obtained from L.R.S and C.A.S. and in approximately half of the clones generated from their parents’ genomic DNA. This indicates that the AT insertion is located in one of the father's alleles and in one of the mother's alleles (Fig. 3). These conclusions were again confirmed by heteroduplex analysis of the genomic DNA PCR products (Fig. 4), which showed that the two fI-deficient sisters are both homozygous for the mutated allele while their parents are heterozygous (Fig. 4). The healthy sister (D.S.) was homozygous for the normal fI allele as assessed by both nucleotide sequencing (Fig. 3) and heteroduplex analysis (Fig. 4). These conclusions were further confirmed by the observation that a 1 : 1 mixture of PCR-amplified fI DNA from L.R.S. and the normal control gave the same electrophoretic pattern as that of the heterozygous parents. Additionally, a mixture of DNA from D.S. and the normal control gave a pattern indistinguishable from that observed for the samples before mixing (Fig. 4).

Fig 4.

Fig 4

Homozygous fI deficiency. (a) Pedigree of the proband's family. I.1, father; I.2, mother; II.1, healthy daughter (D.S.); II.2, fI-deficient daughter (C.A.S.); II.3, fI-deficient daughter (L.R.S.). (b) A 263-bp PCR product was amplified from genomic DNA of all family members using primers 11F1180 and 11F1443. (c) Silver-stained denaturing polyacrylamide gel of PCR product (263 bp) derived from the fI gene of the proband's family. The arrow indicates heteroduplex formation in the parents’ DNA (I.1 and I.2), and also in the mixture of the normal control and L.R.S.'s (II-3) fI DNA fragments.

The premature stop codon detected in both copies of the probands’fI gene may also account for the presence of low levels of fI mRNA in the L.R.S.′s fibroblasts, as defective transcripts are normally eliminated in order to avoid the synthesis of functionally inactive proteins [25,26]. We used a translation inhibitor (cycloheximide) in order to assess the effect of inhibiting translation on nonsense mRNA abundance. L.R.S.′s fibroblasts were incubated with 100 µg/ml cycloheximide for 1, 2 or 3 h followed by RNA extraction and RT-PCR amplification of a 604-bp fI cDNA fragment and a 337-bp GAPDH cDNA fragment (Fig. 5). fI mRNA levels were extremely low (beyond the detection limit of the gel) in L.R.S.′s fibroblasts in the absence of treatment with cycloheximide but after 1 h of treatment, the level of fI mRNA clearly increased (Fig. 5). No alterations in the concentration of constitutively expressed GAPDH mRNA (control) were detected in the same cells (Fig. 5). These results indicate that the accelerated rate of decay of fI mRNA in the proband's fibroblasts is dependent upon its association with the cellular translation machinery.

Fig 5.

Fig 5

Increased levels of nonsense fI mRNA after treatment with cycloheximide. Above: fibroblasts from fI deficient patient (L.R.S.) were treated with 100 mg/ml for 1, 2 or 3 h and the amount of fI mRNA was estimated after RT-PCR using primers 1F2- and 5R606. Below: band intensity was calculated by densitometry and normalized with respect to GAPDH. NT, cells were kept in culture medium without cycloheximide for 3 h before RNA extraction. These figures were taken from a representative experiment.

Discussion

To date, only one complete study of the molecular basis of human fI deficiency was reported [10]. These authors found a replacement of A1282T in exon 11, which substitutes histidine 400 with leucine. One hypothesis considered at the time was that the mutation possibly impaired fI secretion from the LPS-stimulated fibroblasts. However, this possibility was discarded as fibroblasts from normal or deficient individuals secreted approximately equivalent amounts of this protein. Another hypothesis for the deficiency was that the mutation reduces the conformational stability of the protein and therefore increases its susceptibility to degradation by serum proteases [10].

Southern blotting analysis failed to detect evidence of gross rearrangements in the proband's fI gene. Restriction and sequencing analysis also failed to detect specific mutations previously described in other fI-deficient patients such as: (a) the above-mentioned A to T transvertion at position 1282 [10] (b) a splicing error of exon 5 [10] (c) a C1449T transition in exon 12 resulting in a premature termination codon [23] (d) a G936A transition which changes glutamic acid 285 to lysine and (e) a premature stop codon at nucleotide 942 [23].

Sequencing studies of the proband L.R.S.′s complete cDNA revealed the presence of an insertion of two nucleotides (AT) between positions 1204 and 1205 (exon 11) whose resultant frameshift creates a premature termination codon (TAG) shortly downstream of the insertion site. This mutation was detected in all clones derived from L.R.S. and C.A.S. genomic DNA, indicating that both probands are homozygous for the mutant allele. The proband's parents are heterozygous for the mutant allele as ∼50% of the clones derived from both parents genomic DNA carried the same mutation. The third healthy sister (D.S.) was found to be homozygous for the normal allele. These conclusions, confirmed by heteroduplex assays, are consistent with the autosomal recessive inheritance observed for this fI deficiency.

During the course of our RT-PCR amplifications of the fI cDNA from L.R.S., mRNA isolated from stimulated proband's fibroblasts consistently generated significantly less RT-PCR products than normal control mRNA. Though the possibility of a defect in the fI gene promoter cannot be ruled out, we consider this hypothesis unlikely as the expression levels of fI mRNA in the L.R.S.′s fibroblasts clearly increased after treatment with either LPS, IL-6 or IFN-γ. This indicates that the promoter in the mutant allele remains responsive to specific stimuli that are known to increase fI expression levels [13,14].

The mutant allele codes for a 378 amino acid polypeptide, corresponding to the fI light chain that contains the serine protease domain [11]. As truncated proteins are known in some cases to be toxic, the possibility exists that fI transcripts in the probands suffer a greater turnover so as to reduce the rate of synthesis and consequent accumulation of truncated products [25,26]. This phenomenon, known as nonsense-mediated decay (NMD), is a physiological process that requires mRNA scanning by the ribosome in order to detect the stop codon [27,28]. Furthermore, protein synthesis inhibition, which should reduce the kinetics of mRNA–ribosome association, is known to reverse NMD [27,28]. In this study, we demonstrated that treatment of proband fibroblasts with the protein synthesis inhibitor cycloheximide resulted in increased fI mRNA expression. This observation strongly supports the hypothesis that NMD is responsible for the reduced levels of mutant fI mRNA in these cells.

As many human genetic diseases are caused by the presence of premature stop codons, the physiological importance of NMD in attenuating the production of truncated proteins should be considered. The specific gene products and mRNA sequences that mediate this process remain to be fully elucidated. The NMD mechanism is better understood in Caenorhabditis elegans than in humans and few studies have explored the relevance of NMD in human genetic diseases. A dominantly inherited form of β-thalassemia [29] is the best understood human model. In this case, the presence and absence of NMD was shown to be the determining factor between mild and severe forms of the syndrome. More recently, NMD was described in human ataxia telangiectasia-like immunodeficiency [30]. We previously suggested the participation of NMD in two other independent complement C3 primary deficiencies. Both were caused by premature termination codons and had significantly low amounts of C3 mRNA [31,32; and Reis, Nudelman & Isaac (manuscript in preparation)].

In conclusion, we have demonstrated that the molecular basis of a new fI deficiency is caused by a dinucleotide insertion in exon 11, resulting in a frameshift in the mRNA. This frameshift mutation generates a premature termination codon that is responsible for the lack of functional fI in the probands. We also present evidence that associates the observed low levels of mutant messenger RNA to a mechanism of nonsense-mediated decay.

Acknowledgments

We thank the probands’ family for their co-operation in this study and Dr C. Isaac for performing the skin biopsies. We also thank Dr C. A. Moreira Filho [Departamento de Imunologia, Instituto de Ciências Biomédicas, Universidade de São Paulo (USP)] for assistance with heteroduplex assays and Drs C. S. Farah, A. C. R. da Silva, R. B. Quaggio and F. C. Reinach for the use of the nucleotide sequencing facilites at the Departamento de Bioquímica, Instituto de Química, USP. Supported by Fundação de Amparo à Pesquisa do Estado de São Paulo and Conselho Nacional de Pesquisa e Desenvolvimento Tecnológico, Brazil. We are in debt to Dr C. S. Farah for his critical review of this manuscript.

References

  • 1.Hebell T, Ahearn JM, Fearon DT. Suppression of the immune response by a soluble complement receptor of B lymphocytes. Science. 1991;254:102–5. doi: 10.1126/science.1718035. [DOI] [PubMed] [Google Scholar]
  • 2.Croix D, Ahearn J, Rosengard A, Han S, Kelsoe G, Ma M, Carroll MC. Antibody response to a T-dependent antigen requires B cell expression of complement receptors. J Exp Med. 1996;183:1857–64. doi: 10.1084/jem.183.4.1857. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Dempsey PW, Allison MED, Akkaraju S, Goodnow CC, Fearon DT. C3d of complement as a molecular adjuvant: bridging innate and acquired immunity. Science. 1996;271:348–50. doi: 10.1126/science.271.5247.348. [DOI] [PubMed] [Google Scholar]
  • 4.Molina H, Holers VM, Li B, Fang Y-F, Mariathasan S, Goellner J, Strauss-Schoenberger J, Karr RW, Chaplin DD. Markedly impaired humoral immune response in mice deficient in complement receptors 1 and 2. Proc Natl Acad Sci USA. 1996;93:3357–61. doi: 10.1073/pnas.93.8.3357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Vyse TJ, Späth PJ, Davies KA, Morley BJ, Philippe P, Athanassiou P, Giles CM, Walport MJ. Hereditary complement factor I deficiency. Q J Med. 1994;87:385–402. [PubMed] [Google Scholar]
  • 6.Goldberger G, Arnaout MA, Aden D, Kay R, Ritz M, Colten HR. Biosynthesis and postsynthesis processing of human C3b/C4b inactivator (factor I) in three hepatoma cell lines. J Biol Chem. 1984;259:6492–7. [PubMed] [Google Scholar]
  • 7.Whaley K. Biosynthesis of the complement components and the regulatory proteins of the alternative complement pathway by the human peripheral blood monocytes. J Exp Med. 1980;151:501–16. doi: 10.1084/jem.151.3.501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Julen N, Dauchel H, Lemercier CD, Sim RB, Fontaine M, Ripoche J. In vitro biosynthesis of complement factor I by human endothelial cells. Eur J Immunol. 1992;22:213–7. doi: 10.1002/eji.1830220131. [DOI] [PubMed] [Google Scholar]
  • 9.Vetvicka V, Reed W, Hoover ML, Ross GD. Complement factor H and I synthesized by B cells lines function to generate a growth factor activity from C3. J Immunol. 1993;150:4052–60. [PubMed] [Google Scholar]
  • 10.Vyse TJ, Morley BJ, Bartók I, Theodoridis EL, Davies KA, Webster ADB, Walport MJ. The molecular basis of hereditary complement factor I deficiency. J Clin Invest. 1996;97:925–33. doi: 10.1172/JCI118515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Vyse TJ, Bates GP, Walport MJ, Morley BJ. The organization of the human complement factor I gene (IF): a member of the serine protease gene family. Genomics. 1994;24:90–8. doi: 10.1006/geno.1994.1585. [DOI] [PubMed] [Google Scholar]
  • 12.Shiang R, Murray JC, Morton CC, Buetow KH, Wasmuth JJ, Olney AH, Sanger WG, Goldberger G. Mapping of the human complement factor I gene to 4q25. Genomics. 1989;4:82–6. doi: 10.1016/0888-7543(89)90318-2. [DOI] [PubMed] [Google Scholar]
  • 13.Paramaswara B, Minta JO. An initiator element and a proximal cis-acting sequence are essential for transcriptional activation of the complement factor I (CFI) gene. Gene. 1999;237:71–80. doi: 10.1016/s0378-1119(99)00304-2. [DOI] [PubMed] [Google Scholar]
  • 14.Minta JO, Fung M, Paramaswara B. Transcriptional and post-transcriptional regulation of complement factor I (CFI) gene expression in Hep-G2 cells by interleukin-6. Biochim Biophys Acta. 1998;1442:286–95. doi: 10.1016/s0167-4781(98)00189-4. [DOI] [PubMed] [Google Scholar]
  • 15.Minta JO, Fung M. Transcriptional modulation of the human complement factor I gene in Hep-G2 cells by protein kinase C activation. Mol Cell Bioch. 1999;201:111–23. doi: 10.1023/a:1007064602321. [DOI] [PubMed] [Google Scholar]
  • 16.Leitão MF, Vilela MMS, Rutz R, Grumach AS, Condino-Neto A, Kirschfink M. Complement factor I deficiency in a family with recurrent infections. Immunopharmacol. 1997;38:207–13. doi: 10.1016/s0162-3109(97)00080-5. [DOI] [PubMed] [Google Scholar]
  • 17.Naked GM, Pereira MCF, Ferreira de Paula P, Vinet AMR, Inostroza JS, Isaac L. Deficiency of human complement factor I associated with lowered factor H. Clin Immunol. 2000;96:1662–77. doi: 10.1006/clim.2000.4878. [DOI] [PubMed] [Google Scholar]
  • 18.Amadei N, Baracho GV, Nudelman V, Bastos W, Florido MPC, Isaac L. Inherited complete factor I deficiency and systemic lupus erythematosus in a family with low levels of factor H. Scand J Immunol. 2001;53:615–21. doi: 10.1046/j.1365-3083.2001.00931.x. [DOI] [PubMed] [Google Scholar]
  • 19.Sambrook J, Fritsch EF, Maniatis T, editors. Molecular cloning: a laboratory manual. 3. Cold Spring Harbor: Cold Spring: Harbor Laboratory Press; 1989. [Google Scholar]
  • 20.de Bruijin MHL, Fey G. Human complement component C3: cDNA coding sequence and derived primary structure. Proc Natl Acad Sci USA. 1985;82:707–12. doi: 10.1073/pnas.82.3.708. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ripoche J, Day AJ, Harris TJ, Sim RB. The complete amino acid sequence of human complement factor H. Biochem J. 1988;249:593–602. doi: 10.1042/bj2490593. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Catterall CF, Lyons A, Sim RB, Day AJ, Harris TJR. Characterization of the primary amino acid sequence of human complement control protein factor I from an analysis of cDNA. Biochem J. 1987;242:849–56. doi: 10.1042/bj2420849. Submission to GenBank: http://wwwncbinlmnihgov/blast. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Morley BJ, Bartók I, Späth PJ, Vyse TJ, Schneider PM, Walport MJ. Molecular basis of hereditary factor I deficiency. Mol Immunol. 1998;35:344. [Google Scholar]
  • 24.Antonarakis SE and the Nomenclature Working Group. Recommendations for a nomenclature system for human gene mutations. Hum Mut. 1998;11:1–3. doi: 10.1002/(SICI)1098-1004(1998)11:1<1::AID-HUMU1>3.0.CO;2-O. [DOI] [PubMed] [Google Scholar]
  • 25.Maquat LE. When cells stop making sense. Effects of nonsense codons on RNA metabolism in vertebrate cells. RNA. 1995;1:453–65. [PMC free article] [PubMed] [Google Scholar]
  • 26.Maquat LE. Defects in RNA splicing and the consequence of shortened translational reading frames. Am J Hum General. 1996;59:279–86. [PMC free article] [PubMed] [Google Scholar]
  • 27.Lykke-Andersen J, Shu M-D, Steitz JA. Human Upf proteins target a mRNA for nonsense-mediated decay when bound downstream of a termination codon. Cell. 2000;103:1121–31. doi: 10.1016/s0092-8674(00)00214-2. [DOI] [PubMed] [Google Scholar]
  • 28.Kim VN, Kataoka N, Dreyfuss G. Role of the nonsense-mediated decay factor hUpf3 in the splicing-dependent exon-exon junction complex. Science. 2001;293:1832–6. doi: 10.1126/science.1062829. [DOI] [PubMed] [Google Scholar]
  • 29.Hall GW, Thein S. Nonsense codon mutations in the terminal exon of the beta-globin gene are not associated with a reduction in beta-mRNA accumulation. a mechanism for the phenotype of dominant beta-thalassemia. Blood. 1994;83:2031–7. [PubMed] [Google Scholar]
  • 30.Pitts SA, Kullar HS, Stankovic T, et al. hMRE11: genomic structure and a null mutation identified in a transcript protected from nonsense-mediated mRNA decay. Hum Mol Genet. 2001;10(11):1155–62. doi: 10.1093/hmg/10.11.1155. [DOI] [PubMed] [Google Scholar]
  • 31.Reis ES, Baracho GV, Lima AS, Farah CS, Isaac L. Homozygous hereditary C3 deficiency due to a stop codon. J Clin Immunol. 2002. pp. 321–30. [DOI] [PubMed]
  • 32.Ulbrich AG, Florido MPC, Nudelman V, Reis ES, Baracho GV, Isaac L. Hereditary human complement C3 deficiency owing to reduced levels of C3 mRNA. Scand J Immunol. 2001;53:622–6. doi: 10.1046/j.1365-3083.2001.00934.x. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES