Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2003 May;132(2):323–331. doi: 10.1046/j.1365-2249.2003.02134.x

Biased T-cell receptor repertoires in patients with chromosome 22q11.2 deletion syndrome (DiGeorge syndrome/velocardiofacial syndrome)

M PIERDOMINICI *, F MAZZETTA †, E CAPRINI ‡, M MARZIALI †, M C DIGILIO §, B MARINO , A AIUTI **, F AMATI ††, G RUSSO ‡, G NOVELLI ††, F PANDOLFI ‡‡, G LUZI †, A GIOVANNETTI †
PMCID: PMC1808695  PMID: 12699424

Abstract

Chromosome 22q11.2 deletion (del22q11.2) syndrome (DiGeorge syndrome/velocardiofacial syndrome) is a common syndrome typically consisting of congenital heart disease, hypoparathyroidism, developmental delay and immunodeficiency. Although a broad range of immunologic defects have been described in these patients, limited information is currently available on the diversity of the T-cell receptor (TCR) variable β (BV) chain repertoire. The TCRBV repertoires of nine patients with del22q11.2 syndrome were determined by flow cytometry, fragment size analysis of the third complementarity determining region (CDR3 spectratyping) and sequencing of V(D)J regions. The rate of thymic output and the phenotype and function of peripheral T cells were also studied. Expanded TCRBV families were detected by flow cytometry in both CD4+ and CD8+ T cells. A decreased diversity of TCR repertoires was also demonstrated by CDR3 spectratyping, showing altered CDR3 profiles in the majority of TCRBV families investigated. The oligoclonal nature of abnormal peaks detected by CDR3 spectratyping was confirmed by the sequence analysis of the V(D)J regions. Thymic output, evaluated by measuring TCR rearrangement excision circles (TRECs), was significantly decreased in comparison with age-matched controls. Finally, a significant up-regulation in the percentage, but not in the absolute count, of activated CD4+ T cells (CD95+, CCR5+, HLA-DR+), IFN-γ - and IL-2-expressing T cells was detected. These findings suggest that the diversity of CD4 and CD8 TCRBV repertoires is decreased in patients with del22q11.2 syndrome, possibly as a result of either impaired thymic function and/or increased T-cell activation.

Keywords: 22q11.2 deletion, DGS/VCFS, T cell receptor repertoire, CDR3 spectratyping, thymic output

INTRODUCTION

Chromosome 22q11.2 deletion (del22q11.2) syndrome is the most common deletion syndrome with an estimated incidence of 1 : 4000 live births [1]. More than 90% of the patients are hemizygous for a 1·5–3 Mb region within 22q11.2 [2]. A wide range of phenotypic variability is associated with this deletion, but the most characteristic features are congenital heart disease, thymic and parathyroid hypoplasia or aplasia resulting in T-cell immunodeficiency and hypocalcemia. Other common findings are facial, renal and skeletal anomalies, learning difficulties and mild mental retardation [3]. None of the phenotypic features is pathognomonic for the deletion, as well as the extent of the deletion, and its parental origin do not appear to predict end-organ effects or severity [4,5].

In the past, patients were diagnosed on the basis of syndromic characteristics and were categorized as having DGS if they had hypocalcemia, thymic aplasia/hypoplasia and conotruncal cardiac anomalies [6], or VCFS if they showed dysmorphic facies and conotruncal cardiac anomalies [7]. Actually, the acknowledgement of similarities and phenotypic overlap between these two syndromes, as well as their association with the del22q11.2 has led to the use of the more general term del22q11.2 syndrome [8].

Similarly to the phenotypic features, a variable degree of immunologic defects exists in patients with del22q11.2 syndrome [9–13]. The characteristic immunodeficiency is a mild-to-moderate defect in T-cell count [8]. Typically, these patients do not suffer of the opportunistic infections commonly observed in severe T-cell immunodeficiencies. Only a minority of patients have a more profound immunodeficiency with markedly impaired T-cell production and function. In these severely affected patients the immunodeficiency may be partially or totally corrected by treatment with foetal or post-natal thymus transplantation [14,15] or bone marrow transplantation [16].

Limited information is currently available on TCRBV usage in patients with del22q11.2 syndrome. Severe perturbations of TCRBV repertoire have been previously described in a patient with del22q11.2 syndrome showing marked T-cell deficiency [17]. Therefore, we investigated the TCRBV repertoire of nine patients with del22q11.2 syndrome by flow-cytometric analysis, fragment-size analysis of the third complementarity determining region (CDR3 spectratyping) and sequencing of V(D)J regions, performing a quantitative and qualitative assessment of TCRBV repertoire. Other immunologic parameters, including the rate of thymic output and the phenotype and function of peripheral T cells were also investigated.

PATIENTS AND METHODS

Patients

Nine patients with chromosome 22q11.2 deletion syndrome were studied. Clinical and demographic characteristics of the patients investigated are shown in Table 1. In all patients studied, immunoglobulin levels (IgG, IgA, IgM) were normal. No patient had a history of recurrent or opportunistic infections, but only of sporadic occurrences of bronchitis, pneumonia and otitis. Three episodes of broncopneumonia in 5 years were observed in patient #2, one episode of bronchitis per year in the first 4 years of life in patient #6, and one episode of otitis per year in the first 3 years of life in patient #8. All patients were in good health at the time of our analysis.

Table 1.

Demographic and clinical characteristics of the study population

Patient Sex Age (years) Thymus Cardiac defect Bronchitis, sinusitis and/or otitis 22q11.2
#1 M  2 Normal DIV no FISH
#2 M  5 Absent IAA yes FISH
#3 F  5 Absent IAA no FISH/microsatellite analysis (3 Mb)*
#4 M  5 ? Absent no FISH
#5 F  6 Hypoplasic DIV yes FISH/microsatellite analysis (1·5 Mb)*
#6 F  7 Absent TF yes FISH/microsatellite analysis (3 Mb)*
#7 F  8 Absent TF no FISH
#8 M 12 Normal DIV yes FISH
#9 M 13 Normal DIV no FISH/microsatellite analysis (3 Mb)*
Open in a new tab

VSD, ventricular septal defect; IAA, interrupted aortic arch; TF, tetralogy of fallot

*

deletion size. The presence of the thymus was assessed at the time of cardiac surgery with the exception of patient #4.

Deletions of 22q11.2 were investigated by fluorescence in situ hybridization (FISH) analysis on metaphase chromosomes prepared from peripheral blood lymphocytes and in selected patients by microsatellite analysis [18,19]. As controls, we included nine age-matched healthy subjects.

Parental permission was obtained for all tested subjects according to the guidelines of informed consent approved by the Ethic Committee of the Hospital ‘Bambino Gesu’, Rome.

Flow-cytometric analysis of lmphocyte subsets and TCRBV repertoire

Five-hundred microlitres of whole blood were lysed using 10 ml of Ortho Lysing Reagent (Ortho-Clinical Diagnostics, Raritan, NJ, USA), washed, labelled with a cocktail of four monoclonal antibodies (mAbs) for 30 min at 4°C and fixed within 1 h from blood collection. Anti-CD3 fluorescein isothiocyanate (FITC), anti-CD19 phycoerytrin (PE), anti-CD16/56-PE, anti-CD4 allophycocyanin (APC), anti-CD8 peridinin chlorophyll protein (PerCP), anti-CD45RA-FITC, anti-CD62L-PE, anti-CCR5-PE (clone 2D7), anti-HLA-DR-FITC were purchased from BD Immunocytometry Systems (San Jose, CA, USA); anti-Fas-FITC was obtained from MBL (Medical & Biological Laboratories Co., Ltd, Nagoya, Japan). Direct staining with 24 anti-TCRBV antibodies (IOTest Beta Mark, Immunotech, Marseille, France) was performed according to manufacturer's instruction. After staining, cells were washed once in phosphate-buffered saline (PBS) containing 2% foetal bovine serum (FBS, EuroClone, Wetherby West Yorkshire, UK) and analysed on a FACSCalibur cytofluorometer (BD Immunocytometry Systems) using the Cell Quest software. To determine marker expression on CD4+ and CD8+ cells, total lymphocytes were first identified and gated by forward and side scatter. The cells were then additionally gated for CD4 or CD8 expression. The Student t-test was performed to evaluate differences between patients and age-matched healthy controls. The relationships between the variables were evaluated by correlation-regression analysis. The normal distribution of TCRBV (sub)families was obtained from 40 healthy subjects aged between 2 and 40 years with no history, at the time of sampling, of chronic infection, allergy, or autoimmunity.

Single cell analysis of cytokine production

Analysis of cytokine production at the single-cell level was performed as previously described with minor modifications [20]. Briefly, peripheral blood mononuclear cells (PBMC) were isolated from heparinized venous blood by Ficoll-Isopaque (Lymphoprep-Nycomed, Oslo, Norway) gradient centrifugation, counted and resuspended at 1 × 106 cells/ml in RPMI-1640 medium (Gibco BRL, Grand Island, NY, USA) supplemented with 10% FBS (EuroClone), 2 mm glutamine (Sigma, St Louis, MO, USA) and 50 µg/ml gentamycin (Sigma). Cells were then stimulated for 16 h with 1 µg/ml ionomycin (Sigma) and 25 ng/ml phorbol myristate acetate (Sigma) in the presence of 10 µg/ml brefeldin A to inhibit cytokine secretion. After a wash in PBS, cells were fixed with 4% paraformaldehyde by incubation for 5 min at room temperature (22°C), permeabilized with FACS permeabilizing solution (BD Immunocytometry Systems) for 10 min, washed and stained. The following cytokine-specific mAbs were used: FITC labelled anti-hIFN-γ (IgG2b), FITC labelled anti-hIL-2 (IgG1) and PE labelled anti-hIL-4 (IgG1). Surface phenotyping was performed with anti-CD4 APC and anti-CD8 PerCP. All the mAbs were purchased from BD Immunocytometry Systems. After staining, cells were washed once in PBS containing 10% FBS and immediately analysed. The Student t-test was performed to evaluate differences between patients and age-matched healthy controls. The relationships between the variables were evaluated by correlation-regression analysis.

Molecular studies

CD4+ and CD8+ T cells were separated by using CD4 and CD8 MicroBeads and MACS columns according to the manufacturer's protocols (Miltenyi Biotec, Bergisch Gladbach, Germany). Total mRNA was extracted directly from 106 to 107 bead-coated cells using Trizol-LS Reagent (gibco BRL) and Micro-carrier (Molecular Research Center, Cincinnati, OH; USA) and precipitated with isopropyl alcohol. The pelleted RNA was resuspended in diethyl-pyrocarbonate-treated water and the poly(A)+ portion of total RNA was converted into cDNA using 2·5 µm oligo(dT) as primer for reverse transcription, 50 mm KCl, 10 mm TRIS-HCl, 5 mm MgCl2, 1 mm of each dNTPs, 1 U/µl of RNase Inhibitor and 2·5 U/µl MULV reverse transcriptase (Applied Biosystem, Foster City, CA; USA).

To analyse the TCRBV transcript size patterns, cDNA samples were amplified by using a TCRB C1/C2-specific primer (CGGGCTGCTCCTTGAGGGGCTGCG) and a set of 24 TCRBV-specific primers (BV-1, -2, -3, -4, -5·1, -5·3, -6·1, -6·2, -7, -8, -9, -11, -12, -13, -14, -15, -16, -17, -18, -20, -21, -22, -24) [21]. Briefly, 2 µl of the RT product was brought to a final reaction volume of 50 µl containing 50 mm KCl, 10 mm TRIS-HCl 1,5 mm MgCl2, 0,2 mm of each dNTPs, 25 pmol of each oligonucleotide and 2 U of Taq DNA polymerase (Applied Biosystem). After an initial denaturation step of 3 min at 95°C, the reactions were subjected to 35 cycles of PCR (30 s at 94°C, 30 s at 60°C, 30 s at 72°C) followed by a final elongation step for 10 min at 72°C. Aliquots of the unlabelled PCR products were then labelled by 10 cycles of elongation in a 10-µl ‘run-off’ reaction with the FAM TCRBC primer (CTGCACCTCCTTCCCATT) mixed with deionized formamide and TAMRA 500 size standard (Applied Biosystem). Finally, run-off products were electrophoresed for 24 min on a 310 ABI PRISM automated sequencer by using a 47-cm capillary and POP-4 polymer. The CDR3 profile was then analysed with the Genescan software (Applied Biosystem). Analysis of the level of perturbation of TCRBV repertoire of patients was performed according to Gorochov et al. [22] with minor modifications. Briefly, the CDR3 length profiles (spectratypes) were first translated into probability distributions as function of the area under the profile for each CDR3 length. A control profile, representing the non-perturbed repertoire, was determined for each BV by calculating the average distribution of the corresponding CD4 and CD8 profiles from five healthy blood donors. The extent of perturbation for each CDR3 fragment was then calculated by the difference between the sample's distribution and the control's distribution. Finally, the TCR repertoire perturbation per BV family was defined as the sum of the absolute values of the differences between each sample's CDR3 length and the corresponding control distribution. Values of BV perturbation greater than the sum of the standard deviations calculated in normal blood donors for each CDR3 profile were considered abnormal.

For CDR3 sequencing, amplification products were inserted into a plasmid vector (pCRII-TOPO; Invitrogen, Carlsbad, CA; USA), cloned in Escherichia coli and sequenced onto an Applied Biosystems Sequencer Model 377–96. Sequence similarities were identified using the multiple sequence alignment application, Align X, of the Vector NTI Suite 6·0 (InforMax Inc., Bethesda, MD, USA) based on the Clustal W algorithm [23]. The identification of the V(D)J junctions was performed comparing the sequences with those reported in ‘IMGT, the international ImMunoGeneTics database’http://imgt.cines.fr:8104 (initiator and coordinator: Marie-Paule Lefranc, Montpellier, France) [24].

Real-time PCR analysis was performed on CD4+ and CD8+ T cells with T-cell receptor excision circles (TREC) specific primers to detect recent thymic emigrants (RTE), and on the glyceraldehyde-3-phosphate dehydrogenase (GAPDH) to standardize for DNA content. For TREC PCR, the following primers and probe were used: forward 5′-TGGTTTTTGTAAAGGTGC CCAC-3′ (50 nm), reverse 5′-GTGCCAGCTGCAGGGTTT-3′ (50 nm) and the oligo 5′(FAM)CATAGGCACCTGCACCCC GTGC(TAMRA)p-3′(250 nm) as a detection probe. The GAPDH gene was amplified with the primers GAPDH-D1 forward 5′-ACCACAGTCCATGCCATCACT-3′ (300 nm) and GAPDH-D2 reverse 5′-GGCCATCACGCCACAGITT-3′ (900 nm) using as a probe the oligo GAPDH-DP 5′(TET)CCA CCCAGAAGACTGTGGATGGCC(TAMRA)p-3′ (175 nm). A standard curve was prepared by serial dilutions of a plasmid encoding the sequence of α1 circles [25], obtained after amplification of human cord blood genomic DNA using the primers forward 5′-AAAGAGGGCAGCCCTCTCCAAGGCAAAA-3′ and reverse 5′-ACTTCCATCGCAATTCAGGACTCACTT-3′. To ensure homogeneous amplification conditions, the standard plasmid was diluted into human DNA from a cell line devoid of TREC. Amplification reactions (25 µl) contained 100 ng of genomic DNA extracted from PBLs or standards, TaqMan universal PCR master mix (Applied Biosystem), and the appropriate primers and probes. All reactions were performed in the Model 7700 Sequence Detector using standard parameters and analysed using the GeneAmp software developed by Perkin Elmer Applied Biosystems. The amount of TREC per 100 ng of DNA was determined on the basis of the standard curve, with a lower limit of detection of three copies/100 ng of genomic DNA.

The Student t-test was performed to evaluate differences between patients and age-matched healthy controls.

RESULTS

Flow cytometric analysis of the TCRBV repertoire

The relative TCRBV usage was investigated using a panel of 24 BV family-specific monoclonal antibodies covering approximately 60–70% of T cells expressing TCRαβ in normal individuals (Table 2). Expansions (i.e. above the mean percentage plus 3 s.d. of the value of that family in normal donors) were detected by flow cytometric analysis in the majority of patients in both CD4+ and CD8+ T cells. However, they were of small size (range, 2%−6·7% for CD4+ cells and 2·2%−14% for CD8+ cells) if compared with those observed in other primary [26–29] and acquired immunodeficiencies [20,22]. Interestingly, the expansions tended to cluster to certain TCRBV genes, among which BV7·2, BV11 and BV13·1 for CD4+ cells and BV1 and BV11 for CD8+ cells. Deletions of entire BV (sub)families were not detected in the CD4 subset while a lack of expression in BV7·2 and BV18 was seen in CD8+ cells of patient #4 and #1, respectively.

Table 2.

Flow-cytometric analysis of CD4 and CD8 TCRBV repertoires in nine patients with 22q11.2 deletion syndrome

CD4 CD8
BV Control values 1 2 3 4 5 6 7 8 9 Control values 1 2 3 4 5 6 7 8 9
(mean ± 3 s.d.) (mean ± 3 s.d.)
1 3·0 ± 0·5 2·8 4·0 2·7 2·3 3·7 3·3 4·3 5·0 3·3 3·6 ± 0·7 3·6 7·6 3·1 2·3 4·7 2·1 6·2 11·3 4·1
2 8·5 ± 2·1 2·2 10·2 3·0 9·3 7·8 11·2 10·3 11·0 8·3 4·3 ± 3·0 4·1 5·0 5·2 5·7 2·6 3·5 6·0 7·4 5·2
3 3·8 ± 1·4 1·0 3·4 4·6 7·1 1·8 4·9 4·3 1·3 5·5 3·8 ± 2·5 0·8 3·0 4·8 5·8 1·0 11·7 4·0 1·1 3·5
4 1·9 ± 0·4 0·7 2·0 1·6 1·4 1·1 ± 0·7 0·6 0·1 0·3 0·7
5·1 4·8 ± 1·2 7·7 5·8 7·3 7·6 6·6 6·2 7·7 5·8 2·0 ± 0·8 14·0 3·5 2·3 3·6 3·4 1·2 3·3 2·3 2·1
5·2 0·9 ± 0·5 1·5 1·3 0·9 0·8 1·0 0·6 1·2 1·0 0·7 1·0 ± 0·7 2·7 1·4 0·7 1·0 0·9 0·4 2·1 0·5 0·7
5·3 1·3 ± 0·9 1·0 1·6 1·1 1·3 1·0 1·0 0·3 3·0 1·2 1·2 ± 0·5 1·0 1·3 0·8 1·0 1·4 0·4 0·6 1·0 0·6
7·1 2·2 ± 0·4 2·8 2·6 1·5 2·0 1·7 3·3 ± 0·9 5·2 4·9 3·5 1·6 6·1
7·2 0·9 ± 0·6 2·8 2·0 3·0 0·7 2·6 3·0 0·8 0·1 2·7 2·0 ± 2·5 3·4 4·2 4·6 0·0 6·7 1·6 1·0 0·3 4·9
8 3·5 ± 1·5 4·9 4·6 1·6 4·6 2·3 2·6 3·4 5·5 3·5 3·9 ± 1·3 4·6 3·6 1·8 3·0 1·5 0·8 0·9 4·7 2·4
9 4·1 ± 0·6 4·4 4·2 3·5 4·1 3·5 3·9 4·4 3·7 2·0 2·0 ± 1·4 2·1 3·6 2·6 2·6 1·6 2·0 3·3 1·6 1·7
11 0·8 ± 0·2 1·0 0·9 1·0 1·3 2·9 2·0 4·6 1·3 1·0 0·7 ± 0·4 0·5 0·9 0·7 0·6 4·9 3·8 2·2 0·8 0·4
12 1·9 ± 0·7 2·8 2·3 1·6 2·1 1·6 1·9 2·4 0·7 2·0 1·6 ± 1·0 1·8 1·5 1·1 2·0 1·0 0·6 2·3 1·2 0·9
13·1 3·9 ± 0·5 5·2 4·6 4·3 5·1 6·4 6·5 4·0 6·7 4·6 4·1 ± 1·4 3·1 5·5 4·2 4·4 4·9 2·8 4·2 2·8 4·5
13·2 2·8 ± 0·9 4·0 1·6 2·8 6·2 3·5 ± 2·2 3·0 1·0 1·6 5·7
13·6 2·0 ± 0·8 2·8 2·4 2·6 1·6 4·8 4·8 1·7 1·9 2·1 1·7 ± 0·3 1·6 2·6 2·5 1·0 3·2 1·5 1·6 1·3 1·6
14 2·7 ± 0·3 2·8 2·8 2·9 2·8 1·5 2·4 1·7 3·0 4·3 ± 1·2 11·5 5·7 7·7 10·4 5·0 6·5 4·2 5·9
16 1·0 ± 0·3 1·3 1·8 0·7 0·8 0·7 0·6 1·4 2·3 1·6 0·8 ± 0·2 1·7 3·0 1·1 1·3 0·9 1·9 2·4 2·1 0·1
17 5·5 ± 1·1 5·4 4·4 5·0 5·1 3·8 5·6 5·9 6·0 4·6 5·5 ± 1·0 3·7 4·8 4·8 3·4 11·9 9·4 3·8 3·5 4·8
18 1·6 ± 0·8 0·8 0·8 1·1 0·8 2·5 2·6 0·5 1·2 1·2 0·8 ± 0·6 0·0 1·4 0·2 0·3 1·0 1·0 0·2 0·1 0·2
20 2·9 ± 0·8 2·7 3·0 3·3 1·4 4·0 3·4 2·0 3·6 2·0 2·9 ± 0·8 2·5 2·9 3·4 1·7 3·5 1·6 1·0 1·8 2·9
21·3 2·4 ± 0·4 2·3 2·5 1·4 2·2 1·7 2·2 2·6 1·9 5·9 2·4 ± 1·8 2·1 4·2 1·8 4·5 2·5 0·7 0·6 1·6 1·2
22 4·6 ± 2·1 5·2 5·4 4·5 4·2 4·8 3·1 2·0 5·7 3·0 3·3 ± 1·9 4·5 4·7 4·3 2·8 6·7 1·4 1·1 7·3 2·1
23 0·6 ± 0·2 1·3 0·7 0·4 0·5 0·5 0·4 1·1 0·1 0·6 1·8 ± 1·0 1·7 3·9 0·9 1·4 0·9 4·2 1·9 1·7 3·5
Total 69·4 62·9 55·0 71·6 66·5 72·6 64·9 77·8 73·9 79·8 74·3 58·6 64·8 70·2 59·1 52·2 62·1 65·8
Open in a new tab

Analysis was performed with BV-specific monoclonal antibodies; the nomenclature adopted is from Wei et al. [42]. Results are the percentage of TCRαβT cells expressing the indicated TCRBV gene. Over-expressed TCRBV (sub)families are marked by boxing. Blanks denote determinations not done.

Molecular analysis of the TCRBV repertoire

Heterogeneity of the TCRBV repertoire was further investigated by CDR3 spectratyping, that is by the size analysis of CDR3s generated by the random insertion/deletion of nucleotides during V(D)J rearrangement [21]. A normal, polyclonal repertoire results in a histogram with a gaussian-like distribution of CDR3 lengths, whereas abnormal patterns display one or more predominant fragments outside the peak of median length (Fig. 1a). These latter patterns are indicative of TCRBV repertoires restricted by oligo-clonal expansions. Mathematical analysis of the deviation of patients’ histograms from the normal distribution revealed that all patients studied displayed perturbed CDR3 profiles (Fig. 1b). Restrictions of TCRBV repertoires were detected in 54% of CD4 (sub)families and 60% of CD8 (sub)families, and were more severe in the CD8 subset. The two deletions detected by flow cytometric analysis at CD8 BV18 (patient #1) and CD8 BV7·2 (patient #4) were not confirmed by spectratyping that showed perturbed CDR3 profiles.

Fig. 1.

Fig. 1

Open in a new tab

(a) TCRBV CDR3 spectratyping histograms in a representative patient (#9); (b) Diversity of the TCRBV repertoire analysed by CDR3 spectratyping in patients #1 to #9. The extent of TCRBV repertoire perturbation is represented as the per cent difference between the patient's CDR3 distribution and the corresponding control distribution. A value of perturbation greater than the sum of the s.d.s relative to each CDR3 length found in normal blood donors was considered abnormal. The bars on the left of the doublets represent CD4+ cells, and the bars on the right CD8+ cells. Colours denote the following: grey, abnormal pattern in CD4+ T cells; black, abnormal pattern in CD8+ T cells; white, normal pattern. The BV nomenclature adopted is from Wei et al. [42].

To gain further information on the TCRBV repertoires, as well as on the V(D)J joining process, we finally sequenced in a representative patient (#9) the amplification products of two CD4 TCRBV families opportunely selected on the basis of the corresponding CDR3 profile, one (BV14) apparently normal and the other (BV21) clearly perturbed (Fig. 2, left panels). A substantially polyclonal repertoire of productively rearranged V(D)J genes was observed for BV14, whose repertoire diversity, expressed as the percentage ratio between the number of different sequences obtained and the total number of sequences, was 93%. In contrast, a deep oligoclonality was detected for BV21 showing a repertoire diversity of 23% (Fig. 2, right panels). The diversity of the same BV families studied in an apparently healthy donor was 96% and 98%, respectively (not shown).

Fig. 2.

Fig. 2

Open in a new tab

Sequence analysis of TCRB V(D)J coding joints from two representative TCRBV families (14 and 21) of patient #9. CDR3 sequences detected more than once in each patient's sample are presented. The repertoire variability within TCRBV14, that showed a gaussian-like CDR3 profile, was 93% versus 96% in the normal (not shown) while that of TCRBV21 was 23% versus 98% in the normal (not shown). The sequence data are available from EMBL/GenBank/DDBJ

Thymic function

DNA extrachromosomal excision products (also known as TRECs) are normally generated during the process of V(D)J T-cell receptor rearrangement. These products are not replicated during mitosis so that their number decreases with each round of cell division. For this reason, TRECs are usually used as a marker of RTE [25]. Based on these notions, we investigated whether the defective numbers of naive T cells we found in patients with chromosome 22q11.2 deletion syndrome could be attributed to low thymic output by evaluating the levels of TRECs in separated CD4+ and CD8+ T cells. Suggestive of an impaired thymic function, we found in all patients TREC levels significantly lower than observed in age-matched donors in both CD4+ (mean: 46 ± 31 vs. 210 ± 80 copies/100 ng DNA, P = 0·02) and CD8+ subset (mean: 57 ± 33 vs. 190 ± 95 copies/100 ng DNA, P = 0·04).

Flow cytometric analysis of lymphocyte subsets

The percentage and absolute count of lymphocyte subsets are shown, for all patients and age-matched controls, in Fig. 3a–f. Mean values of lymphocyte, CD3+ and CD4+ T-cell counts were significantly reduced in patients with del22q11.2 syndrome as compared with healthy age-matched controls (lymphocytes: 34 ± 9% vs. 43 ± 3%, P = 0·02, and 2572 ± 904 cells/µl vs. 3289 ± 1054 cells/µl, P = 0·02; CD3+: 58 ± 7% vs. 70 ± 5%, P = 0·01, and 1462 ± 465 cells/µl vs. 2266 ± 641 cells/µl, P = 0·01; CD4+: 31 ± 7% vs. 40 ± 7%, P = 0·03, and 808 ± 349 cells/µl vs. 1280 ± 317 cells/µl, P = 0·01). No significant differences were observed in CD8+ T cells as well as in CD19+ B cells (CD8+: 19 ± 7% vs. 20 ± 6% and 481 ± 261 cells/µl vs. 655 ± 264 cells/µl; CD19+: 15 ± 6% vs. 14 ± 7% and 398 ± 243 cells/µl vs. 500 ± 378 cells/µl) while a significant increase of the frequency of natural killer cells (CD3−CD16+CD56+) was detected (24 ± 7% vs. 12 ± 7%, P = 0·02).

Fig. 3.

Fig. 3

Open in a new tab

(a–f). Flow-cytometric analysis of peripheral blood mononuclear cells from nine patients with chromosome 22q11.2 deletion syndrome and from nine healthy age-matched controls. Each dot corresponds to a single subject. Panels (a) to (c) show data expressed as percentage and panels (d) to (f) show data expressed as absolute count. NS, not significant.

The distribution of naive and memory T cells was investigated by the differential expression of CD45RA and CD62L molecules on both CD4+ and CD8+ T cells. Within the CD4 subset, a significant increase of the frequency of memory (CD45RA−CD62L+ and CD45RA−CD62L−) and a corresponding reduction in that of naive T cells (CD45RA+CD62L+) were detected in our patients as compared with healthy age-matched controls: memory cells, 40 ± 15% vs. 25 ± 10%, P = 0·01, and naive cells, 59 ± 15% vs. 74 ± 10%, P = 0·01. The percentage of effector memory CD4+ T cells (CD45RA+CD62L−) was not significantly different from controls (0·5 ± 0·4% vs. 0·4 ± 0·3%, P > 0·05). Within the CD8 subset, the frequency of memory cells was increased (28 ± 16% vs. 14 ± 7%, P = 0·02) while that of effector memory cells (14 ± 12% vs. 10 ± 5%, P > 0·05) and naive cells (60 ± 22% vs. 77 ± 11%, P > 0·05) was not significantly different from controls. When the absolute count was considered, a significant reduction of naive T cells in both CD4 (510 ± 329 cells/µl vs. 966 ± 329 cells/µl, P = 0·001) and CD8 (260 ± 145 cells/µl vs. 515 ± 262 cells/µl, P = 0·01) subsets was shown. The absolute count of effector memory CD4+ T cells was also significantly reduced (3 ± 2 cells/µl vs. 6 ± 4 cells/µl, P = 0·03). Finally, an inverse correlation between the frequency of CD4+ naive T cells and the number of CD4+ T-cell expansions was detected (R = −0·9, P < 0·001).

The expression of activation markers CD95, CCR5 and HLA-DR on CD4 and CD8 subsets was also investigated. An up-regulation of these molecules was detected in patients with del22q11.2. However, a significant difference between patients and age-matched controls was reached within the CD4 subset (CD95+: 38 ± 14% vs. 27 ± 8%, P = 0·04; CCR5+: 8 ± 3% vs. 5 ± 4%, P = 0·04; HLA-DR+: 6 ± 2% vs. 4 ± 2%, P = 0·03) but not within the CD8 subset with the exception of CCR5-expressing T cells (CD95+: 38 ± 20% vs. 31 ± 6%, P > 0·05; CCR5+: 19 ± 11% vs. 12 ± 6%, P = 0·03; HLA-DR+: 17 ± 9% vs. 13 ± 6%, P > 0·05). No significant differences were observed when the absolute count was considered in both CD4+ and CD8+ T cells.

The pattern of activation-induced cytokine production by patient's T cells was shown in Figs 4(a and b). Compared with normal controls, there was a significant increase of IFN-γ- and IL-2-expressing T cells in both CD4 (IFN-γ+: 12 ± 6% vs. 4 ± 2%, P = 0·03; IL-2+: 59 ± 6% vs. 49 ± 9%, P = 0·04) and CD8 (IFN-γ+: 34 ± 18% vs. 14 ± 8%, P = 0·03; IL-2+: 32 ± 10% vs. 19 ± 6%, P = 0·01) subsets. The frequency of IL-4 positive cells was in general normal, in both CD4+ (IL-4+: 3 ± 2% vs. 2 ± 0·7%, P > 0·05) and CD8+ (IL-4+: 2 ± 1% vs. 0·6 ± 0·4%, P > 0·05) T cells. With regard to the absolute count, no significant differences were detected between patients and controls with the exception of IL-2-expressing T cells that were significantly decreased within the CD4 subset: CD4+IL-2+: 471 ± 194 cells/µl vs. 633 ± 222 cells/µl, P = 0·03.

Fig. 4.

Fig. 4

Open in a new tab

(a-b). Flow-cytometric analysis of IFN-γ -, IL-2- and IL-4-expressing T cells from nine patients with chromosome 22q11.2 deletion syndrome and from nine healthy age-matched controls. Each dot corresponds to a single subject. Panel (a) refers to data expressed as percentage and panel (b) refers to data expressed as absolute count. NS, not significant.

DISCUSSION

In this paper we present evidence of a restricted TCRBV repertoire of peripheral blood T cells of patients with del22q11.2 syndrome (DiGeorge syndrome/velocardiofacial syndrome). Results reported herein confirm and extend our previously reported data [30] showing subtle expansions of TCRBV families detected by flow cytometry in the majority of patients. However, because the demonstration of a normal distribution of TCRBV families by monoclonal antibodies does not allow exclusion of a reduced diversity of the repertoire, we performed the more sensitive CDR3 spectratyping. This analysis revealed perturbations of TCRBV repertoires in 54% of CD4 (sub)families and 60% of CD8 (sub)families. The oligoclonal nature of abnormal peaks detected by CDR3 spectratyping was finally confirmed by the sequence analysis of V(D)J regions.

Severe restrictions of TCRBV repertoires have been previously described in a patient with del22q11.2 syndrome who have markedly impaired T-cell count and T-cell function [17] (in the past classified as having the complete form of the DiGeorge syndrome [31]). In contrast, our patients displayed a moderate defect of T-cell number and a normal proliferative responses to mitogens (data not shown). Clinical data showed that none of the studied patients had required immunorestorative therapy or had a history of recurrent or opportunistic infections.

In healthy subjects, occasional expansions are detected exclusively within the CD8 subset [32]. These expansions gradually accumulate during life and may represent the result of immune responses to viral infections [33,34]. However, in our patients, the perturbations of the CD8 TCRBV repertoire were more prominent and systematic than in normal controls, suggesting that they might be related to the underlying immunologic disorder.

Several mechanisms may be involved in the restriction of TCRBV repertoire in patients with del22q11.2 syndrome. Because the diversity of peripheral T-cell repertoires is maintained by the continuous generation in the thymus of new naive T cells, the skewed TCRBV repertoire seen in our patients could be related to a thymic defect. Previous reports showed a severely restricted TCR repertoire in athymic (nu/nu) mice [35,36] and in DGS patients with thymic aplasia [15,17,37]. Consistent with these data, we found, in our patients, significantly reduced TREC levels. In addition, the frequency of naive T cells was also reduced and negatively correlated with the extent of TCRBV perturbation.

It has been previously suggested that reduced TREC levels may be due to activation-induced increase in cell division [38]. According to this hypothesis, we found, in our patients, a significant increase in the percentage of CD4+ T cells with the phenotype and the polarized pattern of cytokine production typical for memory Th1 cells [39]. In addition, other mechanisms, not yet investigated in patients with del22q11.2 syndrome, such as a dysregulation of T-cell transcription factors [40] or an altered production of cytokines [41], should also be considered as responsible for the T-cell alterations.

Finally, with regard to the pathogenesis of del22q11.2 syndrome, one might speculate that the extent of the immunodeficiency may be related to the size of the deleted region on chromosome 22. However, our data do not support this hypothesis because, limited to those patients studied by microsatellite analysis, a larger deletion did not necessarily associate with a more severe immunocompromise. This observation further supports the concept that the phenotypic spectrum observed in patients with 22q11.2 deletion seems to be controlled by many genes in a complex and indefinite manner. The absence of a clear genotype-phenotype mapping function suggests the existence of a genotype and phenotype plasticity probably due to genetic and epigenetic factors (G. Novelli, personal communication, 2002). Further studies will be necessary to clarify the molecular basis of T-cell defect in patients with del22q11.2 syndrome.

Acknowledgments

This work was supported by grants from the University of Rome ‘La Sapienza’ Progetti di Ateneo 1999–2000 to Fernando Aiuti and co-workers (AG), Faculty of Medicine of the University of Rome ‘La Sapienza’ 2000–2001 to GL and Italian Ministry of Education, University and Research (COFIN 2001) to GN.

References

  • 1.Devriendt K, Fryns JP, Mortier G, van Thienen MN, Keymolen K. The annual incidence of DiGeorge/velocardiofacial syndrome. J Med Genet. 1998;35:789–90. doi: 10.1136/jmg.35.9.789-a. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Edelmann L, Pandita RK, Spiteri E, et al. A common molecular basis for rearrangement disorders on chromosome 22q11. Hum Mol Genet. 1999;8:1157–67. doi: 10.1093/hmg/8.7.1157. [DOI] [PubMed] [Google Scholar]
  • 3.Ryan AK, Goodship JA, Wilson DI, et al. Spectrum of clinical features associated with interstitial chromosome 22q11 deletions: a European collaborative study. J Med Genet. 1997;34:798–804. doi: 10.1136/jmg.34.10.798. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Yamagishi H, Ishii C, Maeda J, et al. Phenotypic discordance in monozygotic twins with 22q11.2 deletion. Am J Med Genet. 1998;78:319–21. [PubMed] [Google Scholar]
  • 5.Novelli G, Amati F, Dallapiccola B. Individual haploinsufficient loci and the complex phenotype of DiGeorge syndrome. Mol Med Today. 2000;6:10–1. doi: 10.1016/s1357-4310(99)01577-4. [DOI] [PubMed] [Google Scholar]
  • 6.Conley ME, Beckwith JB, Mancer JF, Tenckhoff L. The spectrum of the DiGeorge syndrome. J Pediatr. 1979;94:883–90. doi: 10.1016/s0022-3476(79)80207-3. [DOI] [PubMed] [Google Scholar]
  • 7.Motzkin B, Marion R, Goldberg R, Shprintzen R, Saenger P. Variable phenotypes in velocardiofacial syndrome with chromosomal deletion. J Pediatr. 1993;123:406–10. doi: 10.1016/s0022-3476(05)81740-8. [DOI] [PubMed] [Google Scholar]
  • 8.Driscoll D, Sullivan KE. DiGeorge syndrome: a chromosome 22q11.2 deletion syndrome. In: Ochs H, Smith E, Puck J, editors. Primary immunodeficiency diseases – a molecular and genetic approach. Oxford: Oxford University Press; 1999. pp. 198–208. [Google Scholar]
  • 9.Barrett DJ, Ammann AJ, Wara DW, Cowan MJ, Fisher TJ, Stiehm ER. Clinical and immunologic spectrum of the DiGeorge syndrome. J Clin Laboratory Immunol. 1981;6:1–6. [PubMed] [Google Scholar]
  • 10.Muller W, Peter HH, Kallfelz HC, Franz A, Rieger CH. The DiGeorge sequence. II. Immunologic findings in partial and complete forms of the disorder. Eur J Pediatr. 1989;149:96–103. doi: 10.1007/BF01995856. [DOI] [PubMed] [Google Scholar]
  • 11.Bastian J, Law S, Vogler L, Lawton A, Herrod H, Anderson S, Horowitz S, Hong R. Prediction of persistent immunodeficiency in the DiGeorge anomaly. J Pediatr. 1989;115:391–6. doi: 10.1016/s0022-3476(89)80837-6. [DOI] [PubMed] [Google Scholar]
  • 12.Sirianni MC, Businco L, Seminara R, Aiuti F. Severe combined immunodeficiencies, primary T-cell defects and DiGeorge syndrome in humans: characterization by monoclonal antibodies and natural killer cell activity. Clin Immunol Immunopathol. 1983;28:361–70. doi: 10.1016/0090-1229(83)90103-4. [DOI] [PubMed] [Google Scholar]
  • 13.Sullivan KE, Jawad AF, Randall P, Driscoll DA, Emanuel BS, Mcdonald-Mcginn DM, Zackai EH. Lack of correlation between impaired T cell production, immunodeficiency, and other phenotypic features in chromosome 22q11.2 deletion syndromes. Clin Immunol Immunopathol. 1998;86:141–6. doi: 10.1006/clin.1997.4463. [DOI] [PubMed] [Google Scholar]
  • 14.August CS, Rosen FS, Filler RM, Janeway CA, Markowski B, Kay HE. Implantation of a foetal thymus, restoring immunological competence in a patient with thymic aplasia (Digeorge's syndrome) Lancet. 1968;2:1210–1. doi: 10.1016/s0140-6736(68)91693-0. [DOI] [PubMed] [Google Scholar]
  • 15.Markert ML, Boeck A, Hale LP, et al. Transplantation of thymus tissue in complete DiGeorge syndrome. N Engl J Med. 1999;341:1180–9. doi: 10.1056/NEJM199910143411603. [DOI] [PubMed] [Google Scholar]
  • 16.Goldsobel AB, Haas A, Stiehm ER. Bone marrow transplantation in DiGeorge syndrome. J Pediatr. 1987;111:40–4. doi: 10.1016/s0022-3476(87)80339-6. [DOI] [PubMed] [Google Scholar]
  • 17.Collard HR, Boeck A, McLaughlin TM, Watson TJ, Schiff SE, Hale LP, Markert ML. Possible extrathymic development of nonfunctional T cells in a patient with complete DiGeorge syndrome. Clin Immunol. 1999;91:156–62. doi: 10.1006/clim.1999.4691. [DOI] [PubMed] [Google Scholar]
  • 18.Pizzuti A, Novelli G, Mari A, et al. Human homologue sequences to the Drosophila dishevelled segment-polarity gene are deleted in the DiGeorge syndrome. Am J Hum Genet. 1996;58:722–9. [PMC free article] [PubMed] [Google Scholar]
  • 19.Pizzuti A, Novelli G, Ratti A, et al. Isolation and characterization of a novel transcript embedded within HIRA, a gene deleted in DiGeorge syndrome. Mol Genet Metab. 1999;67:227–35. doi: 10.1006/mgme.1999.2868. [DOI] [PubMed] [Google Scholar]
  • 20.Giovannetti A, Pierdominici M, Mazzetta F, et al. T cell responses to highly active antiretroviral therapy defined by chemokine receptors expression, cytokine production, T cell receptor repertoire and anti-HIV T-lymphocyte activity. Clin Exp Immunol. 2001;124:21–31. doi: 10.1046/j.1365-2249.2001.01502.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Cottrez F, Auriault C, Capron A, Groux H. Analysis of the V beta specificity of superantigen activation with a rapid and sensitive method using RT PCR and an automatic DNA analyser. J Immunol Meth. 1994;172:85–94. doi: 10.1016/0022-1759(94)90381-6. [DOI] [PubMed] [Google Scholar]
  • 22.Gorochov G, Neumann AU, Kereveur A, et al. Perturbation of CD4+ and CD8+ T-cell repertoires during progression to AIDS and regulation of the CD4+ repertoire during antiviral therapy. Nat Med. 1998;4:215–21. doi: 10.1038/nm0298-215. [DOI] [PubMed] [Google Scholar]
  • 23.Thompson JD, Higgins DG, Gibson TJ, Clustal W. Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl Acids Res. 1994;22:4673–80. doi: 10.1093/nar/22.22.4673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Lefranc MP. IMGT, the international ImMunoGeneTics database. Nucl Acids Res. 2001;29:207–9. doi: 10.1093/nar/29.1.207. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Zhang L, Lewin SR, Markowitz M, et al. Measuring recent thymic emigrants in blood of normal and HIV-1-infected individuals before and after effective therapy. J Exp Med. 1999;190:725–32. doi: 10.1084/jem.190.5.725. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Giovannetti A, Mazzetta F, Caprini E, et al. Skewed T-cell receptor repertoire, decreased thymic output, and predominance of terminally differentiated T cells in ataxia-telangiectasia. Blood. 2002;100:4082–9. doi: 10.1182/blood-2002-03-0976. [DOI] [PubMed] [Google Scholar]
  • 27.Minegishi Y, Akagi K, Nishikawa K, Okawa H, Yata J. Analysis of the CDR3 region of the rearranged IgH chain genes in patients with severe combined immunodeficiency and severe lymphopenia. J Immunol. 1996;156:4666–71. [PubMed] [Google Scholar]
  • 28.Serrano D, Becker K, Cunningham-Rundles C, Mayer L. Characterization of the T cell receptor repertoire in patients with common variable immunodeficiency. oligoclonal expansion of CD8 (+) T cells. Clin Immunol. 2000;97:248–58. doi: 10.1006/clim.2000.4941. [DOI] [PubMed] [Google Scholar]
  • 29.Brooks EG, Filipovich AH, Padgett JW, Mamlock R, Goldblum RM. T-cell receptor analysis in Omenn's syndrome: evidence for defects in gene rearrangement and assembly. Blood. 1999;93:242–50. [PubMed] [Google Scholar]
  • 30.Pierdominici M, Marziali M, Giovannetti A, et al. T cell receptor repertoire and function in patients with DiGeorge syndrome and velocardiofacial syndrome. Clin Exp Immunol. 2000;121:127–32. doi: 10.1046/j.1365-2249.2000.01247.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Markert ML, Hummell DS, Rosenblatt HM, Schiff SE, Harville TO, Williams LW, Schiff RI, Buckley RH. Complete DiGeorge syndrome: persistence of profound immunodeficiency. J Pediatr. 1998;132:15–21. doi: 10.1016/s0022-3476(98)70478-0. [DOI] [PubMed] [Google Scholar]
  • 32.Hingorani R, Choi IH, Akolkar P, Gulwani-Akolkar B, Pergolizzi R, Silver J, Gregersen PK. Clonal predominance of T cell receptors within the CD8+ CD45RO+ subset in normal human subjects. J Immunol. 1993;151:5762–9. [PubMed] [Google Scholar]
  • 33.Argaet VP, Schmidt CW, Burrows SR, et al. Dominant selection of an invariant T cell antigen receptor in response to persistent infection by Epstein-Barr virus. J Exp Med. 1994;180:2335–40. doi: 10.1084/jem.180.6.2335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Khan N, Shariff N, Cobbold M, Bruton R, Ainsworth JA, Sinclair AJ, Nayak L, Moss PA. Cytomegalovirus seropositivity drives the CD8 T cell repertoire toward greater clonality in healthy elderly individuals. J Immunol. 2002;169:1984–92. doi: 10.4049/jimmunol.169.4.1984. [DOI] [PubMed] [Google Scholar]
  • 35.Macdonald HR, Lees RK, Bron C, Sordat B, Miescher G. T cell antigen receptor expression in athymic (nu/nu) mice. Evidence for an oligoclonal beta chain repertoire. J Exp Med. 1987;166:195–209. doi: 10.1084/jem.166.1.195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Maleckar JR, Sherman LA. The composition of the T cell receptor repertoire in nude mice. J Immunol. 1987;138:3873–6. [PubMed] [Google Scholar]
  • 37.Davis CM, Mclaughlin TM, Watson TJ, Buckley RH, Schiff SE, Hale LP, Haynes BF, Markert ML. Normalization of the peripheral blood T cell receptor V beta repertoire after cultured postnatal human thymic transplantation in DiGeorge syndrome. J Clin Immunol. 1997;17:167–75. doi: 10.1023/a:1027382600143. [DOI] [PubMed] [Google Scholar]
  • 38.Hazenberg MD, Otto SA, Cohen Stuart JW, et al. Increased cell division but not thymic dysfunction rapidly affects the T-cell receptor excision circle content of the naive T cell population in HIV-1 infection. Nat Med. 2000;6:1036–42. doi: 10.1038/79549. [DOI] [PubMed] [Google Scholar]
  • 39.Mitra DK, De Rosa SC, Luke A, et al. Differential representations of memory T cell subsets are characteristic of polarized immunity in leprosy and atopic diseases. Int Immunol. 1999;11:1801–10. doi: 10.1093/intimm/11.11.1801. [DOI] [PubMed] [Google Scholar]
  • 40.Kuo CT, Leiden JM. Transcriptional regulation of T lymphocyte development and function. Annu Rev Immunol. 1999;17:149–87. doi: 10.1146/annurev.immunol.17.1.149. [DOI] [PubMed] [Google Scholar]
  • 41.Tan JT, Dudl E, Leroy E, Murray R, Sprent J, Weinberg KI, Surh CD. IL-7 is critical for homeostatic proliferation and survival of naive T cells. Proc Natl Acad Sci USA. 2001;98:8732–7. doi: 10.1073/pnas.161126098. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Wei S, Charmley P, Robinson MA, Concannon P. The extent of the human germline T-cell receptor V beta gene segment repertoire. Immunogenetics. 1994;40:27–36. doi: 10.1007/BF00163961. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES