Skip to main content
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2004 May;136(2):328–333. doi: 10.1111/j.1365-2249.2004.02444.x

Genetic variants in the CCR gene cluster and spontaneous viral elimination in hepatitis C-infected patients

S MASCHERETTI *,, H HINRICHSEN *,, S ROSS , P BUGGISCH, J HAMPE , U R FOELSCH , S SCHREIBER
PMCID: PMC1809016  PMID: 15086398

Abstract

Hepatitis C virus (HCV) infection results in chronic hepatitis in more than 80% of infected patients while 10–20% of patients recover spontaneously. Host genetic factors may influence the ability to clear the virus after infection. Six single nucleotide polymorphisms and a 32 bp deletion in the genes coding for CCR3, CCR2 and CCR5 (which are all located in a cluster on chromosome 3) were investigated in 465 consecutively recruited patients infected with HCV and 370 matched controls. Genetic variants were tested for association with spontaneous viral elimination and, in the chronically infected patients, stage of fibrosis and response to antiviral therapy. The G190A polymorphism (variant allele Ile64) in the first transmembrane domain of CCR2 was under-represented in the 29 patients who had cleared the hepatitis C virus spontaneously (P = 0·018). None of the other variants in the CCR gene cluster showed association with the natural course of the infection, stage of fibrosis or response to therapy.

Keywords: CCR2, HCV, spontaneous recovery

INTRODUCTION

Hepatitis C virus (HCV) infection results in chronic active hepatitis in most infected patients. This can result in liver cirrhosis and represents a high risk factor for developing hepatocellular carcinoma [1,2]. Viral load, viral genotype, quasispecies and age at infection have been evaluated with contradictory results as predictors for the natural course of HCV infection [24]. Development of acute hepatitis is the only clinical predictor of spontaneous viral elimination. Progression of chronic infection to fibrosis is influenced by host factors including alcohol consumption, gender, age at infection and iron load [5]. Combination antiviral therapy with interferon and ribavirin induces a sustained response (negative HCV-RNA more than 24 weeks after the end of treatment) in more than 40% of patients [6]. Viral genotypes 2 and 3, stage of fibrosis 0 or 1, female gender and age < 40 years are associated with an increased chance for sustained response under this therapy [7]. However, it appears likely that host genetic factors also influence the course of HCV infection. Previous studies have investigated the effect of genetic variants of candidate molecules including major histocompatibility complex class II, transforming growth factor-beta, interleukin (IL)-10 and tumour necrosis factor-alpha (TNF-α), which were chosen based on pathophysiological importance without producing clear results [821].

The genes coding for chemokine receptors (CCR) 2, 3 and 5, are located in a gene cluster (CCR3–CCR2–CCR5) spanning 300 Kb [22] on chromosome 3p21.3. They serve as co-receptors in combination with CD4 for human immune deficiency virus (HIV)-1 [2327]. Genetic variants in these genes are associated with a reduced susceptibility to HIV infection or a retarded development to acquired immune deficiency syndrome (AIDS), respectively [22,2832].

The 32 bp deletion in exon 4 of CCR5 (CCR5–Δ32), which leads to truncation and loss of the receptor on lymphoid cells, confers strong resistance to HIV-1 infection in homozygous individuals. In heterozygote patients, this deletion delays the onset of AIDS after HIV infection by as much as 2–3 years compared with patients carrying two wild-type alleles [22,3336]. In contrast, the recessive CCR5 promoter haplotype P1 is associated with a faster progression to AIDS [31]. Hepatitis C patients who are homozygous for the CCR5–Δ32 deletion have been reported to carry increased viral loads [37].

Similarly, the G to A transition at nucleotide position +190, which codes for an amino acid exchange in the first transmembrane domain of CCR2 (Ile64Val), confers a delay in the onset of AIDS by 2–4 years in both heterozygous and homozygous patients [28,31]. Monocyte chemoattractant protein 1 (MCP-1) is the main ligand of CCR2. It is hypothesized that an altered affinity of CCR2 for its ligand also contributes to viral resistance. MCP-1 appears to be an important regulator of cytokine homeostasis within the liver [38,39]. Serum levels of MCP-1 have been found elevated in patients with chronic HCV infection [40].

The aim of this study was to examine an association of genetic variants in the chemokine receptors CCR2, CCR3 and CCR5 with the outcome of HCV infection. The ability to spontaneously clear viral elimination, progression of fibrosis and response to antiviral therapy with interferon (IFN)-α was investigated in a sample of 465 consecutive HCV-infected patients and 370 controls matched for sex, age and ethnicity.

PATIENTS AND METHODS

Patients

A total of 465 consecutively recruited patients infected with HCV (265 men and 200 women), median age 42 years (1781), mainly of German origin (more than 96% Caucasian origin from local, north-German referral areas), attending the out-patient clinic of the 1st Department of Medicine, University Hospital (Kiel) and the 1st Department of Medicine, University Hospital Eppendorf (Hamburg), were included. Three hundred and seventy age- and sex-matched blood donors, for whom infection with HCV and HIV was excluded, were selected randomly as a healthy control group. The institutional ethics committee approved the study protocols and procedures. Written informed consent was obtained from all patients.

Presence of HCV was determined by reverse transcription-polymerase chain rection (RT-PCR) of viral RNA. Genotype of the virus was determined by line probe assay technique [41]. Seventy-seven per cent of the patients were infected with viral genotype 1, 3% viral genotype 2, 17% viral genotype 3 and 3% viral genotype 4.

Spontaneous recovery

Twnty-nine patients (21 women and eight men, median age 33 ranging between 17 and 79 years) showed spontaneous viral elimination whereas 406 matched the criteria of chronic disease. The remaining 30 patients did not meet the criteria for either category and were therefore coded as indeterminate. Definition of spontaneous viral elimination was based on the initial detection of an acute HCV infection (confirmation of viral RNA and high levels of ALT and AST followed by a return to normal levels of ALT and AST and at least three negative tests for viral RNA within the 12 months following the normalization of ALT and AST). Alternatively, patients who did not present an acute HCV infection but still showed HCV antibodies (confirmed by immunoblot assay) or HCV RNA had to test negative for HCV RNA in the blood at least three times for more than 12 months and show normal liver function tests. Chronic infection, on the other hand, was defined as positive HCV RNA testing for more than 6 months.

Grading of fibrosis

Among the chronically infected patients, the histopathological classification of liver fibrosis was performed from liver biopsies according to the METAVIR system [42]. Mild–moderate fibrosis was defined as stages 0, I and II and severe fibrosis as stages III and IV. Patients who showed mild–moderate fibrosis but were not known to be affected for at least 10 years were excluded from this part of the analysis. This resulted in 257 patients, 204 with mild–moderate and 53 with severe fibrosis.

Treatment response

Ninety-two patients were treated with recombinant IFN-α monotherapy while 95 received combination therapy with IFN-α plus ribavirin in the course of the disease. Sustained response was defined as being negative for HCV RNA and having normal liver function tests 24 weeks after discontinuation of the therapy. Under this definition, 18 patients responded to IFN-α monotherapy (20%) (15 patients had no or moderate fibrosis, five women and 10 men, and three male patients had severe fibrosis) and 41 to combined IFN-α plus ribavarin (43%) (31 patients had no or moderate fibrosis, 15 women and 16 men, 10 patients had severe fibrosis, two women and eight men).

Genotyping

All samples were anonymized and genotypes assigned without knowledge of clinical status or treatment response. Sixteen known single nucleotide polymorphisms (SNPs) in the genes coding for CCR2, CCR3 and CCR5 and the CCR5–Δ32 were preliminarily analysed in 96 individuals (HCV-infected patients and healthy controls). Seven SNPs were found to be non-polymorphic and three were too rare (frequency of the rare allele ≤1%) to be statistically relevant and were therefore not genotyped in the full sample (Table 1). The remaining six SNPs were genotyped by allelic discrimination using TaqMan technology (ABI 7700, Applied Biosystems) or by PCR amplification followed by direct sequencing; the CCR5–Δ32 was genotyped by PCR amplification followed by agarose gel electrophoresis (Tables 1 and 2).

Table 1.

Polymorphisms in the CCR gene cluster

Gene Base exchange wild-type/variant Position Frequency (%) of the rare allele Amino acid exchange Genotyping procedure/ reason if not typed
CCR3 T/C +51  9 Tyr17Tre TaqMan
C/T +240  0·5 Arg80Arg Low frequency
C/T +824  1 Arg275Gln Low frequency
T/C +971  0 Leu324Pro Not polymorphic
T/C +1052  0·5 Leu351Pro Low frequency
CCR2 G/A +190  9 Val64Ile TaqMan
T/C +780 30 Asn260Asn TaqMan
CCR5 G/T +208 35 TaqMan
A/G +612  0 Not polymorphic
C/A +626  0 Not polymorphic
C/T +627 41 Sequencing
C/T +630  0 Not polymorphic
A/G +676 37 Sequencing
C/T +684  0 Not polymorphic
C/G +714  0 Not polymorphic
G/A +811  0 Not polymorphic
Δ32 Exon 4 10 PCR

SNPs in CCR2 and CCR3 are numbered from the ATG, SNPs in CCR5 from the beginning of exon 1.

Table 2.

Genotyping of polymorphisms in the CCR gene cluster

CCR2 + 190 TaqMan F probe (G) CAACATGCTGGTCGTCCTCATCTTAATAAACT
62°C, 300/900 nm T probe (A) CAACATGCTGGTCATCCTCATCTTAATAAACT
F primer CCGCTCTACTCGCTGGTGTT
R primer GTTGAGCAGGTAAATGTCAGTCAA
CCR2 + 780 TaqMan F probe (C) TTACTTTCTCTTCTGGACTCCCTATAACATTGTCATTCT
62°C, 300/900 nm T probe (T) TTACTTTCTCTTCTGGACTCCCTATAATATTGTCATTCT
F primer TGAAAACCCTGCTTCGGTG
R primer TTACTCAGGCCGAAGAATTCCT
CCR3 – 51 TaqMan F probe (T) AGACCTTTGGTACCACATCCTACTATGATGACGT
60°C, 50/900 nm T probe (C) AGACCTTTGGTACCACATCCTACTACGATGACGT
F primer ATGCTTCATTGTGGGATTGTATT
R primer CATCAGTGCTCTGGTATCAGCTT
CCR5–208 TaqMan F probe (G) CAGGTTGTTTCCGTTTACAGAGAACAATAATATTGGG
62°C, 300/900 nm T probe (T) CAGGTTTTTTCCGTTTACAGAGAACAATAATATTGGG
F primer TGCTTACTGGTTTGAAGGGCA
R primer TCCCCGTATCCCCTATCCC
CCR5Δ32 PCR F primer TACCTGGCTGTCGTCCATGC
R primer TGACCATGACAAGCAGCG
CCR5627 and 676 PCR F primer TGGGCTTTTGACTAGATGAATGTAAA
R primer GGAACGGATGTCTCAGCTCTTC

Primers and probes were designed with Primer Express (Applied Biosystems (ABI), Foster City (CA, USA) and synthesized by Eurogentec (Liege, Belgium) or ABI. All probes are labelled with TAMRA (5′), F probes are labelled with FAM (3′) and T probes with TET (3′). TaqMan assays followed the standard protocol. Probe concentration was 100 nm for all assays. Annealing temperatures and primer concentrations (forward/reverse) are noted under the description of variants (left column). For direct sequencing, PCR products were purified and sequenced (using PCR primers) according to the ABI ‘Big Dye Terminator’ protocol and analysed on an ABI 3700 automated sequencer. CCR5–Δ32 was genotyped by PCR amplification (T annealing 66°C) followed by agarose gel electophoresis (2% in TAE).

All data were processed according to good laboratory practice using a laboratory information management system [43]. The statistical package SPSS was used for analysis of the data [44]. Fisher's exact test and χ2 test were used. The eh (http://linkage.rockefeller.edu) and arlequin[45] programs were used for haplotype reconstruction and estimation of linkage disequilibrium.

RESULTS

Presence of polymorphisms

The CCR cluster has been sequenced extensively in Caucasians and Asians in previous studies. A de novo mutation detection was therefore not necessary. A series of 16 SNPs, which have been reported in the literature (Table 1), was preliminarily investigated in 96 individuals (HCV-infected patients and healthy controls). The following SNPs were not polymorphic in the population studied (Table 1): +971 in CCR3 (identified previously in a Japanese population but not in a British one of 142 individuals) [46], and +811, +714, +684, +630, +626, +612 in CCR5 (counting from the start of exon 1) representing the rare promoter haplotypes P5, P6, P7, P8, P9 and P10 [31]. SNPs at nucleotide positions +240, +824 and +1052 in CCR3 were observed at a low frequency (<1%), as reported previously [29], and not genotyped in the full sample. Therefore, the following variants were analysed in our sample: G190A (Val64Ile) and T780C (Asn260Asn) in CCR2, T51C (Tyr17Tre) in CCR3, +208, +627, +676 in the CCR5 promoter and Δ32 in CCR5. SNPs +208, +627 and +676 in CCR5 occurred in the known haplotypes P1 (G, C, A), P2 (G, T, A), P3 (T, T, A) and P4 (T, T, G) [28, 31, 47]. CCR2–64Ile and CCR5–Δ32 never occurred together but were always found on a CCR5–P1 bearing haplotype. The complete CCR2–CCR5 haplotypes were therefore: +.P1.+, 64Ile.P1.+, +.P1.Δ32, +.P2.+, +.P3.+ and +.P4.+.

Genotype distributions approximated Hardy–Weinberg equilibrium for the HCV-infected patients as well as the healthy controls. Allele and genotype frequencies for each SNP, as well as haplotype frequencies, did not show any statistically significant difference between the HCV-infected patients and the healthy controls (P > 0·75).

Protection against chronic HCV infection

The CCR2–64Ile variant was under-represented in the 29 patients with spontaneous viral elimination compared with the 406 patients suffering from chronic HCV infection (Table 3). Comparison of genotype frequencies resulted in a P-value of 0·018. Assumption of a dominant effect and therefore analysis of carrier status (combination of Ile64Ile and Ile64Val) resulted in a similar statistical significance for the association (P = 0·02). The haplotype 64Ile.P1.+ showed a reduced frequency of 0·02 in patients who eliminated the hepatitis C virus in comparison with a frequency of 0·10 in both patients with chronic infection and in healthy controls. The corresponding wild-type haplotype +.P1.+ was more frequent in the patients characterized by spontaneous viral elimination (0·44) than in the chronically infected (0·35) and healthy controls (0·35). None of the other variants in the CCR gene cluster showed a statistically significant association with spontaneous viral elimination.

Table 3.

Genotype and allele frequencies of the CCR2–Val64Ile polymorphism in HCV = infected patients with spontaneous viral elimination, chronic disease, and in the healthy controls

Genotype frequencies Allele frequencies


64Val/64Val 64Val/64Ile 64Ile/64Ile 64Val 64Ile
Spontaneous viral elimination (n = 29)  28 (0·9655)  1 (0·0345) 0 (0·0000)  57 (0·983)  1 (0·017)
Chronic disease (n = 406) 327 (0·8054) 78 (0·1921) 1 (0·0025) 732 (0·901) 80 (0·099)
Healthy controls (n = 370) 314 (0·8486) 56 (0·1513) 0 (0·0000) 684 (0·924) 56 (0·076)

Absolute numbers and (frequencies) are shown.

Host genotype and stage of fibrosis

Mild–moderate fibrosis (stages 0, I, II) was compared with severe fibrosis (stages III, IV). No statistically significant association between CCR2–CCR5 variants or haplotypes, respectively, and the severity of fibrosis was found. Carrier status CCR5–Δ32 appeared more frequent in patients with severe fibrosis (0·28) in comparison with mild–moderate cirrhosis (0·17) or healthy controls (0·18), respectively (Table 4). The differences did not reach statistical significance (P = 0·08). The haplotype carrying the CCR5–Δ32, +.P1.Δ32 had a frequency of 0·12 in patients with severe fibrosis (stages III and IV) and 0·08 in the patients with mild–moderate fibrosis (stages 0, I, II).

Table 4.

. Genotype and allele frequencies of the CCR5–Δ32 deletion patients with chronic active HCV infection and different stages of fibrosis

Genotype frequencies Allele frequencies


wt/wt wt/Δ32 Δ32/Δ32 wt Δ32
Mild–moderate fibrosis (n = 204) 169 (0·828) 34 (0·167) 1 (0·005) 372 (0·912) 36 (0·088)
Severe fibrosis (n = 53)  38 (0·717) 15 (0·283) 0 (0·000)  91 (0·858) 15 (0·142)
Healthy controls (n = 250) 204 (0·816) 44 (0·176) 2 (0·008) 452 (0·904) 48 (0·096)

Mild–moderate fibrosis was defined as METAVIR stages 0, I or II, whereas stages III and IV were classified as severe fibrosis. Absolute numbers and (frequencies) are shown.

Host genotype and response to antiviral treatment

No individual variants or CCR2–CCR5 haplotypes appear to predict the likelihood of sustained response to antiviral therapy. Using the combined cohort of patients (IFN and IFN + ribavirin) P-values were in excess of 0·54.

DISCUSSION

It appears likely that host genetic factors contribute to the course of HCV infection, including the ability to spontaneously eliminate viral RNA, as has been suggested for infection with HBV [48,49]. HLA DRB1*01 has been studied with regard to HCV spontaneous clearance with varying results [1214,50,51]. Such divergence in results may reflect the different ethnic backgrounds of the populations under study.

We investigated known polymorphisms in the CCR2–CCR5 gene cluster in relation to the outcome of HCV infection. In the population under study, the variant allele 64Ile in the CCR2 gene, which is associated with slow progression to AIDS after HIV infection, and the corresponding CCR2–CCR5 haplotype carrying this variant allele (64Ile.P1.+) appear under-represented in patients with a spontaneous viral elimination compared with patients suffering from chronic infection. This under-representation is not associated with female gender, as there is no difference for this SNP between females and males in the control group and the hepatitis C patients as well. The association between G190A genotypes and spontaneous viral elimination is statistically significant, with a P-value of 0·018. This P-value is exploratory [52,53] and although haplotype analysis points into the same direction, this finding should be confirmed in a second independent cohort with a high number of patients characterized by spontaneous viral elimination.

The molecular mechanism responsible for the association between the 64Ile allele in the CCR2 gene and slow progression to AIDS after HIV infection is unclear at present. Val64Ile represents a conservative change (both amino acids are neutrally charged) in the first transmembrane domain of the protein. The receptor containing the variance has been shown to be expressed efficiently on the cell surface. It transduces signals in response to MCP-1 binding and protein expression is not altered [54]. These observations suggest that the association between 64Ile and slow progression to AIDS could be due to linkage disequilibrium between the 64Ile and another as yet unknown SNP. The association between 64Ile and lack of spontaneous recovery from HCV infection could therefore also be due to linkage disequilibrium with the causative variant. The fact that CCR2 does not function as a co-receptor for the hepatitis C virus would support this hypothesis.

In the present study we did not observe the increased frequency of the CCR5–Δ32 homozygote genotypes in HCV-infected patients as reported recently by Woitas and co-workers [37], even if we studied an ethnically similar population, which is confirmed by genotype frequencies for CCR5–Δ32 in the background populations analysed. Healthy controls in the study by Woitas et al. (84·3% for the wt/wt, 14·7% for the Δ32/wt, 1% for Δ32/Δ32 [37]) were not different from the present study (81·6% for the wt/wt, 17·6% for the Δ32/wt, 0·8% for the Δ32/Δ32). However, HCV-infected patients in the study presented here were not significantly different from the healthy controls. The difference between the two cohorts of HCV infected patients could be due to population stratification: we have recruited a referral population in which HCV infection was acquired mainly through social contacts, whereas Woitas and co-workers studied a group of patients that was enriched for HCV/HIV co-infections (e.g. due to use of blood products in haemophiliacs or i.v. drug abuse). Departure from Hardy–Weinberg equilibrium that was seen in the patients studied by Woitas et al. but not in our cohort would point also to ethnical differences between the two populations. The association between CCR5–Δ32 and increased viral load was not investigated in the present study.

It would be important to predict progression to fibrosis. Carrier status for CCR5–Δ32 appeared more frequent in patients with severe fibrosis; however, the difference did not reach statistical significance. This genetic variant should be investigated in a larger sample as a potentially weak marker. The mechanisms which cause an advanced stage of fibrosis are still unclear. It would be interesting to study genetic variants in pathways involved in fibrosis using complex statistics (e.g. Petri networks) that allow modelling of additive genetic influences.

In summary, this study shows that host genetic factors in the CCR cluster may have a modest influence on the ability to clear the hepatitis C virus after infection. Further studies will be necessary to confirm the association between the 64Ile polymorphism in the CCR2 gene and lack of spontaneous recovery in a second, independent cohort of HCV-infected patients.

Acknowledgments

The work reported in this manuscript was supported by grants from the Competence Networks ‘Hepatitis’ (http://www.kompetenznetz-hepatitis.de/) and ‘Chronic Inflammatory Bowel Disease’ (http://www.kompetenznetz-ced.de) and the National Genome Research Network (‘NGFN’, http://www.ngfn.de), all awarded by the German Ministry for Education and Research (BMBF). The authors are most grateful to the patients and volunteers who have contributed their DNA for investigation in the study. The authors are indebted to Tanja Wesse, Tam Ho Kim and Birthe Petersen, who were the technicians carrying out the experiments.

REFERENCES

  • 1.Alter MJ, Margolis HS, Krawczynski K, et al. The natural history of community-acquired hepatitis C in the United States. The Sentinel Counties Chronic non-A, non-B Hepatitis Study Team. N Engl J Med. 1992;327:905. doi: 10.1056/NEJM199212313272702. :1899–. [DOI] [PubMed] [Google Scholar]
  • 2.Tong MJ, el-Farra NS, Reikes AR, Co RL. Clinical outcomes after transfusion-associated hepatitis C. N Engl J Med. 1995;332:1463–6. doi: 10.1056/NEJM199506013322202. [DOI] [PubMed] [Google Scholar]
  • 3.Dusheiko G, Schmilovitz-Weiss H, Brown D, et al. Hepatitis C virus genotypes: an investigation of type-specific differences in geographic origin and disease. Hepatology. 1994;19:13–18. [PubMed] [Google Scholar]
  • 4.Farci P, Shimoda A, Coiana A, et al. The outcome of acute hepatitis C predicted by the evolution of the viral quasispecies. Science. 2000;288:339–44. doi: 10.1126/science.288.5464.339. [DOI] [PubMed] [Google Scholar]
  • 5.Poynard T, Bedossa P, Opolon P. Natural history of liver fibrosis progression in patients with chronic hepatitis C. The OBSVIRC, METAVIR, CLINIVIR, and DOSVIRC groups. Lancet. 1997;349:825–32. doi: 10.1016/s0140-6736(96)07642-8. [DOI] [PubMed] [Google Scholar]
  • 6.Manns MP, McHutchison JG, Gordon SC, et al. Peginterferon alfa-2b plus ribavirin compared with interferon alfa-2b plus ribavirin for initial treatment of chronic hepatitis C: a randomised trial. Lancet. 2001;358:958–65. doi: 10.1016/s0140-6736(01)06102-5. [DOI] [PubMed] [Google Scholar]
  • 7.Ferenci P, Brunner H, Nachbaur K, et al. Combination of interferon induction therapy and ribavirin in chronic hepatitis C. Hepatology. 2001;34:1006–11. doi: 10.1053/jhep.2001.28706. [DOI] [PubMed] [Google Scholar]
  • 8.Alric L, Fort M, Izopet J, et al. Genes of the major histocompatibility complex class II influence the outcome of hepatitis C virus infection. Gastroenterology. 1997;113:1675–81. doi: 10.1053/gast.1997.v113.pm9352872. [DOI] [PubMed] [Google Scholar]
  • 9.Alric L, Fort M, Izopet J, et al. Study of host- and virus-related factors associated with spontaneous hepatitis C virus clearance. Tissue Antigens. 2000;56:154–8. doi: 10.1034/j.1399-0039.2000.560207.x. [DOI] [PubMed] [Google Scholar]
  • 10.Fanning LJ, Levis J, Kenny-Walsh E, Whelton M, O'Sullivan K, Shanahan F. HLA class II genes determine the natural variance of hepatitis C viral load. Hepatology. 2001;33:224–30. doi: 10.1053/jhep.2001.20642. [DOI] [PubMed] [Google Scholar]
  • 11.Thursz M, Yallop R, Goldin R, Trepo C, Thomas HC. Influence of MHC class II genotype on outcome of infection with hepatitis C virus. The HENCORE group. Hepatitis C European Network for Cooperative Research. Lancet. 1999;354:2119–24. doi: 10.1016/s0140-6736(99)91443-5. [DOI] [PubMed] [Google Scholar]
  • 12.Asti M, Martinetti M, Zavaglia C, et al. Human leukocyte antigen class II and III alleles and severity of hepatitis C virus-related chronic liver disease. Hepatology. 1999;29:1272–9. doi: 10.1002/hep.510290445. [DOI] [PubMed] [Google Scholar]
  • 13.Barrett S, Ryan E, Crowe J. Association of the HLA-DRB1*01 allele with spontaneous viral clearance in an Irish cohort infected with hepatitis C virus via contaminated anti-D immunoglobulin. J Hepatol. 1999;30:979–83. doi: 10.1016/s0168-8278(99)80249-9. [DOI] [PubMed] [Google Scholar]
  • 14.Mangia A, Gentile R, Cascavilla I, et al. HLA class II favors clearance of HCV infection and progression of the chronic liver damage. J Hepatol. 1999;30:984–9. doi: 10.1016/s0168-8278(99)80250-5. [DOI] [PubMed] [Google Scholar]
  • 15.Kuzushita N, Hayashi N, Moribe T, et al. Influence of HLA haplotypes on the clinical courses of individuals infected with hepatitis C virus. Hepatology. 1998;27:240–4. doi: 10.1002/hep.510270136. [DOI] [PubMed] [Google Scholar]
  • 16.Minton EJ, Smillie D, Neal KR, Irving WL, Underwood JC, James V. Association between MHC class II alleles and clearance of circulating hepatitis C virus. J Infect Dis. 1998;178:39–44. doi: 10.1086/515599. [DOI] [PubMed] [Google Scholar]
  • 17.Powell EE, Edwards-Smith CJ, Hay JL, et al. Host genetic factors influence disease progression in chronic hepatitis C. Hepatology. 2000;31:828–33. doi: 10.1053/he.2000.6253. [DOI] [PubMed] [Google Scholar]
  • 18.Yee LJ, Tang J, Herrera J, Kaslow RA, van Leeuwen DJ. Tumor necrosis factor gene polymorphisms in patients with cirrhosis from chronic hepatitis C virus infection. Genes Immun. 2000;1:386–90. doi: 10.1038/sj.gene.6363696. [DOI] [PubMed] [Google Scholar]
  • 19.Yee LJ, Tang J, Gibson AW, Kimberly R, Van Leeuwen DJ, Kaslow RA. Interleukin 10 polymorphisms as predictors of sustained response in antiviral therapy for chronic hepatitis C infection. Hepatology. 2001;33:708–12. doi: 10.1053/jhep.2001.22347. [DOI] [PubMed] [Google Scholar]
  • 20.Knapp S, Yee LJ, Zhang L, et al. Polmorphisms in the interferon-induced genes and the outcome of Hepatitis C infection; role of MxA, OAS-1 and PKR. Genes Immun. 2003;4:411–9. doi: 10.1038/sj.gene.6363984. [DOI] [PubMed] [Google Scholar]
  • 21.Knapp S, Hennig B, Frodsham A, et al. Interleukin-10 polymorphisms and outcome of Hepatitis C Infection. Immunogenetics. 2003;55:362–9. doi: 10.1007/s00251-003-0594-5. [DOI] [PubMed] [Google Scholar]
  • 22.Dean M, Carrington M, Winkler C, et al. Genetic restriction of HIV-1 infection and progression to AIDS by a deletion allele of the CKR5 structural gene. Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study. Science. 1996;273:1856–62. doi: 10.1126/science.273.5283.1856. [DOI] [PubMed] [Google Scholar]
  • 23.Alkhatib G, Combadiere C, Broder CC, et al. CC CKR5: a RANTES, MIP-1alpha, MIP-1beta receptor as a fusion cofactor for macrophage-tropic HIV-1. Science. 1996;272:1955–8. doi: 10.1126/science.272.5270.1955. [DOI] [PubMed] [Google Scholar]
  • 24.Feng Y, Broder CC, Kennedy PE, Berger EA. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science. 1996;272:872–7. doi: 10.1126/science.272.5263.872. [DOI] [PubMed] [Google Scholar]
  • 25.Deng H, Liu R, Ellmeier W, et al. Identification of a major co-receptor for primary isolates of HIV-1. Nature. 1996;381:661–6. doi: 10.1038/381661a0. [DOI] [PubMed] [Google Scholar]
  • 26.Choe H, Farzan M, Sun Y, et al. The beta-chemokine receptors CCR3 and CCR5 facilitate infection by primary HIV-1 isolates. Cell. 1996;85:1135–48. doi: 10.1016/s0092-8674(00)81313-6. [DOI] [PubMed] [Google Scholar]
  • 27.Doranz BJ, Rucker J, Yi Y, et al. A dual-tropic primary HIV-1 isolate that uses fusin and the beta-chemokine receptors CKR-5, CKR-3, and CKR-2b as fusion cofactors. Cell. 1996;85:1149–58. doi: 10.1016/s0092-8674(00)81314-8. [DOI] [PubMed] [Google Scholar]
  • 28.Smith MW, Dean M, Carrington M, et al. Contrasting genetic influence of CCR2 and CCR5 variants on HIV-1 infection and disease progression. Hemophilia Growth and Development Study (HGDS), Multicenter AIDS Cohort Study (MACS), Multicenter Hemophilia Cohort Study (MHCS), San Francisco City Cohort (SFCC), ALIVE Study. Science. 1997;277:959–65. doi: 10.1126/science.277.5328.959. [DOI] [PubMed] [Google Scholar]
  • 29.Zimmermann N, Bernstein JA, Rothenberg ME. Polymorphisms in the human CC chemokine receptor-3 gene. Biochim Biophys Acta. 1998;1442:170–6. doi: 10.1016/s0167-4781(98)00162-6. [DOI] [PubMed] [Google Scholar]
  • 30.Mummidi S, Ahuja SS, Gonzalez E, et al. Genealogy of the CCR5 locus and chemokine system gene variants associated with altered rates of HIV-1 disease progression. Nat Med. 1998;4:786–93. doi: 10.1038/nm0798-786. [DOI] [PubMed] [Google Scholar]
  • 31.Martin MP, Dean M, Smith MW, et al. Genetic acceleration of AIDS progression by a promoter variant of CCR5. Science. 282:1907–11. doi: 10.1126/science.282.5395.1907. 1998. [DOI] [PubMed] [Google Scholar]
  • 32.Kostrikis LG, Huang Y, Moore JP, et al. A chemokine receptor CCR2 allele delays HIV-1 disease progression and is associated with a CCR5 promoter mutation. Nat Med. 1998;4:350–3. doi: 10.1038/nm0398-350. [DOI] [PubMed] [Google Scholar]
  • 33.Huang Y, Paxton WA, Wolinsky SM, et al. The role of a mutant CCR5 allele in HIV-1 transmission and disease progression. Nat Med. 1996;2:1240–3. doi: 10.1038/nm1196-1240. [DOI] [PubMed] [Google Scholar]
  • 34.Liu R, Paxton WA, Choe S, et al. Homozygous defect in HIV-1 coreceptor accounts for resistance of some multiply-exposed individuals to HIV-1 infection. Cell. 1996;86:367–77. doi: 10.1016/s0092-8674(00)80110-5. [DOI] [PubMed] [Google Scholar]
  • 35.Biti R, Ffrench R, Young J, Bennetts B, Stewart G, Liang T. HIV-1 infection in an individual homozygous for the CCR5 deletion allele. Nat Med. 1997;3:252–3. doi: 10.1038/nm0397-252. [DOI] [PubMed] [Google Scholar]
  • 36.Sullivan AD, Wigginton J, Kirschner D. The coreceptor mutation CCR5Delta32 influences the dynamics of HIV epidemics and is selected for by HIV. Proc Natl Acad Sci USA. 2001;98:10214–9. doi: 10.1073/pnas.181325198. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Woitas RP, Ahlenstiel G, Iwan A, et al. Frequency of the HIV-protective CC chemokine receptor 5-Delta32/Delta32 genotype is increased in hepatitis C. Gastroenterology. 2002;122:1721–8. doi: 10.1053/gast.2002.33660. [DOI] [PubMed] [Google Scholar]
  • 38.Marra F, Romanelli RG, Giannini C, et al. Monocyte chemotactic protein-1 as a chemoattractant for human hepatic stellate cells. Hepatology. 1999;29:140–8. doi: 10.1002/hep.510290107. [DOI] [PubMed] [Google Scholar]
  • 39.Dambach DM, Watson LM, Gray KR, Durham SK, Laskin DL. Role of CCR2 in macrophage migration into the liver during acetaminophen-induced hepatotoxicity in the mouse. Hepatology. 2002;35:1093–103. doi: 10.1053/jhep.2002.33162. [DOI] [PubMed] [Google Scholar]
  • 40.Narumi S, Tominaga Y, Tamaru M, et al. Expression of IFN-inducible protein-10 in chronic hepatitis. J Immunol. 1997;158:5536–44. [PubMed] [Google Scholar]
  • 41.Le Pogam S, Dubois F, Christen R, Raby C, Cavicchini A, Goudeau A. Comparison of DNA enzyme immunoassay and line probe assays (Inno-LiPA HCV I and II) for hepatitis C virus genotyping. J Clin Microbiol. 1998;36:1461–3. doi: 10.1128/jcm.36.5.1461-1463.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Bedossa P, Poynard T. An algorithm for the grading of activity in chronic hepatitis C. The METAVIR Cooperative Study Group. Hepatology. 1996;24:289–93. doi: 10.1002/hep.510240201. [DOI] [PubMed] [Google Scholar]
  • 43.Hampe J, Wollstein A, Lu T, et al. An integrated system for high throughput TaqMan based SNP genotyping. Bioinformatics. 2001;17:654–5. doi: 10.1093/bioinformatics/17.7.654. [DOI] [PubMed] [Google Scholar]
  • 44.SPSS Inc. SPSS statistical algorithms. Chicago: SPSS Inc.; 1997. [Google Scholar]
  • 45.Schneider S. Switzerland: Genetics and Biometr Laboratory, University of Geneva; 2000. Arlequin ver. 2.000: A software for population genetics dat analysis. [Google Scholar]
  • 46.Fukunaga K, Asano K, Mao XQ, et al. Genetic polymorphisms of CC chemokine receptor 3 in Japanese and British asthmatics. Eur Respir J. 2001;17:59–63. doi: 10.1183/09031936.01.17100590. [DOI] [PubMed] [Google Scholar]
  • 47.Clark VJ, Metheny N, Dean M, Peterson RJ. Statistical estimation and pedigree analysis of CCR2-CCR5 haplotypes. Hum Genet. 2001;108:484–93. doi: 10.1007/s004390100512. [DOI] [PubMed] [Google Scholar]
  • 48.Thursz MR, Kwiatkowski D, Allsopp CE, et al. Association between an MHC class II allele and clearance of hepatitis B virus in the Gambia. N Engl J Med. 1995;332:1065–9. doi: 10.1056/NEJM199504203321604. [DOI] [PubMed] [Google Scholar]
  • 49.Almarri A, Batchelor JR. HLA and hepatitis B infection. Lancet. 1994;344:1194–5. doi: 10.1016/s0140-6736(94)90510-x. [DOI] [PubMed] [Google Scholar]
  • 50.Fanning LJ, Levis J, Kenny-Walsh E, Wynne F, Whelton M, Shanahan F. Viral clearance in hepatitis C (1b) infection: relationship with human leukocyte antigen class II in a homogeneous population. Hepatology. 2000;31:1334–7. doi: 10.1053/jhep.2000.7437. [DOI] [PubMed] [Google Scholar]
  • 51.Barrett S, Goh J, Coughlan B, et al. The natural course of hepatitis C virus infection after 22 years in a unique homogenous cohort: spontaneous viral clearance and chronic HCV infection. Gut. 2001;49:423–30. doi: 10.1136/gut.49.3.423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Rothman KJ. No adjustments are needed for multiple comparisons. Epidemiology. 1990;1:43–6. [PubMed] [Google Scholar]
  • 53.Perneger TV. What's wrong with Bonferroni adjustments. BMJ. 1998;316:1236–8. doi: 10.1136/bmj.316.7139.1236. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54.Lee B, Doranz BJ, Rana S, et al. Influence of the CCR2-V64I polymorphism on human immunodeficiency virus type 1 coreceptor activity and on chemokine receptor function of CCR2b, CCR3, CCR5, and CXCR4. J Virol. 1998;72:7450–8. doi: 10.1128/jvi.72.9.7450-7458.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES