Abstract
The pathogenic mycobacteria are an insidious group of bacterial pathogens that cause the deaths of millions of people every year. One of the reasons these pathogens are so successful is that they are able to invade and replicate within host macrophages, one of the first lines of defence against intruding pathogens. In contrast, non-pathogenic mycobacteria, such as Mycobacterium smegmatis are killed rapidly by macrophages. In order to understand better the series of events that allow pathogenic mycobacteria to survive and replicate within macrophages, while the non-pathogenic mycobacteria are killed rapidly, we inoculated the human monocytic cell line U937 with pathogenic (M. tuberculosis and M. avium) and non-pathogenic (M. smegmatis) mycobacteria and monitored the expression of over 3500 genes at 4, 12 and 24 h post-inoculation using a commercially available gene array system. We observed multiple differences in the gene expression patterns of monocytes infected with pathogenic and non-pathogenic mycobacteria including genes involved in cytokine, lymphokine and chemokine production, adhesion, apoptosis, signal transduction, transcription, protein cleavage, actin polymerization and growth. We also observed differences in gene expression profiles in monocytes infected with M. tuberculosis or M. avium, indicating that there are differences in the host pathogen interactions of mononuclear phagocytes infected with different pathogenic mycobacterial species. These results increase the understanding of the mechanisms used by pathogenic mycobacteria to cause disease, the host response to these organisms, and provide new insights for antimycobacterial intervention strategies.
Keywords: expression; genes, macrophages; mycobacteria; uptake
INTRODUCTION
The genus Mycobacterium contains over 60 species including the obligate pathogen Mycobacterium tuberculosis, the facultative pathogen M. avium and numerous non-pathogenic species such as M. smegmatis. M. tuberculosis is one of the most troublesome human pathogenic bacteria and is estimated to infect over one-third of the world's population, resulting in the deaths of more people worldwide than any other infectious agent [1]. M. avium, although considered less pathogenic, also causes disease in people with immune disorders (e.g. AIDS), those with pre-existing lung conditions (e.g. chronic obstructive pulmonary disease) and on occasion in people who are otherwise apparently healthy [2,3]. In addition M. avium ssp. paratuberculosis has been implicated as the aetiological agent of Crohn's disease, a chronic inflammatory disease of the intestine and/or colon [4,5].
When non-pathogenic bacteria are phagocytosed by macrophages the normal progression of events leads to the acidification of the phagosome and fusion with lysosomes, resulting in an environment that is lethal to most bacteria [6]. However, pathogenic mycobacteria, such as M. avium and M. tuberculosis, prevent the acidification of the phagosome and fusion with lysosomes [7–11]. Thus when pathogenic mycobacteria enter macrophages they are not killed, but are able to multiply resulting in the demise of the macrophage and the release of bacteria that go on to infect other macrophages with increased efficiency [12]. The series of events that allow pathogenic mycobacteria to alter the normal progression of events within mononuclear phagocytes is poorly understood, but probably involves multiple factors, including the alteration of phagocyte gene expression patterns.
We hypothesized that mononuclear phagocytes infected with pathogenic mycobacteria have altered gene expression profiles compared to phagocytes infected with non-pathogenic mycobacteria, and that these functional genomic differences contribute to the altered outcomes for these host–pathogen interactions. Using U937 cells, a human monocytic cell line that differentiates into macrophage-like cells after treatment with phorbol esters [13], we monitored the expression of macrophage genes after infection with pathogenic (M. tuberculosis and M. avium) and non-pathogenic (M. smegmatis) mycobacteria at time intervals of 4, 12 and 24 h post-inoculation using a commercially available DNA array (Clonetech Atlas Human cDNA Expression Arrays I, II and III) containing more than 3500 human genes (for a full list of genes see http://atlasinfo.clontech.com/ and select Atlasinfo then select 7850–1 Human 1·2 I, 7852–1 Human 1·2 II and 7855–1 Human 1·2 III). We observed altered gene expression profiles in U937 cells infected with pathogenic and non-pathogenic mycobacteria. We also observed differences in gene expression among U937 cells infected with M. tuberculosis and M. avium.
MATERIALS AND METHODS
Bacterial and cell culture
M. avium strain 101 was isolated from the blood of an AIDS patient and has been shown to be virulent to mice [14]; M. tuberculosis H37Rv was purchased from American Tissue Culture Collection (ATCC, Virginia); and M. smegmatis mc2 155 was a gift from William Jacobs Jr (Albert Einstein College of Medicine, The Bronx, New York, USA). All mycobacteria were cultured on Middlebrook 7H11 agar and 7H9 broth supplemented with OADC (Difco, Detroit, MI, USA). Inocula were prepared by suspending mycobacteria in Hanks's buffered salt solution (HBSS) which was vortex agitated for 1 min, allowed to sit for 1 min to allow any clumps to settle, and the top portion was used to infect U937 monolayers. U937 monolayers were prepared by placing 1 × 107 cells in a 125 ml plastic flask containing RPMI-1640 supplemented with 10% (v/v) heat-inactivated fetal bovine serum (Sigma Chemicals, St Louis, MO, USA). The cells were allowed to grow for 3 days at 37°C in 5% CO2, after which phorbol ester (PMA) was added to a final concentration of 100 µg per ml. The next day (U937 cells had returned to resting stage as determined by their response to stimulation with lipopolysaccharide by measuring the production of superoxide anion; data not shown) cultures were washed 2× with fresh media and inoculated with the various mycobacteria.
Infection of U937 cells and RNA isolation
U937 monolayers (containing approximately 108 cells) were incubated with 1 × 108 bacteria (MOI of 1) for 1 h and washed with HBSS to remove any extracellular bacteria. Using microscopic analysis we observed that approximately 60–70% of the macrophages became infected with at least one bacterium (data not shown). At time periods 4, 12 and 24 h post-inoculation the macrophage monolayers were harvested for RNA. Total RNA was isolated from infected and uninfected macrophages using the Atlas Pure Total RNA Labeling System (Clontech Laboratories, Palo Alto, CA, USA) in accordance with the manufacturer's instructions. Briefly, cell culture flasks with adherent cells were drained of media and the adherent cells were lysed with 3 ml of denaturing solution at 4°C for 5 min with agitation. The resulting solution was transferred to a tube and centrifuged at 12 000 g at 4°C for 5 min to remove cellular debris. The supernatant was phenol chloroform extracted three times, mixed with an equal amount of ice-cold isopropanol and centrifuged at 15 000 g for 15 min at 4°C. The resulting pellet was air-dried, suspended in RNase-free water, mixed with an appropriate amount of DNase buffer and digested with RNase free, DNase for 30 min at 37°C. The solution was phenol–chloroform extracted, chloroform extracted, precipitated with ethanol and suspended in RNase-free water. The RNA was examined in a 1% denaturing agarose gel for degradation and quantified by UV spectroscopy at 260/280 nm to ensure the quality of RNA.
Preparation of 32P-labelled cDNA probes
32P-labelled probes were prepared utilizing the Atlas Pure Total RNA Labeling System (Clontech Laboratories) in accordance with the manufacturer's instructions. Briefly, 5 µg of total RNA was reverse transcribed utilizing the primer mix supplied with each array. This mixture was heated to 65°C in a polymerase chain reaction (PCR) thermal cycler for 2 min, then to 50°C for 2 min, at which time 13·5 µl of master mix containing 4 µl 5× reaction buffer, 2 µl 10× dNTP mix, 5 µl α32dATP (3000 Ci/mmol, 10 µCi/µl), 0·5 µl DTT (100 mm) and 2 µl of MMLV reverse transcriptase was added, mixed briefly and incubated for 25 min at 50°C. The reaction was terminated by adding 2 µl 10× termination mix. Unincorporated nucleotides were removed using a NucleoSpin Extraction Spin Column (Clontech Laboratories, Palo Alto, CA, USA) according the manufacturer's instructions. The radionucleotide incorperation into the probe was measured by scintillation counting.
Hybridization of cDNA probes to arrays
Clontech Human Nylon Filter Arrays (Clontech Laboratories Inc.) were prehybridized in 5 ml of Express-Hyb solution provided with the arrays supplemented with 0·5 mg heat denatured and sheared salmon testes DNA at 68°C for 30 min. The radiolabelled cDNA probe was mixed with 5 µl Cot-1 DNA (supplied with the arrays), heated in a boiling waterbath for 2 min, placed on ice for 2 min, added to the hybridization solution and allowed to hybridize to the filter arrays for 12 h. The membranes were washed 4× in 200 ml of 2× SSC plus 0·1% sodium dodecyl sulphate (SDS) for 30 min at 68°C, then again in 200 ml of 0·1× SSC plus 0·5% SDS for 30 min at 68°C and rinsed in 200 ml of 2× SSC for 5 min at room temperature. The filters were wrapped in plastic wrap and exposed to a phosphor imaging screen for 24 h. The arrays were stripped by boiling in 500 ml of a 0·5% SDS solution for 5 min at which time the solution was removed from the heat and allowed to sit for 10 min, and rinsed in 2× SSC plus 1% SDS. The arrays were checked for residual radioactivity by exposing it to a phosphor imaging screen for 24 h. Arrays were used three times and discarded.
Array and data analysis
The phosphor imaging screens were analysed using a phosphor imager (Perkin Elmer, Boston, MA, USA) and AtlasImage 2·0 analysis software. The arrays were normalized to the appropriate uninfected macrophage control array using the global normalization method provided in the software package. Several ‘housekeeping’ genes such as hypoxanthine–guanine phosphoriboslytransferase 1 (HPRT1), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), tubulin alpha 1 (TUBA1), major histocompatibility class 1 C (HLAC), beta-actin (ACTB) and the 23-kDa highly basic protein (PRL13A) were used as controls to because their transcription levels were within twofold in macrophages infected with pathogenic and non-pathogenic mycobacteria. The data shown are representative of two independent hybridization experiments using RNA isolated from two independent experiments. All differentially expressed gene spots were checked by visual examination to ensure that no differentially expressed genes were the result of inaccurate alignment of the arrays or an artefact of 23P spotting. Only genes that were shown to be differentially expressed by at least threefold in two independent experiments were included.
Quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis
To confirm the array data we chose seven genes to analyse via quantitative RT-PCR. The genes chosen were MMP9, EPHA3, CASP10, SCYA1, ITGAL, EPX and G3PDH. G3PDH was used as an internal control because it was shown to be expressed at the same levels in all macrophages. RT-PCR was performed using the Advantage RT-for-PCR Kit (BD Biosciences, Palo Alto, CA, USA). Briefly, 0·5 µg of total RNA was mixed with 1·0 µl (20 µm) oligo(dT)18 primers in a total volume of 13·5 µl, heated to 70°C for 2 min and placed on ice for 2 min. To this mixture was added 0·4 µl reaction buffer, 1·0 µl of dNTP mix (10 mm each), 0·5 µl RNase inhibitor and 1·0 µl MMLV reverse transcriptase (200 units/µl). This mixture was incubated for 1 h at 42°C, heated to 94°C for 5 min to destroy any DNase activity and diluted to 100 µl by adding 80 µl DEPC-treated water. The resulting cDNA was PCR amplified using primers with the sequences listed in Table 1. Quantitative PCR reactions were carried out using an Icycler (Bio-Rad, Hercules, CA, USA) and a SYBR Green method. Briefly, PCR reactions were carried out in 50 µl reactions consisting of 25 µl SYBR Green Master Mix (Applied Biosystems, Warrington, UK), 1 µl each primer (10 µm), 5 µl cDNA and 20 µl water. PCR was carried out with 1 cycle of 95°C for 5 min, followed by 45 cycles of 95°C for 30 s, and 60°C for 30 s. Each PCR product was verified for purity by running an agarose gel.
Table 1.
Primers used for real-time PCR
| Primer | Sequence (5′−3′) | Tm (°C) | Gene target | Product size (bp) |
|---|---|---|---|---|
| MMP9F | CCGAGCTGACTCGACGGTGATGG | 64·6 | mmp9 | 334 |
| MMP9R | GAGGTGCCGGATGCCATTCACGTC | 65·6 | mmp9 | |
| EPHF | ATATCTCTACCTTCCGCACAACAGGTGACTG | 64·6 | EphA3 | 318 |
| EPHR | CACCAGTATCTCCAGAATTATTGTCTGTCT | 60·3 | EphA3 | |
| CASPF | AATTTGGTCTATGCCAGGCCCATTTCCT | 64·5 | casp10 | 414 |
| CASPR | CAGTTGTGTCATCTTGGCTCACCACAG | 63·3 | casp10 | |
| SICF | ATACCAGCTCCATCTGCTCCAATGAGGGC | 67·2 | SCYA1 | 192 |
| SICR | TCGGGGACAGGTGAAGCCATGTGGTTTCC | 69·3 | scya1 | |
| IALF | GTCAGGGCGTGGGACATCTAGTAGG | 63·3 | itgal | 330 |
| IALR | TGGAGTGCAATGGCGCAATCTTGGCT | 67·3 | itgal | |
| EPXF | GGAATTTGGCACAGCTTAGCCGGG | 64·3 | epx | 314 |
| EPXR | GAAGATGTCCCTTGAAACCGTGGTG | 61·5 | epx |
RESULTS
RNA purification, cDNA labelling and array hybridization
Total RNA from U937 cells infected with M. tuberculosis, M. avium or M. smegmatis was purified and 5 µg was reverse-transcribed into cDNA using α32P-dATP and primers specific for each gene on the array, as described in Materials and methods. The quality of RNA was assayed via UV spectrophotometry at 260/280 nm and the ratios were between 1·8 and 1·9, the RNA was also inspected visually on formaldehyde agarose gels to ensure that no degradation had occurred (data not shown). Labelling efficiencies were assayed using scintillation counting and each sample produced approximately 1 × 107DPM (degradations per minute). The entire reactions were used to probe the oligonucleotide arrays, which were then washed, exposed to a phosphor screen for 24 h and scanned in a phosphor imager. Only genes with expression levels that differed from the control uninfected macrophages by at least threefold on two separate experiments were considered as being differentially expressed. The results between two separate experiments varied very little, and the trends were the same.
Analysis of U937 gene expression after infection with pathogenic and non-pathogenic mycobacteria
The expression of 3528 human genes in U937 cells infected with the obligate pathogen M. tuberculosis, the facultative pathogen M. avium or the non-pathogen M. smegmatis was examined at time periods 4, 12 and 24 h post-inoculation. As expected, the majority of the genes examined did not show any difference in expression after infection with pathogenic or non-pathogenic mycobacteria compared to control uninfected U937 cells. M. tuberculosis-infected U937 cells showed the greatest number of differentially regulated genes with 53, or approximately 1·5% (Table 2). M. avium-infected cells showed the second greatest number of genes with altered expression with 43 or 1·2% (Table 3) and M. smegmatis-infected cells showed the least number with 30 or 0·9% (Table 4).
Table 2.
Genes differentially expressed in U937 cells after infection with Mycobacterium tuberculosis
| Fold induction at time point (h) | |||||
|---|---|---|---|---|---|
| Gene | GenBank ID | Classification | 4 | 12 | 24 |
| FTL1 | U01134 | Tyrosine kinase | – | – | −3 |
| ERRB3 | M29366 | Tyrosine kinase | – | – | 3·5 |
| EPHA3 | M83941 | Tyrosine kinase | – | – | 49 |
| PRKAR1B | M65066 | Protein kinase | – | – | 4·5 |
| LAT | AF036905 | Signal transduction | – | 4·4 | 3 |
| CSNK2B | X16937 | Signal transduction | 4 | 4 | – |
| PLAUR | U08839 | Signal transduction/adhesion | – | 4·7 | – |
| NFKB | X61498 | Transcription factor | – | – | 3 |
| ID2 | M97796 | Transcription factor | – | – | −3 |
| ZNF136 | U09367 | Transcription factor | 2·5 | 17 | – |
| ISGF3G | M87503 | Transcription factor | – | – | −3 |
| IRF7 | U73036 | Transcriptional regulator | – | 4·6 | – |
| BTEB1 | D31716 | Transcriptional regulator | −5 | −27 | – |
| SPN | J04536 | Intracellular signalling | – | – | −3 |
| GNB2L1 | M24194 | G protein | 2·3 | 3 | – |
| GNB1 | M36430 | G protein | – | – | 4·4 |
| FGF11 | U66199 | Growth factor | 3 | 3 | 5 |
| MST1 | M74178 | Growth factor | – | 4·2 | 4·1 |
| NDUFB7 | M33374 | Adhesion | – | −4 | – |
| ITGA5 | X06256 | Adhesion | – | 3 | – |
| ITGAL | Y00796 | Adhesion/integrin | – | 19 | 3 |
| BCL2L1 | Z23115 | Apoptosis | – | −14 | – |
| IEX1L | AF039067 | Apoptosis | – | 4 | – |
| CASP10 | U60519 | Apoptosis | – | 8·3 | 3·3 |
| RPS19 | M81757 | Ribosomal protein/apoptosis | – | 3 | 3 |
| SSP1 | X13694 | Cytokine | 2 | 3 | – |
| OSM | M27288 | Cytokine | – | – | 4·5 |
| TGFB2 | M19154 | Cytokine | – | – | 5 |
| IL1B | K02770 | Cytokine | – | 3·3 | 4 |
| GROB(MIP2) | X53799 | Cytokine | 3 | 5 | 3 |
| SCYA1(I309) | M57502 | Cytokine | 3 | 8 | 12 |
| TNFA | X01394 | Cytokine | – | 3 | 2 |
| IL8 | Y00787 | Chemokine | – | – | 3 |
| RANTES | M21121 | Chemokine | – | 6·8 | – |
| SCYA3(MIP1) M23452 | Chemokine | – | 3 | 3 | |
| Neuroleukin | K03515 | Lymphokine | – | 4·1 | – |
| IL2RG | D11086 | Cytokine receptor | – | 3 | – |
| IL2RA | X01057 | Cytokine receptor | – | 16 | 3·5 |
| TIMP1 | X03124 | Metalloproteinase inhibitor | – | 4·7 | – |
| MMP9 | J05070 | Metalloproteinase | – | 4·4 | – |
| MMP11 | X57766 | Metalloproteinase | – | – | 4·4 |
| TPM4 | X05276 | Actin binding protein | – | 5·5 | 3 |
| SNL | U03057 | Actin binding/ruffling | – | 7 | – |
| TMSB4X | M17733 | Actin polymerization inhibitor | – | – | −6 |
| PP2A | J02902 | Phosphatase | 3 | 3 | – |
| AP2M1 | D63475 | Vacuolar acidification | – | −4 | −4 |
| CTSD | M11233 | Lysosomal protease | – | – | −10 |
| FTL | M11147 | Iron regulation | – | 4 | – |
| NDUFA4 | U94586 | Oxidoreductase | −6 | −31 | −7 |
| PPIL2 | U37220 | Peptidylproyl isomerase | −4 | −5·8 | – |
| T1A-2 | AJ225022 | Injury marker | – | 7 | 3 |
| C3 | K02765 | Complement | – | 5·6 | – |
| POR | S90469 | Metabolism of FA/steroids | 2·5 | 3·8 | – |
Table 3.
Genes differentially expressed in U937 cells after infection with Mycobacterium avium
| Fold induction at time point (h) | |||||
|---|---|---|---|---|---|
| Gene | GenBank ID | Classification | 4 | 12 | 24 |
| ERBB3 | M29366 | Tyrosine kinase | 3 | 6·7 | 4·8 |
| EPHA3 | M83941 | Tyrosine kinase | – | 23 | 52 |
| PTPN7 | D11327 | Tyrosine phosphatase | 4 | 3·3 | – |
| LAT | AF036905 | Signal transduction | – | 3·5 | – |
| CSF1 | M37435 | Signal molecule | 4·6 | 3 | – |
| ID2 | M97796 | Transcription factor | – | −4 | −3·8 |
| NFKB | X61498 | Transcription factor | – | 7·7 | 3·2 |
| ISGF3G | M87503 | Transcription factor | – | – | −3·2 |
| JUN | J04111 | Transcription factor | – | 4 | – |
| SPI1 | X52056 | Transcription factor | 7·8 | 4·6 | – |
| SPN | J04536 | Intracellular signalling | – | −3 | −3·4 |
| ARHGDIA | X69550 | G protein dissociation inhibitor | – | 4·2 | – |
| GNB1 | M36430 | G protein | – | 3·5 | 10·9 |
| GNB2L1 | M24194 | G protein | 3·1 | 4·5 | 2·9 |
| FGF11 | U66199 | Growth factor | 3·4 | 3·7 | – |
| ITGA5 | X06256 | Adhesion | – | 5·6 | – |
| ITGAL | Y00796 | Adhesion/integrin | – | 15 | 3 |
| ICAM1 | J03132 | Adhesion/signal transduction | – | – | 3·7 |
| BCL2L1 | Z23115 | Apoptosis | – | −19 | – |
| IEX1L | AF039067 | Apoptosis | – | 5·9 | 3·1 |
| CASP10 | U60519 | Apoptosis | – | 6·1 | – |
| RPS19 | M81757 | Ribosomal protein/apoptosis | – | 4 | – |
| Neurolukin | K03515 | Lymphokine | – | 3·5 | – |
| SCYA1(I309) M57502 | Cytokine | 2·8 | 3·7 | 32 | |
| TNFA | X01394 | Cytokine | – | 5·2 | 3·8 |
| RANTES | M21121 | Cytokine | – | 4·7 | 3 |
| GROB(MIP2) | X53799 | Cytokine | – | 2·7 | 8·7 |
| IL1B | K02770 | Cytokine | – | 3 | 3·8 |
| IL8 | Y00787 | Chemokine | – | – | 4 |
| IL2RG | D11086 | Cytokine receptor | – | 4·3 | – |
| IL2RA | X01057 | Cytokine receptor | – | 4·8 | 3 |
| TNFRSF1B | M32315 | Cytokine receptor | – | 3 | 6·8 |
| CDKN1A | U09579 | Kinase inhibitor/cell cycle | – | 4·1 | – |
| TMP1 | X03124 | Metalloproteinase inhibitor | – | 4·9 | 2·3 |
| MMP9 | J05070 | Metalloproteinase | – | 5 | – |
| MMP11 | X57766 | Metalloproteinase | – | 9·3 | – |
| CAPN4 | X04106 | Protease | – | 3·7 | – |
| PI | X02920 | Protease inhibitor | – | – | 3·4 |
| TMSB4X | M17733 | Actin polymerization inhibitor | – | −4·5 | – |
| AZU1 | X58794 | Chemotaxis/antimicrobial | 4·2 | 4 | – |
| AP2M1 | D63475 | Lysosome acidification | – | −3 | −3 |
| CTSD | M11233 | Lysosomal protease | – | – | −3·4 |
| MT1H | X64177 | Metal binding protein | 3·7 | 2·7 | 3·3 |
| DTR | M60278 | EGF receptor | – | – | 6·8 |
Table 4.
Genes differentially expressed in U937 cells after infection with Mycobacterium smegmatis
| Fold induction at time point (h) | |||||
|---|---|---|---|---|---|
| Gene | GenBank ID | Classification | 4 | 12 | 24 |
| CDKN1A | U09579 | Kinase inhibitor/cell cycle | 3·6 | 3·4 | – |
| ERBB3 | M29366 | Tyrosine kinase receptor | – | – | 4 |
| BRF1 | X79067 | Transcription factor | – | – | 5 |
| NSEP1 | M83234 | Transcription factor | – | – | 4 |
| JUN | J04111 | Transcriptional regulator | 3 | 5·9 | 3·7 |
| GNB1 | M36430 | G protein | – | 3 | 12·5 |
| GNB2L1 | M24194 | G protein | – | 3·4 | – |
| FGF11 | U66199 | Growth factor | 2·5 | 3·1 | 5 |
| GRN | M75161 | Growth factor | – | 3·1 | – |
| PGF | X54936 | Growth factor | – | – | 4·4 |
| NDUFB7 | M33374 | Adhesion | – | 5·2 | – |
| ICAM1 | J03132 | Adhesion | – | 3 | 5·2 |
| IEX-L1 | AF039067 | Apoptosis | 3 | 4 | – |
| LIF | X13967 | Cytokine | – | 5·9 | 3 |
| RANTES | M21121 | Cytokine | – | 4·5 | 3 |
| GROB(MIP2) | X53799 | Cytokine | 3·5 | 4·5 | 16·8 |
| IL1B | K02770 | Cytokine | – | 3 | 3·7 |
| TNFA | X01394 | Cytokine | 4 | 8 | 5·8 |
| IL8 | Y00787 | Cytokine | – | 3 | 8·3 |
| SPP1 | X13694 | Cytokine | – | – | 4·5 |
| IL2RG | D11086 | Cytokine receptor | – | 3·2 | – |
| Neuroleukin | K03515 | Lymphokine | – | – | 3 |
| MMP1 | X05231 | Metalloprotease | – | – | 4 |
| MMP9 | J05070 | Metalloprotease | – | 3 | 4·5 |
| HSPA1A | M11717 | Chaperone | – | – | 9·5 |
| IQGAP1 | L33075 | rasGAP-like protein | – | −5·6 | – |
| CRHR1 | X72304 | Hormone receptor | −3 | −10·3 | −8 |
| FTH1 | M97164 | Iron storage | 3 | 4·7 | – |
| BTG1 | X61123 | Antiproliferative | – | 3·3 | 3·5 |
U937 cells infected with pathogenic or non-pathogenic mycobacteria showed some similarities in gene induction patterns (Table 5). Cells infected with pathogenic or non-pathogenic mycobacteria had similar expression patterns for several genes including: the cytokines IL1B, GROB, TNFA, RANTES, the growth factor FGF11, the metalloproteinase MMP9, the cytokine receptor IL2RG, the apoptotic gene IEX-L1 and the lymphokine neuroleukin. Some genes had similar expression patterns in U937 cells infected with M. avium or M. smegmatis but were different from those infected with M. tuberculosis, such as the signal transducer ICAM1, the G protein GNB1, the kinase inhibitor CDKN1A and the transcription factor JUN; it was also noted that most of these genes were expressed to a greater degree in M. smegmatis- than in M. avium-infected cells.
Table 5.
Macrophage genes differentially expressed after infection with pathogenic and non-pathogenic mycobacteria
| M. tuberculosis Fold induction at time point (h) | M. avium Fold induction at time point (h) | M. smegmatis Fold induction at time point (h) | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene | Gene Bank ID | Function | 4 | 12 | 24 | 4 | 12 | 24 | 4 | 12 | 24 |
| ERBB3 | M29366 | Signal transduction/adhesion | – | – | 3·5 | 3 | 6·7 | 4·8 | – | – | 4 |
| ICAM1 | J03132 | Signal transduction/adhesion | – | – | – | – | – | 3·7 | – | 3 | 5·2 |
| NDUFB7 | M33374 | Adhesion | – | −4 | – | – | – | – | – | 5·2 | – |
| IL1B | K02770 | Cytokine | – | 3·3 | 4 | – | 3 | 3·8 | – | 3 | 3·7 |
| GROB(MIP2) | X53799 | Cytokine | 3 | 5 | 3 | – | 2·7 | 8·7 | 3·5 | 4·5 | 16·8 |
| TNFA | X01394 | Cytokine | – | 3 | 2 | – | 5·2 | 3·8 | 4 | 8 | 5·8 |
| RANTES | M21121 | Cytokine | – | 6·8 | – | – | 4·7 | 3 | – | 4·5 | 3 |
| SSP1 | X13694 | Cytokine | 2 | 3 | – | – | – | – | – | – | 4·5 |
| IL2RG | D11086 | Cytokine receptor | – | 3 | – | – | 4·3 | – | – | 3·2 | – |
| IL8 | Y00787 | Chemokine | – | – | 3 | – | – | 4 | – | 3 | 8·3 |
| Neuroleukin | K03515 | Lymphokine | – | 4·1 | – | – | 3·5 | – | – | 5·9 | 3 |
| GNB2L1 | M24194 | G protein | 2·3 | 3 | – | – | 3·4 | – | 3·1 | 4·5 | 2·9 |
| GNB1 | M36430 | G protein | – | – | 4·4 | – | 3·5 | 10 | – | 3 | 12·5 |
| CDKN1A | U09579 | Kinase inhibitor/cell cycle | – | – | – | – | 4·1 | – | 3·6 | 3·4 | – |
| JUN | J04111 | Transcription factor | – | – | – | – | 4 | – | 3 | 5·9 | 3·7 |
| MMP9 | J05070 | Metalloproteinase | – | 4·4 | – | – | 5 | – | – | 5 | 4·5 |
| FGF11 | U66199 | Growth factor | 3 | 3 | 5 | 3·4 | 3·7 | – | 2·5 | 3·1 | 5 |
| IEX-L1 | AF039067 | Apoptosis | – | 4 | – | – | 5·9 | 3·1 | 3 | 4 | – |
U937 cells infected with pathogenic mycobacteria showed differences in gene expression compared to those infected with the non-pathogen M. smegmatis(Table 6). Cells infected with M. tuberculosis or M. avium had similar expression patterns for 18 genes, repressing seven and inducing 11. The repressed genes included those encoding the lysosomal protease CTSD, the lysosomal acidification-related protein AP2M1, the actin polymerase inhibitor TMSB4X, the apoptosis factor BCL2L1, the signal transducer SPN and the transcription factors ID2 and ISGF3G. Genes induced only in cells infected with pathogenic mycobacteria include those encoding the metalloproteinase MMP11, the cytokine SCYA1, the cytokine receptor IL2Ra, the apoptotic protease CASP10, the signal transducer LAT, the transcription factor NFKB, the integrins ITGA5 and ITGAL, the metalloproteinase inhibitor TIMP1 and the ribosomal protein RPS19.
Table 6.
Genes differentially expressed only in U937 cells infected with pathogenic mycobacteria
| M. tuberculosis Fold induction at time point (h) | M. avium Fold induction at time point (h) | |||||||
|---|---|---|---|---|---|---|---|---|
| Gene | GenBank ID | Function | 4 | 12 | 24 | 4 | 12 | 24 |
| CTSD | M11233 | Lysosomal protease | – | – | −10 | – | – | −3·4 |
| AP2M1 | D63475 | Lysosome acidification | – | −4 | −4 | – | −3 | −3 |
| MMP11 | X57766 | Metalloproteinase | – | – | 4·4 | – | 9·3 | – |
| TIMP1 | X03124 | Metalloproteinase inhibitor | – | 4·7 | – | – | 4·9 | 2·3 |
| SCYA1(I309) | M57502 | Cytokine | 3 | 8 | 12 | 2·8 | 3·7 | 32 |
| IL2Ra | X01057 | Cytokine receptor | – | 16 | 3·5 | – | 4·8 | 3 |
| CASP10 | U60519 | Apoptosis | – | 8·3 | 3·3 | – | 6·1 | – |
| BCL2L1 | X23115 | Apoptosis | – | −14 | – | – | −19 | – |
| RPS19 | M81757 | Apoptosis/ribosomal protein | – | 3 | 3 | – | 4 | – |
| TMSB4X | M17733 | Actin polymerase inhibitor | – | – | −6 | – | −4·5 | – |
| EPHA3 | M83941 | Tyrosine kinase | – | – | 49 | – | 23 | 52 |
| LAT | AF036905 | Signal transduction | – | 4·4 | 3 | – | 3·5 | – |
| SPN | J04536 | Intracellular signalling | – | – | −3 | – | −3 | −3·4 |
| NFKB | X61498 | Transcription factor | – | – | 3 | – | 7·7 | 3·2 |
| ID2 | M97796 | Transcription factor | – | – | −3 | – | −4 | −3·8 |
| ISGF3G | M87503 | Transcription factor | – | – | −3 | – | – | −3·2 |
| ITGA5 | X06256 | Adhesion | – | 3 | – | – | 5·6 | – |
| ITGAL | Y00796 | Adhesion/integrin | – | 19 | 3 | – | 15 | 3 |
U937 cells infected with the non-pathogen M. smegmatis also differentially regulated genes not observed in those infected with pathogenic mycobacteria (Table 7). Eleven genes were differentially expressed only in U937 cells infected with M. smegmatis: two were repressed and nine were induced. The two repressed genes encoded the hormone receptor CRHR1 and the rasGAP-like protein IQGAP1. The nine induced genes included those encoding the iron storage protein FTH1, the cytokine LIF, the antiproliferative BTG1, the transcription factors BRF1 and NSEP1, the metalloproteinase MMP1, the chaperone HSPA1A and the growth factors PGF and GRN. There were also unique genes differentially expressed in macrophages infected with M. tuberculosis or M. avium(Tables 8 and 9).
Table 7.
Genes differentially expressed only in U937 cells infected with M. smegmatis
| Fold induction at time point (h) | |||||
|---|---|---|---|---|---|
| Gene | GenBank ID | Function | 4 | 12 | 24 |
| FTH1 | M97164 | Iron storage | 3 | 4·7 | – |
| LIF | X13967 | Cytokine | – | 5·9 | 3 |
| BTG1 | X61123 | Antiproliferative | – | 3·3 | 3·5 |
| BRF1 | X79067 | Transcription factor | – | – | 5 |
| NSEP1 | M83234 | Transcription factor | – | – | 4 |
| CRHR1 | X72304 | Hormone receptor | −3 | −10·3 | −8 |
| MMP1 | X05231 | Metalloproteinase | – | – | −4 |
| HSPA1A | M11717 | Chaperone | – | – | 9·5 |
| PGF | X54936 | Growth factor | – | – | 4·4 |
| GRN | M75161 | Growth factor | – | – | 3·1 |
| IQGAP1 | L33075 | rasGAP-like protein | – | −5·6 | – |
Table 8.
Genes differentially expressed only in U937 cells infected with M. tuberculosis
| Fold induction at time point (h) | |||||
|---|---|---|---|---|---|
| Gene | GenBank ID | Function | 4 | 12 | 24 |
| NDUFB7 | M33374 | Adhesion | – | −4 | – |
| SCYA3(MIP1)M23452 | Chemokine | – | 3 | 3 | |
| TGFB2 | M19154 | Cytokine | – | – | 5 |
| OSM | M27288 | Cytokine | – | – | 4·5 |
| SSP1 | X13694 | Cytokine | 2 | 3 | – |
| C3 | K02765 | Complement | – | 5·6 | – |
| POR | S90469 | Metabolism of FA/steroids | 2·5 | 3·8 | – |
| ZNF136 | U09367 | Transcription factor | 2·5 | 17 | – |
| ID2 | M97796 | Transcription factor | – | – | −3 |
| BTEB1 | D31716 | Transcriptional regulator | −5 | −27 | – |
| IRF7 | U73036 | Transcriptional regulator | – | 4·6 | – |
| PP2A | J02902 | Phosphatase | 3 | 3 | – |
| PRKAR1B | M65066 | Protein kinase | – | – | 4·5 |
| VEGF | U01134 | Tyrosine kinase | – | – | −3 |
| CSNK2B | X16937 | Signal transduction | 4 | 4 | – |
| PLAUR | U08839 | Signal transduction/adhesion | – | 4·7 | – |
| FTL | M11147 | Iron regulation | – | 4 | – |
| MST1 | M74178 | Growth factor | – | 4·2 | 4·1 |
| NDUFA4 | U94586 | Oxidoreductase | −6 | −31 | −7 |
| PPIL2 | U37220 | Peptidylproyl isomerase | −4 | −5·8 | – |
| T1A-2 | AJ225022 | Injury marker | – | 7 | 3 |
| TPM4 | X05276 | Actin binding protein | – | 5·5 | 3 |
| SNL | U03057 | Actin binding/ruffling | – | 7 | – |
Table 9.
Genes differentially expressed only in U937 cells infected with M. avium
| Fold induction at time point (h) | |||||
|---|---|---|---|---|---|
| Gene | GenBank ID | Function | 4 | 12 | 24 |
| PTPN7 | D11327 | Tyrosine phosphatase | 4 | 3·3 | – |
| CSF1 | M37435 | Signal molecule | 4·6 | 3 | – |
| CAPN4 | X04106 | Protease | – | 3·7 | – |
| PI | X02920 | Protease inhibitor | – | – | 3·4 |
| ARHGDIA | X69550 | G protein dissociation inhibitor | – | 4·2 | – |
| SPI1 | X52056 | Transcription factor | 7·8 | 4·6 | – |
| DTR | M60278 | EGF receptor | – | – | 6·8 |
| TFRSF1B | M32315 | TNF receptor | – | 3 | 6·8 |
| ICAM1 | J03132 | Adhesion/signal transduction | – | – | 3·7 |
| AZU1 | X58794 | Chemotaxis/antimicrobial | 4·2 | 4 | – |
| MT1H | X64177 | Metal binding protein | 3·7 | 2·7 | 3·3 |
Confirmation of microarray data using real time RT-PCR
In order to verify the results obtained using the arrays, quantitative real time reverse transcriptase PCR was performed as described in Materials and methods using primers specific for each gene (Table 1) and an Icycler thermocycler (Bio-Rad, Hercules, CA, USA). We chose six genes with different expression levels in U937 cells infected with the various mycobacteria and one with a similar level of gene expression in U937 cells infected with pathogenic and non-pathogenic mycobacteria and compared the data with those obtained using the arrays (Table 10). Our results show that the levels of gene expression using both methods followed the same trends, but the exact level of expression was sometimes different. We also noted that the levels of gene expression as measured by the arrays tended to be higher than the levels of gene expression measured by RT-PCR experiments (Table 10). We have repeated the RT-PCR once more with five genes, and the results obtained agree with the previous results.
Table 10.
Comparison of gene induction levels as measured by real time RT-PCR and array data
| Fold induction at time point 12 h | ||||
|---|---|---|---|---|
| Gene | Infecting species | CT | (RT-PCR) | (array) |
| G3PDH | avium | 29 | 2 | – |
| tuberculosis | 30 | – | – | |
| smegmatis | 30 | – | – | |
| None | 30 | – | – | |
| CASP10 | avium | 35 | 4 | 6·1 |
| tuberculosis | 34 | 8 | 8·3 | |
| smegmatis | 37 | – | – | |
| None | 37 | – | – | |
| SCYA1 | avium | 22 | 4 | 3·7 |
| tuberculosis | 22 | 4 | 8 | |
| smegmatis | 24 | – | – | |
| None | 24 | – | – | |
| MMP9 | avium | 22 | 4 | 5 |
| tuberculosis | 22 | 4 | 4·4 | |
| smegmatis | 23 | 2 | 5 | |
| None | 24 | – | – | |
| ITGAL | avium | 27 | 16 | 19 |
| tuberculosis | 28 | 8 | 19 | |
| smegmatis | 31 | – | – | |
| None | 31 | – | – | |
| EPX | avium | 35 | – | – |
| tuberculosis | 35 | – | – | |
| smegmatis | 33 | 4 | 6·2 | |
| None | 35 | – | – | |
| EPHA3 | avium | 36 | 16 | 23 |
| tuberculosis | 36 | 16 | 22 | |
| smegmatis | 39 | 2 | – | |
| None | 40 | – | – |
DISCUSSION
The genus mycobacterium contains many species including the obligate pathogen M. tuberculosis, the facultative pathogen M. avium and the non-pathogen M. smegmatis. M. tuberculosis is by far the most aggressive member of this group and is estimated to infect one-third of the world's population [1]. M. avium, although a serious pathogen in people with immunological disorders such as AIDS [15] or pulmonary abnormalities [16], is significantly less aggressive than M. tuberculosis and M. smegmatis is non-pathogenic. Studies aimed at characterizing the host response to the pathogenic mycobacteria have given insights into the mechanisms used by these organisms to evade the host immune system [7,9,17–20]. However with the advent of high density oligonucleotide arrays it is now possible to characterize the expression of thousands of host genes in response to different types of pathogenic bacteria [21–24]. In the present study we characterized the expression of over 3500 genes in the human macrophage-like cell line U937 infected with pathogenic and non-pathogenic mycobacteria to determine how pathogenic mycobacteria are able to evade the host defence mechanisms encountered in macrophages. Although U937 cells differ in few aspects from primary human monocyte derived macrophages (MDM), they are infected by mycobacteria and the intracellular growth of mycobacteria are comparable to what is observed in MDM.
Many genes were differentially regulated in U937 cells infected with pathogenic and non-pathogenic mycobacteria (Table 5). The gene expression patterns are most dissimilar between the obligate pathogen M. tuberculosis and the non-pathogen M. smegmatis; and the facultative pathogen M. avium is in many instances in between. This point can be demonstrated most clearly in the case of NDUFB7, which is repressed in cells infected with M. tuberculosis, not differentially expressed in those infected with M. avium and induced in cells infected with M. smegmatis. We also observed that ICAM1 and JUN are only expressed in cells infected with M. avium or M. smegmatis but not in those infected with M. tuberculosis. To a lesser extent, GROB, RANTES, GMB1 and CDKN1A are expressed similarly in U937 cells infected with M. avium or M. smegmatis, but are different than those infected with M. tuberculosis. Similarly, the expression of IL8, Neuroleukin, BNB2L1 and MMP9 are expressed similarly in U937 cells infected with M. tuberculosis and M. avium but not in those infected with M. smegmatis. Overall the genomic expression patterns of U937 cells infected with M. avium is more similar to those infected with M. tuberculosis than M. smegmatis.
The differential expression of several genes is observed only in U937 cells infected with pathogenic mycobacteria (Table 6). Two such genes encode the apoptosis factors BCL2L1 and CASP10. Although conflicting reports as to the ability of pathogenic mycobacteria to induce apoptosis in monocytes and macrophages abound [25–28], we present evidence that apoptosis-related genes are expressed in a manner consistent with pathogenic mycobacterial induced apoptosis of U937 cells. First BCL2L1 is repressed in U937 cells infected with M. tuberculosis and M. avium by 14-fold and 19-fold, respectively, after 12 h. BCL2L1 is a membrane-bound protein that inhibits apoptosis in many different cell types and its repression is associated with the induction of apoptosis [29,30]. Secondly, CASP10 an apoptotic cysteine protease is induced in U937 cells infected with M. avium and M. tuberculosis. CASP10 is an initiator of the caspase cascade which induces apoptosis [31–33]. Further evidence of apoptosis can be seen by the induction of the ribosomal protein RPS19, which has been shown to be released as a dimer by apoptotic cells and is a potent chemo-attractant of monocytes [34,35]. Interestingly, recent data suggest that intracellular M. tuberculosis trigger anti-apoptotic mechanisms, antagonizing the host cell attempt to induce apoptosis [36]. Therefore, the data showing anti-apoptotic and apoptotic genes being up-regulated simultaneously supports what has been described in other systems.
In contrast to M. smegmatis, both M. avium and M. tuberculosis suppressed the expression of cathepsin D (CTSD) and AP2M1, a gene involved in lysosome acidification. This finding may correlate with the ability of virulent mycobacteria to inhibit phagosome–lysosome fusion [10,37]. Cathepsin D is present on the vacuole membrane containing virulent mycobacteria in a non-cleaved (inactive) form [38]. Our data indicate that in addition to interfering with the activation of cathepsin D in the golgi, infection with virulent mycobacteria also suppresses the de novo synthesis of this protein. Similar findings were observed in a recent publication, although in that study the authors did not compare virulent and avirulent mycobacteria on macrophage gene expression [24].
Macrophages infected with M. avium and M. tuberculosis down-regulate the expression of the transcription factors ID2 and ISGF3G. These transcription factors, inhibitor of DNA binding-2 protein and interferon-gamma (IFN-γ) responsive restriction factor, are involved in macrophage activation by cytokines. M. tuberculosis has been shown to interfere with the signal transduction cascade induced by the treatment of macrophages with IFN-γ[39], although the specific step associated with the inhibition has not been identified. Our results suggest a potential point in the IFN-γ-triggered macrophage response impacted by pathogenic mycobacteria. Macrophages infected with M. smegmatis induce the expression of two transcription factors, BRF1 and NSEP1, that are not induced by infection with M. avium or M. tuberculosis. These transcription factors regulate DNA synthesis. The fact that cells infected with virulent mycobacteria do not induce these genes suggests that the effect of infection by pathogenic mycobacteria is more systemic than thought previously. Macrophages infected with M. smegmatis also express LIF, which is not observed in macrophages infected with pathogenic mycobacteria. LIF is a cytokine that has been reported to activate macrophages; although no studies have investigated the effect of LIF on macrophages infected with pathogenic mycobacteria, its expression in macrophages infected with non-pathogenic mycobacteria suggests it plays a role in clearing non-pathogenic mycobacteria.
Tables 1 and 9 show genes that are expressed differentially only in macrophages infected with M. tuberculosis or M. avium. Among the genes that are induced only by M. tuberculosis infection is complement factor 3, which has been demonstrated in vitro to participate in the uptake of M. tuberculosis by macrophages [40]. The production of complement factor 3 by macrophages may be important for bacterial uptake in sites where there is no serum, such as the alveolar space. However, the role of complement on mycobacterial uptake by macrophages is currently unclear, as several studies have questioned the participation of complement and complement receptors in bacterial uptake in vivo[41,42].
A number of other genes were shown to be expressed either in M. avium- or M. tuberculosis-infected macrophages. To date, all the information present in the literature suggests that M. tuberculosis and M. avium have similar effects on macrophages. For example, both bacteria inhibit vacuole acidification, maturation and fusion with lysosomes [9,10]. However, our findings indicate that both infections have overlapping, as well as differential effects on macrophage gene regulation. These results are in agreement with recent observations on the intravacuolar concentration of elements in macrophages infected with either M. avium or M. tuberculosis[43]. This work has demonstrated that while macrophage response to infection with both mycobacteria is similar, there are differences which are of unknown importance.
In summary, by examining gene expression patterns in macrophages infected with virulent (M. avium and M. tuberculosis) or avirulent (M. smegmatis) mycobacteria, we have identified several macrophage genes expressed differentially during the infection process. The analysis of these genes offers new insights into the macrophage response following infection. Future studies will address some of these differences, with the potential to provide new details of the pathogenesis of these infections.
Acknowledgments
This work was funded by the University of California–Wide AIDS Research Program (UARP F01-CPMC-123 to J.A.M.) and The Public Health Service (AI-43199 to L.E.B.). We would like to thank Lia Danelishvili for assistance with the arrays, and Martin Wu for help with software applications.
References
- 1.Kochi A. The global tuberculosis situation and the new control strategy of the World Health Organization 1991. Bull WHO. 2001;79:71–5. [PMC free article] [PubMed] [Google Scholar]
- 2.Inderlied CB, Kemper CA, Bermudez LE. The Mycobacterium avium complex. Clin Microbiol Rev. 1993;6:266–310. doi: 10.1128/cmr.6.3.266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Falkinham JO., III Epidemiology of infection by nontuberculous mycobacteria. Clin Microbiol Rev. 1996;9:177–215. doi: 10.1128/cmr.9.2.177. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Ryan P, Bennett MW, Aarons S, et al. PCR detection of Mycobacterium paratuberculosis in Crohn's disease granulomas isolated by laser capture microdissection. Gut. 2002;51:665–70. doi: 10.1136/gut.51.5.665. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Sechi LA, Mura M, Tanda F, et al. Identification of Mycobacterium avium subsp. paratuberculosis in biopsy specimens from patients with Crohn's disease identified by in situ hybridization. J Clin Microbiol. 2001;39:4514–7. doi: 10.1128/JCM.39.12.4514-4517.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Aderem A, Underhill DM. Mechanisms of phagocytosis in macrophages. Annu Rev Immunol. 1999;17:593–623. doi: 10.1146/annurev.immunol.17.1.593. [DOI] [PubMed] [Google Scholar]
- 7.Armstrong JA, Hart PD. Phagosome–lysosome interactions in cultured macrophages infected with virulent tubercle bacilli. Reversal of the usual nonfusion pattern and observations on bacterial survival. J Exp Med. 1975;142:1–16. doi: 10.1084/jem.142.1.1. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Russell DG, Dant J, Sturgill-Koszycki S. Mycobacterium avium- and Mycobacterium tuberculosis-containing vacuoles are dynamic, fusion-competent vesicles that are accessible to glycosphingolipids from the host cell plasmalemma. J Immunol. 1996;156:4764–73. [PubMed] [Google Scholar]
- 9.Clemens DL, Horwitz MA. Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J Exp Med. 1995;181:257–70. doi: 10.1084/jem.181.1.257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Sturgill-Koszycki S, Schlesinger PH, Chakraborty P, et al. Lack of acidification in Mycobacterium phagosomes produced by exclusion of the vesicular proton-ATPase. Science. 1994;263:678–81. doi: 10.1126/science.8303277. [DOI] [PubMed] [Google Scholar]
- 11.Van Crevel R, Ottenhoff TMH, van der Meer JWM. Innate immunity to Mycobacterium tuberculosis. Clin Microbiol Rev. 2002;15:294–309. doi: 10.1128/CMR.15.2.294-309.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Bermudez LE, Parker A, Goodman JR. Growth within macrophages increases the efficiency of Mycobacterium avium in invading other macrophages by a complement receptor-independent pathway. Infect Immun. 1997;65:1916–25. doi: 10.1128/iai.65.5.1916-1925.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Sordet O, Rebe C, Plenchette S, et al. Specific involvement of caspases in the differentiation of monocytes into macrophages. Blood. 2002;100:4446–53. doi: 10.1182/blood-2002-06-1778. [DOI] [PubMed] [Google Scholar]
- 14.Bermudez LE, Petrofsky M, Kolonoski P, Young LS. An animal model of Mycobacterium avium complex disseminated infection after colonization of the intestinal tract. J Infect Dis. 1992;165:75–9. doi: 10.1093/infdis/165.1.75. [DOI] [PubMed] [Google Scholar]
- 15.Horsburgh CR, Jr, Metchock B, Gordon SM, Havlik JA, Jr, McGowan JE, Jr, Thompson SE., III Predictors of survival in patients with AIDS and disseminated Mycobacterium avium complex disease. J Infect Dis. 1994;170:573–7. doi: 10.1093/infdis/170.3.573. [DOI] [PubMed] [Google Scholar]
- 16.Martinez-Moragon E, Menendez R, Palasi P, Santos M, Lopez Aldeguer J. Environmental mycobacterial diseases in patients with and without HIV infection: epidemiology and clinical course. Arch Bronconeumol. 2001;37:281–6. doi: 10.1016/s0300-2896(01)75071-5. [DOI] [PubMed] [Google Scholar]
- 17.Azouaou N, Petrofsky M, Young LS, Bermudez LE. Mycobacterium avium infection in mice is associated with time-related expression of Th1 and Th2 CD4+ T-lymphocyte response. Immunology. 1997;91:414–20. doi: 10.1046/j.1365-2567.1997.00282.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Bermudez LE, Champsi J. Infection with Mycobacterium avium induces production of interleukin-10 (IL-10), and administration of anti-IL-10 antibody is associated with enhanced resistance to infection in mice. Infect Immun. 1993;61:3093–7. doi: 10.1128/iai.61.7.3093-3097.1993. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Bermudez LE, Parker A, Petrofsky M. Apoptosis of Mycobacterium avium-infected macrophages is mediated by both tumour necrosis factor (TNF) and Fas, and involves the activation of caspases. Clin Exp Immunol. 1999;116:94–9. doi: 10.1046/j.1365-2249.1999.00852.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Champsi J, Young LS, Bermudez LE. Production of TNF-alpha, IL-6 and TGF-beta, and expression of receptors for TNF-alpha and IL-6, during murine Mycobacterium avium infection. Immunology. 1995;84:549–54. [PMC free article] [PubMed] [Google Scholar]
- 21.Nau GJ, Richmond JF, Schlesinger A, Jennings EG, Lander ES, Young RA. Human macrophage activation programs induced by bacterial pathogens. Proc Natl Acad Sci USA. 2002;99:1503–8. doi: 10.1073/pnas.022649799. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Nakachi N, Matsunaga K, Klein TW, Friedman H, Yamamoto Y. Differential effects of virulent versus avirulent Legionella pneumophila on chemokine gene expression in murine alveolar macrophages determined by cDNA expression array technique. Infect Immun. 2000;68:6069–72. doi: 10.1128/iai.68.10.6069-6072.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Ragno S, Romano M, Howell S, Pappin DJ, Jenner PJ, Colston MJ. Changes in gene expression in macrophages infected with Mycobacterium tuberculosis: a combined transcriptomic and proteomic approach. Immunology. 2001;104:99–108. doi: 10.1046/j.0019-2805.2001.01274.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Greenwell-Wild T, Vazquez N, Sim D, et al. Mycobacterium avium infection and modulation of human macrophage gene expression. J Immunol. 2002;169:6286–97. doi: 10.4049/jimmunol.169.11.6286. [DOI] [PubMed] [Google Scholar]
- 25.Klingler K, Tchou-Wong KM, Brandli O, et al. Effects of mycobacteria on regulation of apoptosis in mononuclear phagocytes. Infect Immun. 1997;65:5272–8. doi: 10.1128/iai.65.12.5272-5278.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Keane J, Balcewicz-Sablinska MK, Remold HG, et al. Infection by Mycobacterium tuberculosis promotes human alveolar macrophage apoptosis. Infect Immun. 1997;65:298–304. doi: 10.1128/iai.65.1.298-304.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Durrbaum-Landmann I, Gercken J, Flad HD, Ernst M. Effect of in vitro infection of human monocytes with low numbers of Mycobacterium tuberculosis bacteria on monocyte apoptosis. Infect Immun. 1996;64:5384–9. doi: 10.1128/iai.64.12.5384-5389.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Riendeau CJ, Kornfeld H. THP-1 Cell apoptosis in response to mycobacterial infection. Infect Immun. 2003;71:254–9. doi: 10.1128/IAI.71.1.254-259.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Boise LH, Gonzalez-Garcia M, Postema CE, et al. bcl-x, a bcl-2-related gene that functions as a dominant regulator of apoptotic cell death. Cell. 1993;74:597–608. doi: 10.1016/0092-8674(93)90508-n. [DOI] [PubMed] [Google Scholar]
- 30.Cory S. Regulation of lymphocyte survival by the bcl-2 gene family. Annu Rev Immunol. 1995;13:513–43. doi: 10.1146/annurev.iy.13.040195.002501. [DOI] [PubMed] [Google Scholar]
- 31.Fernandes-Alnemri T, Armstrong RC, Krebs J, et al. In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains. Proc Natl Acad Sci USA. 1996;93:7464–9. doi: 10.1073/pnas.93.15.7464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Chang HY, Yang X. Proteases for cell suicide: functions and regulation of caspases. Microbiol Mol Biol Rev. 2000;64:821–46. doi: 10.1128/mmbr.64.4.821-846.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Kang JJ, Schaber MD, Srinivasula SM, et al. Cascades of mammalian caspase activation in the yeast Saccharomyces cerevisiae. J Biol Chem. 1999;274:3189–98. doi: 10.1074/jbc.274.5.3189. [DOI] [PubMed] [Google Scholar]
- 34.Horino K, Nishiura H, Ohsako T, et al. A monocyte chemotactic factor, S19 ribosomal protein dimer, in phagocytic clearance of apoptotic cells. Lab Invest. 1998;78:603–17. [PubMed] [Google Scholar]
- 35.Nishimura T, Horino K, Nishiura H, et al. Apoptotic cells of an epithelial cell line, AsPC-1, release monocyte chemotactic S19 ribosomal protein dimer. J Biochem (Tokyo) 2001;129:445–54. doi: 10.1093/oxfordjournals.jbchem.a002876. [DOI] [PubMed] [Google Scholar]
- 36.Danelishvili L, McGarvey J, Li YJ, Bermudez LE. Mycobacterium tuberculosis infection causes different levels of apoptosis and necrosis in human macrophages and alveolar epithelial cells. Cell Microbiol. 2003;5:649–60. doi: 10.1046/j.1462-5822.2003.00312.x. [DOI] [PubMed] [Google Scholar]
- 37.Crowle AJDR, Ross E, May MH. Evidence that vesicles containing live Mycobacterium tuberculosis and Mycobacterium avium in cultured macrophages are not acidic. Infect Immun. 1991;59:1823–31. doi: 10.1128/iai.59.5.1823-1831.1991. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Sturgill-Koszycki S, Schaible UE, Russell D. Mycobacterium-containing phagosomes are accessible to early endosomes and reflect a transitional state in normal phagosome biogenesis. EMBO J. 1996;15:6960–8. [PMC free article] [PubMed] [Google Scholar]
- 39.Ting LM, Kim AC, Cattamanchi A, Ernst JD. Mycobacterium tuberculosis inhibits IFN-gamma transcriptional responses without inhibiting activation of STAT1. J Immunol. 1999;163:3898–906. [PubMed] [Google Scholar]
- 40.Schlesinger LS, Horwitz MA. Phagocytosis of leprosy bacilli is mediated by complement receptors CR1 and CR3 on human monocytes and complement component C3 in serum. J Clin Invest. 1990;85:1304–14. doi: 10.1172/JCI114568. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41.Bermudez LE, Goodman J, Petrofsky M. Role of complement receptors in uptake of Mycobacterium avium by macrophages in vivo: evidence from studies using CD18-deficient mice. Infect Immun. 1999;67:4912–6. doi: 10.1128/iai.67.9.4912-4916.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 42.Hu C, Mayadas-Norton T, Tanaka K, Chan J, Salgame P. Mycobacterium tuberculosis infection in complement receptor 3-deficient mice. J Immunol. 2000;165:2596–602. doi: 10.4049/jimmunol.165.5.2596. [DOI] [PubMed] [Google Scholar]
- 43.Wagner D, Maser J, Lai B, Cai Z, Bermudez LE. ASM General Meeting. Los Angeles: 2000. Quantification of trace elements in the mycobacterial phagosome using novel hard X-ray microprobe. [Abstract] [Google Scholar]