Skip to main content
NCBI home page
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2006 Feb;143(2):249–259. doi: 10.1111/j.1365-2249.2005.03003.x

Oral administration of CpG-ODNs suppresses antigen-induced asthma in mice

K Kitagaki 1, T R Businga 1, J N Kline 1
PMCID: PMC1809575  PMID: 16412048

Abstract

Oligodeoxynucleotides containing CpG motifs (CpG-ODNs) can protect against eosinophilic airway inflammation in asthma. Previously we have found that parenteral or mucosal administration of CpG-ODNs is effective in preventing (as well as reversing established) disease. In this study, we examined the effect of oral CpG-ODNs on the development of immune tolerance. Using an ovalbumin (OVA)-induced murine model of asthma, we found that CpG-ODNs, administered orally around the time of sensitization, prevented eosinophilic airway inflammation in a dose-dependent manner. Although oral co-administration of CpG-ODNs with OVA (known to induce tolerance) did not significantly change the inhibition of OVA-induced airway eosinophilia, it did modulate OVA-specific immunoglobulin responses: oral administration of OVA alone suppressed OVA-specific IgG1 production, but only mice that received CpG-ODNs demonstrated enhanced levels of OVA-specific IgG2c. Finally, we examined whether oral administration of CpG-ODNs, alone or with OVA, could reverse established eosinophilic airway inflammation. Again, neither OVA nor CpG-ODNs alone modulated established eosinophilic airway inflammation, but a combination of the OVA and CpG-ODNs successfully desensitized the mice. This desensitization was associated with suppression of OVA-specific IgE and enhancement of OVA-specific IgG2c production. These findings provide the first indication that oral administration of CpG-ODNs is effective in preventing and reversing antigen-induced eosinophilic airway inflammation. CpG-ODNs may be useful as a component of oral immunotherapy to promote tolerance in established asthma.

Keywords: asthma, tolerance, oral, pathogen-associated molecular patterns

Introduction

We have previously demonstrated that systemic administration of oligodeoxynucleotides containing CpG motifs (CpG-ODNs) provides protection against eosinophilic airway inflammation in murine model of asthma in association with reduction of antigen-specific IgE [1]. A similar protective effect may be induced via airway administration [2,3], confirming the effectiveness of mucosal delivery of CpG-ODNs. However, neutrophilic airway inflammation can be induced by inhalation of CpG-containing DNA [4]; thus we examined whether enteral administration of CpG-ODNs may be an alternate route towards mucosal immunotherapy for atopic asthma.

In addition to preventing atopic responses, we and others have reported that CpG-ODNs can reverse established eosinophilic airway inflammation in association with reduction of antigen-specific IgE and IgG1, and induce tolerance in murine models of asthma [2,5,6]. Since optimal immune tolerance is induced by coadministration of CpG-ODNs and antigen, we suggest that CpG-ODNs may serve as an adjuvant for allergen immunotherapy. Immunotherapy against allergic diseases has been linked to immune deviation, resulting in suppression of antigen-induced Th2 immune responses; possibly acting through induction of antigen-specific regulatory T cells [7]. It is known that oral administration of antigen induces antigen-specific peripheral T cell tolerance in some autoimmune diseases [8] as well as in murine models of asthma [9–12]. However, the roles of CpG-ODNs in promoting oral tolerance have not been investigated. Therefore, in this study we also evaluated the effect of orally administered CpG-ODNs on the induction of oral tolerance in eosinophilic airway inflammation.

Materials and methods

Animals

Six-week old female C57BL/6 mice were obtained from Jackson Laboratories (Bar Harbor, ME). All animal care and housing requirements of the National Institutes of Health Committee on Care and Use of Laboratory Animals were followed. All protocols were reviewed and approved by the University of Iowa Animal Care and Use Committee.

Oligonucleotides

The CpG-ODNs (#1826) consisted of 20 bases on a phosphothioate backbone containing CpG motifs (TCCAT GACGTTCCTGACGTT). The control ODNs (Cont-ODNs) were identical, except that the CpG motifs were rearranged (TCCATGAGCTTCCTGAGTCT). The ODNs were produced under Good Manufacturing Practice conditions and had undetectable levels of lipopolysaccharide by the limulus amebocyte lysate assay; the ODNs were supplied by Coley Pharmaceutical Group (Wellesley, MA, USA).

Murine models of asthma and treatment with CpG-ODNs

Oral prevention

Mice were sensitized by intraperitoneal injection of 10 µg ovalbumin (OVA, Sigma, St. Louis, MO, USA) mixed with 1 mg of alum in a volume of 0·2 ml saline at days 0 and 7. Varying doses of CpG-ODNs or 1000 µg of Cont-ODNs were administered (by gastric gavage) on day −3, 0 and +7. The mice were challenged with inhaled OVA (1% solution, 30 min) on days 14 and 16, and sacrificed 48 h after the final exposure to OVA (day 18) (Fig. 1a).

Fig. 1.

Fig. 1

Open in a new tab

Murine models of asthma and treatment of CpG-ODNs. The effects of enterally administered CpG-ODNs and/or OVA were examined in the context of (a) prevention, (b) oral tolerance, and (c) immunotherapy of established atopic asthma.

Oral tolerance

The mice received, daily by gastric gavage, 20 mg OVA, 100 µg CpG-ODNs or mixture of 20 mg OVA and 100 µg CpG-ODNs from day −7 to −2; the mice were then sensitized to OVA (on days 0 and 7, by i.p. administration as described above), challenged with 1% OVA (days 14 and 16) and sacrificed (day 18) (Fig. 1b).

Oral immunotherapy

The mice were sensitized to (days 0 and 7) and challenged with 1% OVA (days 14 and 16), as described above, then subjected to a course of oral immunotherapy. Immunotherapy consisted of six weekly administrations, by gastric gavage, of: OVA (20 mg) in the presence or absence of CpG-ODNs (100 µg); saline; or CpG-ODNs (100 µg) alone. The mice were rechallenged with inhaled 1% OVA (days 56 and 58) at the completion of therapy prior to sacrifice (Fig. 1c).

General murine treatment

For some studies, bronchial hyperresponsiveness to inhaled methacholine was measured using whole-body plethysmography as previously described [1]; mice were placed into plethysmographs (Buxco Electronics, Inc., Troy, NY, USA). Airway resistance is expressed as Penh, and postmethacholine-inhalation measures are normalized to Penh following inhalation of saline. At the time of sacrifice, phlebotomy was performed by retro-orbital puncture under anaesthesia. Following euthanasia, the trachea of each mouse was cannulated and saline washings were collected; these lavages were processed for cell counts and differential analysis using Diff-Quik staining. Lungs of representative mice from each group were formalin-fixed, and sections were stained with H&E stain for examination by light microscopy.

In vitro assays

OVA-specific IgE, IgG1 and IgG2c in serum were measured by ELISA as previously reported [2,5]. Plates were coated with 100 µl/well of OVA (1 mg/ml) and placed at 4 °C overnight. After blocking the plates with 10% bovine serum containing PBS, 100 µl of diluted serum samples were applied by duplication. Then, 100 µl of biotinylated rat antimouse-IgE antibody (2 µg/ml, Clone: R35-72, BD Biosciences, San Diego, CA, USA) antimouse-IgG1 antibody (2 µg/ml, Clone: A85-1, BD Biosciences) and antimouse-IgG2c antibody (2 µg/ml, for detection of IgG2c in C57BL/6 mice, Clone; R19-15, BD Biosciences; This antibody recognizes an epitope in the CH3 domain of mouse IgG, with strong reactivity to the Igh-1a allotype and weaker reactivity to Igh-1b) were applied to each well as the detection antibodies. After application of 100 µl of avidin peroxidase (2·5 mg/ml, Sigma), the colour reaction was developed using 100 µl of TMB substrate (TMB Substrate Regent Set, BD Biosciences). The reaction was stopped by adding 50 µl/well of 1 N H2SO4. The data was expressed by OD readings at 450 nm. Based on our previous experience, the serum was diluted 1/25 for OVA-specific IgE, 1/2500 for IgG1 and 1/500 for IgG2c. When averages of OD readings were more than 2·5, additional dilutions of samples were used to confirm that the response was not on the assay's plateau. Cytokine responses were measured using commercially available ELISAs (R & D), according to the manufacturer's instructions.

Statistics

Statistical significance was evaluated using the program SPSS 11·0 for Windows. Student's T-test was employed for comparing the means of related samples. A P < 0·05 was considered significant.

Results

Effect of oral administration of CpG-ODNs on OVA-induced atopic responses

Inhalation of OVA induced prominent airway eosinophilia in OVA-sensitized C57BL/6 mice (Fig. 2a,b). Oral administration of CpG-ODNs around the time of sensitization (days −3, 0, and 7), at doses from 100 to 1000 µg, significantly prevented antigen-induced airway eosinophilia in a dose dependent manner (Fig. 2a). This inhibition was CpG motif-dependent since control ODNs did not exert any protective effects (Lung lavage eosinophils: saline-treated: 1·11 ± 0·33 × 106; 1000 µg Control ODNs: 0·93 ± 0·33 × 106, P = 0·34). Airway eosinophilia among the three groups of mice paralleled the development of peribronchial-/perivascular airway inflammation (Fig. 2b). Since CpG-ODNs have been reported to induce neutrophilic airway inflammation when administered directly into lung [4], we also assessed BAL neutrophilia. Although inhalation of OVA slightly increased the number of neutrophils in the airway, oral CpG-ODN up to 1000 µg did not affect airway neutrophilia (Fig. 2a).

Fig. 2.

Fig. 2

Open in a new tab

Oral administration of CpG-ODNs prevented OVA-induced airway eosinophilia in a dose-dependent manner. Mice were treated with oral CpG-ODNs prior to, at the time, and following sensitization to the experimental allergen, OVA. (a) Airway eosinophilia (▪) was suppressed by orally administered CpG-ODNs in a dose-dependent manner although airway neutrophilia (□) was not affected by any dose of CpG-ODNs. Each column indicates the mean and S.E.M. of 4–7 mice. *P < 0·05, **P < 0·01 versus saline treatment. (b) Representative sections (40 × magnification) from untreated control mice (Saline) and mice treated with CpG-ODN 1000 µg (CpG-ODNs) or Control ODNs 1000 µg (Cont-ODNs).

Assessment of bronchial hyperresponsiveness demonstrated a significant reduction in methacholine-induced bronchospasm in mice treated with 500 or 1000 µg of CpG-ODN, compared with untreated mice (Penh after 50 mg/ml methacholine as fold-increase over baseline Penh, Penh-50 ratio: Untreated: 4·7; 500 µg CpG-ODNs: 2·7; 1000 µg CpG-ODNs: 2·1, versus untreated each P < 0·05, n = 4/group).

As a measure of systemic immune responses, we measured serum cytokine levels in a subset of studied mice. We found that oral administration of CpG-ODN alone induced a Th1 response; though this did not quite reach statistical significance for IFN-γ (serum IFN-γ 8 h after a single administration: Saline: nd; CpG-ODN 10 µg: nd; CpG-ODN 100 µg: nd; CpG-ODN 500 µg: 1236 ± 623 pg/ml, P = 0·09 versus saline), IL-18 increases were significant (Saline: 72 ± 25 pg/ml; CpG-ODN 10 µg: 77 ± 24; CpG-ODN 100 mg: 100 ± 26; CpG-ODN 500 mg: 147 ± 19 pg/ml, P < 0·05 versus Saline).

We also evaluated immunoglobulin responses: (Th2-associated) OVA-specific IgE and IgG1, and (Th1-associated) IgG2c [13]. OVA-specific IgE production was significantly suppressed after treatment with the highest dose of oral CpG-ODNs (1000 µg, Fig. 3a); the reduction in OVA-specific IgG1 did not reach statistical significance (1000 µg CpG: P = 0·09, Fig. 3b). In addition, a significant enhancement of OVA-specific IgG2c was seen after treatment with high doses of oral CpG-ODNs (Fig. 3c).

Fig. 3.

Fig. 3

Open in a new tab

Oral administration of high dose of CpG-ODNs suppressed OVA-specific IgE (a) and enhanced OVA-specific IgG2c (b). OVA-specific IgG1 production was not modulated by oral administered CpG-ODNs. Each column indicates the mean and S.E.M. of 4–7 mice. *P < 0·05 versus saline treatment.

Effect of CpG-ODNs on oral tolerance

Recently, Mycobacterium vaccae, known to contain CpG-DNA, was shown to induce tolerance in a murine model of asthma [14], supporting a potential role for exposure to microbial products in promoting tolerance. It is well known that oral administration of high doses of antigen can also induce antigen-specific anergy or tolerance in models of allergy and asthma [9,10,12]. To explore whether the protective effects of CpG-ODNs and antigen, each administered orally, might interact in the induction of tolerance, we used a suboptimal dose of CpG-ODNs (100 µg) in concert with high dose OVA (20 mg). Untreated mice (Saline group) developed prominent airway eosinophilia after OVA sensitization and challenge (Fig. 4a), which was blocked by a tolerizing course of oral OVA (20 mg, daily for five days prior to sensitization); we found that CpG-ODNs, in an amount suboptimal for the prevention of eosinophilia, induced tolerance to a similar degree. When the two treatments were coadministered, airway eosinophilia was also suppressed. Because of the degree of protection offered by each treatment, any additive or synergistic effects would be masked. Airway neutrophilia was not induced by these treatments (Fig. 4a,b).

Fig. 4.

Fig. 4

Open in a new tab

(a) Tolerance induced by oral administration of OVA or CpG-ODNs before sensitization suppresses the subsequent development of airway eosinophilia (▪), and does not induce neutrophilia (□). Mice were sensitized to OVA (day 0 and 7) and challenged with inhaled OVA (days 14 and 16), then sacrificed (day 18). OVA (20 mg) or/and CpG-ODNs (100 µg) were orally administered once daily for five days (day −7 to −2). Each column indicates the mean and S.E.M. of 4 mice. *P < 0·05 versus saline treatment. (b) Representative sections (40 × magnification) from mice treated with saline (Saline), OVA 20 mg (OVA), CpG-ODNs 100 µg (CpG) and OVA plus CpG-ODNs (CpG + OVA).

Methacholine-induced bronchospasm in mice treated with OVA and/or with CpG-ODNs was reduced compared with untreated control mice (Penh-50 ratio: Untreated: 4·6; OVA: 2·7; CpG-ODNs: 2·6; OVA + CpG-ODNs: 2·0).

Interestingly, although oral administration of OVA (but not CpG-ODNs) nearly completely suppressed the induction of both OVA-specific IgE and IgG1 (Fig. 5a,b), neither OVA nor CpG-ODNs alone induced OVA-specific IgG2c (Fig. 5c). However, treatment with a combination of OVA and CpG-ODNs significantly induced OVA-specific IgG2c and suppressed OVA-specific IgG1 and IgE.

Fig. 5.

Fig. 5

Open in a new tab

Oral administration of high dose of OVA and CpG-ODNs suppressed OVA-specific IgE (A) and IgG1 (B) in a murine model of OVA-induced asthma. OVA-specific IgG2c (C) production was enhanced by coadministration of OVA and CpG-ODNs, but neither OVA nor CpG-ODNs alone. OVA (20 mg) or/and CpG-ODNs (100 µg) were orally administered once daily for five days (day −7 to −2) before sensitization. Serum was obtained at day 18. Each column indicates the mean and S.E.M. of 4 mice. *P < 0·05, **P < 0·01 versus saline treatment.

Effect of antigen-based oral immunotherapy and oral administration of CpG-ODNs on established atopic airway inflammation

In previous studies, we found that systemic administration of CpG-ODNs promotes successful allergen-specific immunotherapy in a murine model of asthma [5]. Oral allergen immunotherapy may have an advantage over traditional systemic immunotherapy in improving compliance, especially among children, and possibly in reduced adverse effects. Therefore, to evaluate the effect of CpG-ODNs on oral immunotherapy in the setting of established atopic asthma, we developed a protocol in which OVA-sensitized/challenged mice were treated with a six-week course of weekly OVA (20 mg) and/or CpG-ODNs (100 µg). We found that airway eosinophilia induced by rechallenge with inhaled OVA was modestly reduced by treatment with OVA or CpG-ODNs (Fig. 6a,b), but significantly reduced only by the combination. The combination treatment represented an additive effect in suppressing airway eosinophilia, and was significantly improved in comparison with CpG-ODNs alone (P < 0·05) and nearly so compared with OVA alone (P = 0·07). Oral immunotherapy with OVA and/or CpG-ODN did not affect OVA-induced airway neutrophilia (Fig. 6a,b).

Fig. 6.

Fig. 6

Open in a new tab

Allergen-based oral immunotherapy coadministered with CpG-ODNs reversed established allergen-induced airway eosinophilia. Immunotherapy of mice previously sensitized to and challenged with OVA consisted of six weekly oral administrations of OVA (20 mg) in the presence or absence of CpG-ODNs (100 µg), saline or CpG-ODN (100 µg) alone. The mice were rechallenged with nebulized OVA following the course of treatment. Each column indicates the mean and S.E.M. of 4 mice. *P < 0·05 versus saline treatment. (B) Representative sections (40 × magnification) from mice treated with saline (Saline), OVA 20 mg (OVA), CpG-ODN 100 µg (CpG) and OVA plus CpG-ODNs (OVA + CpG).

The mice that had received oral OVA and CpG-ODNs demonstrated significantly suppressed OVA-specific IgE, but not IgG1, compared with the untreated mice (Fig. 7a,b). Combination treatment significantly enhanced OVA-specific IgG2c production compared with un-treated mice, although the induction of OVA-specific IgG2c was relatively smaller (as was suppression of Th2-type immunoglobulins) in comparison with the prevention models (Fig. 7C).

Fig. 7.

Fig. 7

Open in a new tab

Allergen-based oral immunotherapy enhanced by oral administration of CpG-ODNs suppressed OVA-specific IgE (a), but not IgG1 production (b), and enhanced OVA-specific IgG2c (c). Mice were sensitized to OVA at day 0 and 7, and then challenged daily with inhaled OVA from day 14 and 16. Immunotherapy consisted of six weekly oral administration of OVA (20 mg) in the presence or absence of CpG-ODNs (100 µg), saline or CpG-ODNs (100 µg) alone. The mice were rechallenged with inhaled OVA daily from day 56–59. Serum was obtained at day 60. Each column indicates the mean and S.E.M. of 4 mice. *P < 0·05 versus saline treatment.

Discussion

In these studies, we found that oral administration of CpG-ODNs was effective, in a dose-dependent manner, in preventing the onset of eosinophilic airway inflammation in a murine model of atopic asthma. For the studies of oral tolerance and those of established airway inflammation, we chose to administer 100 µg of CpG-ODNs, a dose submaximal in our preventive experiments, and 20 mg of OVA, a concentration of OVA found effective in inducing oral tolerance in other studies [9–12]. As expected, high dose of antigen nearly completely suppressed antigen-induced eosinophilic airway inflammation. Oral CpG-ODNs promoted tolerance in conjunction with oral antigen; unlike antigen alone, CpG-ODNs also promoted a Th1-type (IgG2c) antigen-specific immunoglobulin response. In the setting of established eosinophilic airway inflammation, CpG-ODNs with antigen, but neither CpG-ODNs nor antigen alone, induced antigen-specific oral tolerance. CpG-ODNs did not induce neutrophilic airway inflammation in any of these oral administration settings. The suppressive effect of ODNs on asthmatic responses is CpG motif-specific since Control ODNs at a dose of 1000 µg did not have any similar effect.

We and others have previously reported that mucosal (intranasal and intratracheal) administration of CpG-ODNs can both prevent and reverse eosinophilic airway inflammation in murine models of asthma [3,15]. These current studies, however, are the first demonstration that CpG-ODNs can effectively modulate allergic airway inflammation following enteral administration. These findings are somewhat unexpected because the ODN were not specially formulated and are susceptible to rapid gastrointestinal degradation. However, McCluskie & Davis [16] reported that oral administration of CpG-ODNs had an adjuvant effect in enhancing IgG2c production against tetanus toxoid, hepatitis B surface antigen, and killed influenza, which encouraged us in this line of investigation.

In contrast to other routes of administration, oral CpG-ODNs were effective only at significantly greater doses. Although intraperitoneal administration of as little as 1 µg of CpG-ODNs results in a significant protective effect against atopic responses [17], 100–500 µg of oral CpG-ODNs were required for similar effects in this study. At those doses, however, both pulmonary and systemic (antigen-specific IgE and IgG2c) inflammatory responses were modulated. This was consistent with McCluskie & Davis’ finding that CpG-ODNs enhanced antigen-specific IgG2c production but not did not suppress IgG1 production [16].

The protective mechanism(s) of CpG-ODNs on eosinophilic airway inflammation remain unclear. CpG-ODNs can strongly induce Th1 responses [18], in part through the induction of T-bet expression [19]. As eosinophilic airway inflammation in asthma is driven by Th2 cells [20], and Th1 and Th2 responses are counter-regulatory [21,22], it has been speculated that Th1 cytokines like interferon γ (IFN-γ), interleukin 12 (IL-12) or IL-18 are critical for CpG-ODNs-induced suppression of atopic inflammation. Although some studies found that CpG-ODNs failed to inhibit eosinophilic airway inflammation in IFN-γ knockout (KO) mice [3], we have shown that CpG-ODNs remained effective in the absence of IFN-γ and IL-12; a moderately higher dose was required to achieve the same level of suppression as in mice with intact Th1 responses [17]. We also have found that both IL-10-dependent and IFN-γ/IL-12-dependent pathways play a role in the in vitro suppression of Th2 cytokines by CpG-ODNs [23].

Oral tolerance can be promoted in mice by oral administration of high doses of antigen; mice treated in this manner are then protected against subsequent sensitization and do not develop eosinophilic airway inflammation when challenged with inhaled antigen [9–12]. The concept of microbial products modulating the response to allergen encountered by the mucosal immune system is not new. Gerhold et al. [24] showed that inhalation exposure of infant mice to LPS enhanced OVA-specific IgG2c but did not suppress airway eosinophilia after OVA sensitization and challenge, whereas prior exposure to OVA or OVA plus LPS suppressed OVA-induced eosinophilia. In line with those studies, we speculated that CpG-ODNs might modulate the tolerogenic effects of mucosal (in this case oral) antigen administration.

Interestingly, both administration of CpG-ODNs and of high-dose OVA similarly tolerized the mice against sensitization; we did not detect any additive effect between these treatments. Oral administration of antigen suppressed Th2-related antigen-specific IgG1 production in parallel with suppressing airway eosinophilia, but did not modulate antigen-specific IgG2c. Although oral administration of CpG-ODNs alone modulated neither IgG1 nor IgG2c, coadministration of CpG-ODNs and antigen significantly suppressed antigen-specific IgG1 and enhanced antigen-specific IgG2c production. This divergence in regulation of antigen-specific immunoglobulin production suggests separate immunologic mechanisms for these effects.

The induction of oral tolerance subsequent to the establishment of allergic responses has not been well examined. Since we and others have shown that administration of CpG-ODNs with antigen, but not CpG-ODNs alone, can effectively tolerize previously sensitized mice [2,5,6], we also evaluated whether oral coadministration of antigen and CpG-ODNs could have similar effects. When oral OVA and CpG-ODNs were given for 6 weeks to mice with OVA-induced eosinophilic inflammation, airway eosinophilia and bronchial hyperresponsiveness were significantly reduced; oral administration of either OVA or CpG-ODNs alone was not effective. This data suggests that combination of antigen and CpG-ODNs are important in suppressing the eosinophilic airway inflammation in antigen-specific manner. Previously, others reposted that conjugated of antigen and CpG-ODNs were more effective in suppressing antigen-induced asthmatic responses than coadministration [25]. Other group reported that conjugate ratios of antigen and CpG-ODNs are important to achieve optimal effects [26]. Although our experiment focused on comparison with coadministration of antigen and CpG-ODNs to CpG-ODNs alone or antigen immunotherapy, it must be very important to compare between coadministration and conjugates. In contrast to reports that oral administration of antigen following inhalation challenge increased airway eosinophilia [12], we neither found enhancement nor suppression of established eosinophilic airway inflammation. Induction of mucosal (or oral) tolerance may represent a two-edged sword, with the risk of enhancing as well as suppressing immune responses, depending on timing of antigen exposure and other factors. Immunotherapy may function as a preventive vaccine (against future sensitizations) as well as a therapeutic intervention in patients with established allergic diseases. As individuals with established T-cell responses are more resistant to the induction of tolerance than naïve subjects [27], our findings suggest that CpG-ODNs might be especially useful in promoting successful oral tolerance in established allergic disease.

Immunotherapy against allergic diseases has been speculatively linked to the shifting of pro-atopic antigen-specific Th2 responses to protective Th1 immune responses to a specific antigen [28], among other mechanisms. Oral immunotherapy with CpG-ODNs enhanced antigen-specific IgG2c production, demonstrating that CpG-ODNs can promote a shift of antigen-specific immune response from Th2 to Th1 type. But induction of IgG2c by CpG-ODNs-based oral immunotherapy was relatively smaller than seen in other two models. We did not find the reason in this study but it might be depend on the different models we used. Although it has been clearly demonstrated that Th1 cytokines like IFN-γ and IL-12 prevent allergic inflammation in murine model of asthma [29,30], recent reports also suggested that induction of antigen-specific Th1 responses might worsen asthma symptoms [31,32]. In addition, we previously reported suppression of Th2 responses by CpG-ODNs that is independent of Th1 cytokines [17,23]. An alternate explanation for the efficacy of immunotherapy is the induction of regulatory cells, such as CD4+CD25+ T-cells, whose effects may require IL-10, TGF-β, or other mediators [9–12]. In this study, we did not find an increase of TGF-β or of IL-10 in lung lavage fluid after oral immunotherapy (data not shown). However, CpG-ODNs might induce antigen-specific regulatory T cells as does Mycobacterium vaccae [14]; these cells are highly potent, and influence inflammation by modulating their microenvironment, and their mediators may not be detectable systemically. Other studies in our laboratory indicate that systemic administration of CpG-ODNs during sensitization induces antigen-specific IL-10-producing T cells (data not shown), which may represent regulatory T-cells. Further studies are necessary to clarify these effects.

A double-blind, placebo-controlled study has demonstrated the safety and efficacy of oral specific immunotherapy in atopic children allergic to Dermatophagoides [33]. This proof-of-principal study suggests that induction of successful oral tolerance is a feasible approach for the control of allergic diseases including asthma. Our findings in this study provide the first indication that successful oral tolerance, even in the setting of established eosinophilic airway inflammation, may be enhanced by oral administration of CpG-ODNs. Clinical studies to identify the effects of enhancing tolerance with oral immunotherapy should consider the benefit of utilizing an immunostimulatory adjunct such as CpG-ODNs. The reportedly increased potency of conjugated, as opposed to coadministered, CpG-ODN and allergen [15] suggest this as a possible route for clinically effective treatment.

References

  • 1.Kline JN, Waldschmidt TJ, Businga TR, Lemish JE, Weinstock JV, Thorne PS, Krieg AM. Modulation of airway inflammation by CpG oligodeoxynucleotides in a murine model of asthma. J Immunol. 1998;160:2555–9. [PubMed] [Google Scholar]
  • 2.Jain VV, Businga TR, Kitagaki K, George CL, O'Shaughnessy PT, Kline JN. Mucosal immunotherapy with CpG oligodeoxynucleotides reverses a murine model of chronic asthma induced by repeated antigen exposure. Am J Physiol Lung Cell Mol Physiol. 2003;285:L1137–46. doi: 10.1152/ajplung.00073.2003. [DOI] [PubMed] [Google Scholar]
  • 3.Sur S, Wild JS, Choudhury BK, Sur N, Alam R, Klinman DM. Long term prevention of allergic lung inflammation in a mouse model of asthma by CpG oligodeoxynucleotides. J Immunol. 1999;162:6284–93. [PubMed] [Google Scholar]
  • 4.Schwartz DA, Quinn TJ, Thorne PS, Sayeed S, Yi AK, Krieg AM. CpG motifs in bacterial DNA cause inflammation in the lower respiratory tract. J Clin Invest. 1997;100:68–73. doi: 10.1172/JCI119523. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Kline JN, Kitagaki K, Businga TR, Jain VV. Treatment of established asthma in a murine model using CpG oligodeoxynucleotides. Am J Physiol Lung Cell Mol Physiol. 2002;283:L170–9. doi: 10.1152/ajplung.00402.2001. [DOI] [PubMed] [Google Scholar]
  • 6.Santeliz JV, Nest GV, Traquina P, Larsen E, Wills-Karp M. Amb a 1-linked CpG oligodeoxynucleotides reverse established airway hyperresponsiveness in a murine model of asthma. J Allergy Clin Immunol. 2002;109:455–62. doi: 10.1067/mai.2002.122156. [DOI] [PubMed] [Google Scholar]
  • 7.Wohlleben G, Erb KJ. Atopic disorders: a vaccine around the corner? Trends Immunol. 2001;22:618–26. doi: 10.1016/s1471-4906(01)02055-5. [DOI] [PubMed] [Google Scholar]
  • 8.Weiner HL, Friedman A, Miller A, et al. Oral tolerance: immunologic mechanisms and treatment of animal and human organ-specific autoimmune diseases by oral administration of autoantigens. Annu Rev Immunol. 1994;12:809–37. doi: 10.1146/annurev.iy.12.040194.004113. [DOI] [PubMed] [Google Scholar]
  • 9.Haneda K, Sano K, Tamura G, Sato T, Habu S, Shirato K. TGF-beta induced by oral tolerance ameliorates experimental tracheal eosinophilia. J Immunol. 1997;159:4484–90. [PubMed] [Google Scholar]
  • 10.Russo M, Jancar S. Pereira de Siqueira AL, Mengel J, Gomes E, Ficker SM, Caetano de Faria AM. Prevention of lung eosinophilic inflammation by oral tolerance. Immunol Lett. 1998;61:15–23. doi: 10.1016/s0165-2478(97)00155-7. [DOI] [PubMed] [Google Scholar]
  • 11.Nakao A, Kasai M, Kumano K, Nakajima H, Kurasawa K, Iwamoto I. High-dose oral tolerance prevents antigen-induced eosinophil recruitment into the mouse airways. Int Immunol. 1998;10:387–94. doi: 10.1093/intimm/10.4.387. [DOI] [PubMed] [Google Scholar]
  • 12.Russo M, Nahori MA, Lefort J, et al. Suppression of asthma-like responses in different mouse strains by oral tolerance. Am J Respir Cell Mol Biol. 2001;24:518–26. doi: 10.1165/ajrcmb.24.5.4320. [DOI] [PubMed] [Google Scholar]
  • 13.Karachunski PI, Ostlie NS, Monfardini C, Conti-Fine BM. Absence of IFN-gamma or IL-12 has different effects on experimental myasthenia gravis in C57BL/6 mice. J Immunol. 2000;164:5236–44. doi: 10.4049/jimmunol.164.10.5236. [DOI] [PubMed] [Google Scholar]
  • 14.Zuany-Amorim C, Sawicka E, Manlius C, et al. Suppression of airway eosinophilia by killed Mycobacterium vaccae-induced allergen-specific regulatory T-cells. Nat Med. 2002;8:625–9. doi: 10.1038/nm0602-625. [DOI] [PubMed] [Google Scholar]
  • 15.Broide D, Schwarze J, Tighe H, et al. Immunostimulatory DNA sequences inhibit IL-5, eosinophilic inflammation, and airway hyperresponsiveness in mice. J Immunol. 1998;161:7054–62. [PubMed] [Google Scholar]
  • 16.McCluskie MJ, Davis HL. Oral, intrarectal and intranasal immunizations using CpG and non-CpG oligodeoxynucleotides as adjuvants. Vaccine. 2000;19:413–22. doi: 10.1016/s0264-410x(00)00208-5. [DOI] [PubMed] [Google Scholar]
  • 17.Kline JN, Krieg AM, Waldschmidt TJ, Ballas ZK, Jain V, Businga TR. CpG oligodeoxynucleotides do not require TH1 cytokines to prevent eosinophilic airway inflammation in a murine model of asthma. J Allergy Clin Immunol. 1999;104:1258–64. doi: 10.1016/s0091-6749(99)70022-9. [DOI] [PubMed] [Google Scholar]
  • 18.Heeg K, Zimmermann S. CpG DNA as a Th1 trigger. Int Arch Allergy Immunol. 2000;121:87–97. doi: 10.1159/000024303. [DOI] [PubMed] [Google Scholar]
  • 19.Liu N, Ohnishi N, Ni L, Akira S, Bacon KB. CpG directly induces T-bet expression and inhibits IgG1 and IgE switching in B cells. Nat Immunol. 2003;4:687–93. doi: 10.1038/ni941. [DOI] [PubMed] [Google Scholar]
  • 20.Kay AB. TH2-type cytokines in asthma. Ann NY Acad Sci. 1996;796:1–8. doi: 10.1111/j.1749-6632.1996.tb32561.x. [DOI] [PubMed] [Google Scholar]
  • 21.Parronchi P, De Carli M, Manetti R, et al. IL-4 and IFN (alpha and gamma) exert opposite regulatory effects on the development of cytolytic potential by Th1 or Th2 human T cell clones. J Immunol. 1992;149:2977–83. [PubMed] [Google Scholar]
  • 22.Swain SL, Weinberg AD, English M, Huston G. IL-4 directs the development of Th2-like helper effectors. J Immunol. 1990;145:3796–806. [PubMed] [Google Scholar]
  • 23.Kitagaki K, Jain VV, Businga TR, Hussain I, Kline JN. Immunomodulatory Effects of CpG Oligodeoxynucleotides on Established Th2 Responses. Clin Diagn Laboratory Immunol. 2002;9:1260–9. doi: 10.1128/CDLI.9.6.1260-1269.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Gerhold K, Bluemchen K, Franke A, Stock P, Hamelmann E. Exposure to endotoxin and allergen in early life and its effect on allergen sensitization in mice. J Allergy Clin Immunol. 2003;112:389–96. doi: 10.1067/mai.2003.1646. [DOI] [PubMed] [Google Scholar]
  • 25.Shirota H, Sano K, Kikuchi T, Tamura G, Shirato K. Regulation of murine airway eosinophilia and Th2 cells by antigen-conjugated CpG oligodeoxynucleotides as a novel antigen-specific immunomodulator. J Immunol. 2000;164:5575–82. doi: 10.4049/jimmunol.164.11.5575. [DOI] [PubMed] [Google Scholar]
  • 26.Horner AA, Takabayashi K, Beck L, et al. Optimized conjugation ratios lead to allergen immunostimulatory oligodeoxynucleotide conjugates with retained immunogenicity and minimal anaphylactogenicity. J Allergy Clin Immunol. 2002;110:413–20. doi: 10.1067/mai.2002.126660. [DOI] [PubMed] [Google Scholar]
  • 27.Leishman AJ, Garside P, Mowat AM. Induction of oral tolerance in the primed immune system: influence of antigen persistence and adjuvant form. Cell Immunol. 2000;202:71–8. doi: 10.1006/cimm.2000.1665. [DOI] [PubMed] [Google Scholar]
  • 28.Frew AJ. Immunotherapy of allergic disease. J Allergy Clin Immunol. 2003;111:S712–9. doi: 10.1067/mai.2003.84. [DOI] [PubMed] [Google Scholar]
  • 29.Nakajima H, Iwamoto I, Yoshida S. Aerosolized recombinant interferon-gamma prevents antigen-induced eosinophil recruitment in mouse trachea. Am Rev Respir Dis. 1993;148:1102–4. doi: 10.1164/ajrccm/148.4_Pt_1.1102. [DOI] [PubMed] [Google Scholar]
  • 30.Gavett SH, O'Hearn DJ, Li X, Huang SK, Finkelman FD, Wills-Karp M. Interleukin 12 inhibits antigen-induced airway hyperresponsiveness, inflammation, and Th2 cytokine expression in mice. J Exp Med. 1995;182:1527–36. doi: 10.1084/jem.182.5.1527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Hansen G, Berry G, DeKruyff RH, Umetsu DT. Allergen-specific Th1 cells fail to counterbalance Th2 cell-induced airway hyperreactivity but cause severe airway inflammation. J Clin Invest. 1999;103:175–83. doi: 10.1172/JCI5155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Randolph DA, Carruthers CJ, Szabo SJ, Murphy KM, Chaplin DD. Modulation of airway inflammation by passive transfer of allergen-specific Th1 and Th2 cells in a mouse model of asthma. J Immunol. 1999;162:2375–83. [PubMed] [Google Scholar]
  • 33.Giovane AL, Bardare M, Passalacqua G, Ruffoni S, Scordamaglia A, Ghezzi E, Canonica GW. A three-year double-blind placebo-controlled study with specific oral immunotherapy to Dermatophagoides: evidence of safety and efficacy in paediatric patients. Clin Exp Allergy. 1994;24:53–9. doi: 10.1111/j.1365-2222.1994.tb00917.x. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES