Abstract
The introduction of the conjugate seven-valent pneumococcal vaccine has led to the replacement of vaccine serotypes with nonvaccine serotypes of Streptococcus pneumoniae. This observation implies that intraspecies competition between pneumococci occurs during nasopharyngeal colonization, allowing one strain or set of strains to predominate over others. We investigated the contribution of the blp locus, encoding putative bacteriocins and cognate immunity peptides, to intraspecies competition. We sequenced the relevant regions of the blp locus of a type 6A strain able to inhibit the growth of the type 4 strain, TIGR4, in vitro. Using deletional analysis, we confirmed that inhibitory activity is regulated by the function of the response regulator, BlpR, and requires the two putative bacteriocin genes blpM and blpN. Comparison of the TIGR4 BlpM and -N amino acid sequences demonstrated that only five amino acid differences were sufficient to target the heterologous strain. Analysis of a number of clinical isolates suggested that the BlpMN bacteriocins divide into two families. A mutant in the blpMN operon created in the clinically relevant type 19A background was deficient in both bacteriocin activity and immunity. This strain was unable to compete with both its parent strain and a serotype 4 isolate during cocolonization in the mouse nasopharynx, suggesting that the locus is functional in vivo and confirming its role in promoting intraspecies competition.
Streptococcus pneumoniae colonizes a majority of children by 1 year of age. Colonization with a single strain can last for weeks to months but is eventually cleared. Serial culturing of samples from the nasopharynxes of children has demonstrated that the population of pneumococci is constantly in flux, with one strain replacing another over time (1, 2, 5, 12). In addition, some children appear to be colonized with two or more pneumococcal strains at any given time (7, 20). The recent introduction of the seven-valent conjugate pneumococcal vaccine to the standard infant vaccination schedule has dramatically reduced the incidence of both colonization and invasive disease caused by the pneumococcus (24). Because the vaccine contains only 7 of the >90 serotypes of pneumococci, there have been concerns that some of the remaining serotypes may fill the void left by the vaccine-targeted organisms. Over the intervening years since its release, reports have suggested that serotype replacement may be occurring at the levels of both colonization and disease (6, 9, 13). For example, the incidence of the previously uncommon nonvaccine serotype 19A has increased significantly in the postvaccine era as a cause of invasive pneumococcal disease in children of less than 5 years of age (17). Whether infections with these formerly infrequent serotypes will eventually result in a similar disease spectrum with respect to numbers and severity has yet to be determined. The fact that serotype replacement has occurred suggests that competition between the predominant vaccine strains and the replacement strains was occurring at some level prior to vaccination of the population. Understanding the dynamics that occur between distinct strains of pneumococci within the polymicrobial environment of the human nasopharynx may help to better predict the outcome of vaccination. These interactions are likely to include bacterial factors that allow one strain to gain a foothold in the competitive environment of the nasopharynx.
Bacteriocins are small antimicrobial peptides produced by many bacterial species that have been implicated in intra- and interspecies competition. Bacteriocins typically target organisms that are either closely related to or within the same species as the producer bacteria (4). Producer bacteria are protected from the effects of their own bacteriocins via production of a specific immunity protein. This protein is typically cotranscribed with the genes encoding the bacteriocins. The blp locus of pneumococcus encodes a number of putative bacteriocin-like peptides (3, 19). Upstream of the bacteriocin genes, the locus contains open reading frames for a typical two-component regulatory system (blpR and blpH), a small peptide pheromone (blpC), and a dedicated ABC transporter (blpA and -B). The ABC transporter is thought to recognize the N termini of both the pheromone and the bacteriocins and to transport these peptides across the cytoplasmic membrane, concurrent with cleavage at a conserved double-glycine motif. Cleaved extracellular BlpC can then bind to the sensor kinase, BlpH. This interaction results in the activation of BlpR and upregulation of the entire gene cluster via binding to consensus sequences within each promoter. Transcriptional analysis of the locus in the two fully sequenced pneumococcal strains R6 and TIGR4 demonstrated that application of chemically synthesized BlpC resulted in upregulation of a number of operons only within the locus, including those encoding the regulatory proteins, transport apparatus, and putative bacteriocins (3). The transcript level of a downstream operon encoding BlpXY and -Z was also upregulated by the addition of BlpC. This operon encodes proteins proposed to be involved in immunity. Analysis of a number of pneumococcal strains demonstrated that there are at least four different pheromones produced and that each is specific for its cognate BlpR/H protein (3, 19).
In this study, we characterized the blp locus in a clinical isolate of pneumococcus that demonstrates an in vitro phenotype consistent with bacteriocin activity and further defined the importance of the locus in competition during model murine nasopharyngeal colonization. In addition, we sequenced the bacteriocin genes of a number of clinical isolates and determined which amino acids are important in dictating inhibition in vitro.
MATERIALS AND METHODS
Bacterial strains and growth conditions.
The S. pneumoniae strains used in this study are described in Table 1. An array of clinical strains were analyzed and considered unrelated based on differences in capsular type and time and location of isolation. All strains were grown in tryptic soy broth (TS) or on tryptic soy agar (TSA) supplemented with catalase (4,741 U/plate; Worthington, Lakewood, NJ), except where indicated. TSA was supplemented with streptomycin (100 μg/ml), kanamycin (500 μg/ml), or erythromycin (1 μg/ml) where indicated. Cultures were grown on agar plates at 37°C in 5% CO2 or anaerobically using a BBL gas pack system. Broth cultures were grown at 37°C without agitation. For transformation, bacteria were grown from plates at low inocula in C+Y (pH 8.0) (11a) at 37°C until the optical density at 620 nm reached 0.150. One-hundred-microliter aliquots were removed and placed at 30°C with 10 ng/ml of purified competence-stimulating peptides 1 and 2. After 10 min, approximately 100 pg/ml of DNA was added to the mixture and incubated at 30°C for an additional 40 min. The culture was then transferred to 37°C and incubated for 2 h before being plated on selective medium.
TABLE 1.
Bacterial strains used in this study
| Strain | Serotype | Characteristic or genotypea | Source or reference |
|---|---|---|---|
| P376 | 6A | Opaque variant of clinical isolate P303 | 10 |
| TIGR4 | 4 | Clinical isolate | 22 |
| P29 | 7F | Clinical isolate | R. Austrian |
| P32 | 19A | Clinical isolate | R. Austrian |
| P35 | 19F | Clinical isolate | R. Austrian |
| P56 | 12F | Clinical isolate | R. Austrian |
| P631 | 5 | Clinical isolate | R. Austrian |
| P1121 | 23F | Recovered from human colonization study | 15 |
| 6ASmr | 6A | 6A × D39Smr (backcrossed twice) | This study |
| 6AΔblpR | 6A | 6A × 0100993/486rr (23) (backcrossed three times); Emr | This study |
| 6AΔblpMNOjanus | 6A | 6ASmr × pBlpΔMNOjanus; selected for Knr Sms | This study |
| 6AΔblpMNO | 6A | 6AΔblpMNOjanus × pBlpAL cut with BstBI and NheI, with ends blunted and religated, removing blpMN and -O coding sequence; selected for Smr Kns | This study |
| 6AΔblpM | 6A | 6AΔblpMNOjanus × pBlpAL derivative containing an in-frame deletion of blpM; selected for Smr Kns | This study |
| 6AΔblpN | 6A | 6AΔblpMNOjanus × pBlpAL derivative containing an in-frame deletion of blpN; selected for Smr Kns | This study |
| 6AΔblpO | 6A | 6AΔblpMNOjanus × pBlpAL derivative containing a complete deletion of blpO; selected for Smr Kns | This study |
| 6AblpMNOWT | 6A | 6AΔblpMNOjanus × PCR product from type 6A strain using primers 1 and 11; selected for Smr Kns | This study |
| 6AblpMNOTIGR4 | 6A | 6AΔblpMNOjanus × pBlpAL derivative containing the chimeric form of blpMN (see Materials and Methods for details); selected for Smr Kns | This study |
| 19ASmr | 19A | 19A × D32Smr (backcrossed twice) | This study |
| 19AΔblpMNOjanus | 19A | 19ASmr × pBlpΔMNOjanus; selected for Knr Sms | This study |
| 19AΔblpMNO | 19A | 19AΔblpMNOjanus × pBlpAL cut with BstBI and NheI, with ends blunted and religated, removing blpMN and -O coding sequence; selected for Smr Kns | This study |
| 19AblpMNOWT | 19A | 19AΔblpMNOjanus × pBlpAL; selected for Smr Kns | This study |
Abbreviations: Kn, kanamycin; Sm, streptomycin; Em, erythromycin.
Bacteriocin assay.
Pneumococci grown on TSA plates overnight were resuspended in phosphate-buffered saline (PBS) to an optical density at 595 nm of 0.700. Test strains were then stabbed into TSA plates and allowed to grow anaerobically at 37°C for 6 h. Plates were carefully overlaid with 105 CFU/ml of a mid-log-phase broth-grown overlay strain in 7 ml of TS containing 0.5% agar which had been maintained at 37°C before application and returned to an anaerobic environment for overnight growth at 37°C. Test strains that scored positive for bacteriocin activity had a clear zone of complete inhibition of the overlay strain surrounding the area of test strain growth.
blp sequence analysis.
Primers 1 and 2 (Table 2) were used to PCR amplify and sequence the region of DNA likely to contain blpM and blpN based on sequence comparison. The blp locus from the type 6A strain was amplified using primers 14 and 15, which amplified a 6,600-bp fragment. An extension of the 3′ region of the locus, including the downstream gene SP0547, was amplified by primers 16 and 17. PCR was performed with Pfx high-fidelity polymerase (Invitrogen, Carlsbad, CA), using the following cycling parameters: 30 cycles of 95°C for 30 s, 52°C for 30 s, and 72°C for 1 min/kb. PCR products were purified and sequenced using a BigDye Terminator v3.1 cycle sequencing kit from Applied Biosystems. Sequencing products were analyzed on a 3730 DNA analyzer from Applied Biosystems.
TABLE 2.
Primers used in this study
| Primer | Sequence and description |
|---|---|
| 1 | TTCCTTTCATATAGTGGATAGGTC; 275 bp upstream of blpM ATG |
| 2 | CAGTTTACGGAACAAGTTTTAATAT; 40 bp upstream of blpO ATG |
| 3 | CCAATGCATTAACAAAAGGAGACTTGTATG; construction of blpM mutation, forward primer containing NsiI site separating start and stop codons of blpM |
| 4 | CCAATGCATAACAAATACTCCTTTTTTA; construction of blpM mutation, reverse primer containing NsiI site separating start and stop codons of blpM |
| 5 | CCAATGCATTAAAAATGAAAGCTAAATTTT; construction of blpN mutation, forward primer containing NsiI site separating start and stop codons of blpN |
| 6 | CCAATGCATACAAGTCTCCTTTTGTTA; construction of blpN mutation, reverse primer with NsiI site separating start and stop codons of blpN |
| 7 | TTAATTTACAGGGGAGTTTCTTT; forward primer 56 bp from 3′ end of blpO ORF |
| 8 | TGTCTTCGAAGGTGGTGGTGCTGCTTTTG; forward primer engineering BstBI site into TIGR4 blpM for construction of chimera |
| 9 | CCCTGTAAATTAAGCTAGCAAATAC; reverse primer for amplification of blpMNO from TIGR4 for construction of chimera |
| 10 | GAAGAGATTAGGGTTTTGTGCC; forward primer 35 bp upstream of stop codon of blpA |
| 11 | TCTCGCAAGGAAGATGTTCCG; reverse primer 22 bp upstream of stop codon of SP0535 |
| 12 | GGCCGCTTTCGAAGGATCCGTTTGATTTTTAATGGATAAT; forward primer for amplification of the janus cassette with engineered BstBI site |
| 13 | ACCTGCTAGCGGGCCCCTTTCCTTATGCTTTTGGAC; reverse primer for amplification of janus cassette with engineered NheI site |
| 14 | GTGAGCGACTTTATAGTTTCAATCC; forward primer for sequencing of type 6A blp locus 240 bp upstream of the stop codon of blpA |
| 15 | CTGAAAATGAGTTCCTCCTGG; reverse primer for sequencing of type 6A blp locus within SP0547 |
| 16 | CTGAAAATGAGTTCCTCCTGG; forward primer for sequencing of entire SP0547 locus 427 bp downstream of start codon of blpY |
| 17 | GCCTCTGGATTGGCTTGGGTATCA; reverse primer for sequencing of SPO547 within SP0548 |
Generation of defined blp mutants.
Pneumococcal mutants were created as follows. The blpMNO region was cloned into Escherichia coli plasmid pUC19 at the SmaI site, using primers 1 and 11. The resulting plasmid was designated pBlpAL. The janus insertion was created by amplifying the cassette from strain CP1296 (21) by PCR and engineering BstBI and NheI sites into the 5′ and 3′ regions, respectively (primers 12 and 13). This product was ligated into pBlpAL cut with BstBI and NheI at unique sites that span blpM through blpO. The resulting plasmid, called pBlpALΔMNOjanus, was transformed into 6ASmr and selected for kanamycin resistance and streptomycin sensitivity. This strain was named 6AΔMNOjanus. The remaining blpMNO mutants were constructed by replacing the janus cassette in this strain. The blpM and -N deletions were constructed by performing inverse PCR on pBlpAL, using primers 3 and 4 for the blpM deletion and primers 5 and 6 for the blpN deletion. These primers were engineered to create a unique NsiI site between the stop and start codons of the respective genes. The resulting PCR products were then cut with NsiI, ligated, and transformed into E. coli Top10 cells (Invitrogen, Carlsbad, CA). The blpO deletion was created by performing inverse PCR on pBlpAL, using primers 7 and 2. The resulting product was phosphorylated using T4 DNA kinase, blunt end ligated, and transformed into E. coli Top10 cells. The chimeric protein was created by amplification of DNA from TIGR4, using primers 8 and 9, which introduced a BstBI site at the 5′ end. This product was digested with BstBI and NheI and ligated to the 1,022-kb BstBI/NheI fragment of pBlpAL. All plasmids were verified by restriction digestion. The janus cassette was replaced in strain 6AΔMNOjanus by transforming the strain with the PCR product produced by primers 1 and 11 and selecting colonies on streptomycin plates. Deletion of the blpMN operon in the serotype 19A strain was performed by amplifying the janus cassette insertion in strain 6AΔMNOjanus, using primers 1 and 11, and transforming the product into a streptomycin-resistant derivative of 19A. An unmarked mutation deleting the entire blpMNO region was created in this strain as described above. The janus cassette in 19AΔMNOjanus was replaced with the wild-type locus by transforming cells with the plasmid pBlpAL. All constructs were verified for a double-crossover event by a loss of kanamycin resistance and by PCR. 6AΔblpR was created by isolating DNA from the type 3 isolate containing an erythromycin cassette, replacing the blpR gene (23), and transforming the construct into the type 6A strain. This mutation was backcrossed three times to reduce the possibility of transformation occurring with unlinked DNA.
Mouse colonization assay.
All mice were purchased from Taconic and were housed in accordance with Institutional Animal Care and Use Committee protocols. Five to 7-week-old BALB/c mice were inoculated intranasally with 10 μl containing 2 × 107 to 4 × 107 CFU of a recently animal-passaged pneumococcus strain resuspended in PBS. All suspensions were plated for colony counts following inoculation to ensure that no inhibition had occurred in suspension prior to intranasal instillation. At 4 days postinoculation, a time point shown in pilot studies to provide a stable level of colonization, the mice were sacrificed by CO2 asphyxiation, the trachea of each was exposed, 200 μl of sterile PBS was instilled into it, and the lavage fluid exiting the nares was collected. The lavage fluid was then serially diluted in PBS and plated on TSA. Plates were supplemented with neomycin (5 μg/ml) to prevent the growth of contaminants or with neomycin plus streptomycin to select for growth of the 19A derivatives. Results of antibiotic selection were verified using colony immunoblotting with a rabbit polyclonal antibody against capsular serotype 4 on neomycin-only plates. The lower limit of detection of this assay was 100 CFU/ml of lavage fluid.
Nucleotide sequence accession numbers.
The GenBank accession number for the type 6A blp locus is DQ323933. Accession numbers for the blpM and blpN genes from clinical isolates are as follows: 19F, ABD03964; 18C, ABD03966; 23F, ABD03970; 5, ABD03968; 7F, ABD03958; 12F, ABD03962; and 19A, ABD03960.
RESULTS
Bacteriocin-like activity in a clinical isolate of the pneumococcus.
In order to characterize the functional significance of the blp locus in pneumococci, we screened an array of clinical isolates (n = 9) for their relative abilities to inhibit growth of an unrelated strain in an agar overlay assay. In order to remove the inhibitory effects of pneumococcal hydrogen peroxide production, assays were done either aerobically with catalase added to both agar layers or under anaerobic conditions, with equivalent results. This screening procedure identified isolates of type 6A and 19A with inhibitory activity in vitro when tested against a number of other pneumococcal isolates, including the fully sequenced type 4 strain TIGR4 (Table 3 and Fig. 1C). The TIGR4 strain had no reciprocal activity against type 6A or 19A or any other clinical isolate tested under these assay conditions (Table 3).
TABLE 3.
Results of plate overlay assay
| Test Strain | Result with overlay straina
|
||||||||
|---|---|---|---|---|---|---|---|---|---|
| 6A | TIGR4 | 7F | 19A | 19F | 18C | 12F | 5 | 23F | |
| 6A | − | + | + | − | − | + | + | + | + |
| TIGR4 | − | − | − | − | − | − | − | − | − |
| 7F | − | − | − | − | − | − | − | − | − |
| 19A | − | + | + | − | + | + | + | − | + |
| 19F | − | − | − | − | − | − | − | − | − |
| 18C | − | − | − | − | − | − | − | − | − |
| 12F | − | − | − | − | − | − | − | − | − |
| 5 | − | − | − | − | − | − | − | − | − |
| 23F | − | − | − | − | − | − | − | − | − |
+, definite zone of inhibition of overlaid strain.
FIG. 1.
(A) Table summarizing results of agar overlay assays with deletion mutants of the blp locus. Plus signs designate definite zones of inhibition, and empty cells designate combinations that were not tested. (B) Alignment of BlpM and BlpN amino acid sequences from type 6A and TIGR4 strains and the chimeric proteins from 6AblpMNOTIGR. Shaded amino acids are nonconserved, and arrows designate putative cleavage sites of preproteins. (C) Photographs of results of selected overlay assays. Pictures a to g demonstrate test strains with zones of inhibition, while pictures h to m demonstrate test strains lacking inhibition. Pictures a and b are shown with a TIGR4 overlay, and pictures c to m are shown with an overlay of 6AΔblpMNO. Test strains: a and c, type 6A; b and f, type 19A; d, 6AblpMNOWT; e, 6AΔblpO; g, 19AblpMNOWT; h, 6AΔblpMNO; i, 6AΔblpM; j, 6AΔblpN; k, TIGR4; l, 6AblpMNOTIGR4; m, 19AΔblpMNO.
BlpR regulates expression of in vitro bacteriocin activity and immunity.
In order to confirm that the blp locus was responsible for intraspecies inhibition, the blpR regulatory gene homologue of the type 6A strain was deleted by replacement of an internal fragment of the gene with the erythromycin resistance cassette. The resulting strain, 6AΔblpR, was analyzed for loss of its inhibitory activity and immunity, using the plate overlay method. As predicted, 6AΔblpR was deficient in in vitro intraspecies inhibition when tested against TIGR4. In addition, as expected, 6AΔblpR was killed by its parent strain, suggesting a deficiency in expression of its immunity phenotype (Fig. 1A). Therefore, deletion of the BlpR response regulator led to a defect in both killing and immunity. These observations provided the first direct functional demonstration that the blp locus is involved in intraspecies competition in vitro.
Sequence analysis of the 6A blp locus.
Given the preliminary results for the type 6A strain, we sequenced its blp locus from the N terminus of the blpA gene to the end of the previously defined locus, SP0547 (Fig. 2). This region was predicted to contain the genes encoding the bacteriocins based on the arrangement of the locus in other previously sequenced strains (8, 22). As in the TIGR4 locus, putative bacteriocin genes in the type 6A locus were preceded by a highly conserved consensus sequence for BlpR binding. The type 6A strain's blp locus contains homologues for the predicted bacteriocin genes blpM, -N, and -O. These genes would be predicted to encode three proteins, with each containing a conserved N-terminal signal sequence followed by a double-glycine motif, consistent with the sequences of previously described bacteriocins. Surprisingly, similar genes were also found in the TIGR4 genome, although TIGR4 did not inhibit the growth of the type 6A strain. The type 6A strain encodes BlpM, -N, and -O proteins that have 6 of 84, 2 of 67, and 2 of 49 residues, respectively, that differ from the TIGR4 sequence. The type 6A locus contains two operons downstream of the putative BlpM, -N, and -O bacteriocins, preceded by two additional BlpR consensus binding sequences that contain open reading frames (ORFs) encoding proteins of unknown function. The final operon contains homologous ORFs for the genes blpX, -Y, and -Z and, unlike TIGR4, is predicted to include the downstream ORF SP0547 due to deletion of a transcriptional terminator sequence. BlpX, -Y, and -Z and SP0547 are 100%, 96%, 98%, and 99% identical to the TIGR4 sequence, respectively, at the amino acid level.
FIG. 2.
Graphical demonstration of the blp locus in a type 6A strain and comparison with the corresponding portion of the TIGR4 genome. Solid arrows represent coding sequences for double glycine-containing proteins, vertically striped arrows represent genes of unknown function, checked arrows represent transport genes, the white box represents an insertion sequence element, and gray boxes represent the conserved putative BlpR binding sites designating the start sites of operons. The gap in 6A designates an unsequenced region.
Deletional analysis of blpM, -N, and -O.
Using chromosomal allelic replacement, the 6A blpM, -N, and -O ORFs were deleted both individually and in combination. In order to create in-frame, unmarked deletions in these small, closely approximated genes, the janus cassette (21) was inserted between unique restriction sites, replacing the entire blpMNO operon. A type 6A strain derivative made streptomycin resistant was used for insertion of the janus cassette in the blpMNO locus. The resulting isolate was resistant to kanamycin and sensitive to streptomycin, confirming the insertion of the janus cassette. The cassette was then replaced by transforming this strain with fragments containing altered versions of the blpMNO operon. Separate deletions were created in blpM, -N, and -O by deleting each gene in its entirety, leaving only its predicted stop and start codons. The deletion of the entire blpMNO locus was created by introduction of a deletion spanning from the 5′ end of the blpM ORF through the 3′ end of the blpO ORF. In order to determine the significance of the small number of amino acid differences between BlpM and BlpN in the type 6A isolate and TIGR4, a chimeric gene was created by exchanging the type 6A strain blpM and -N with TIGR4 blpM and -N. The chimeric protein contains the N terminus of 6A blpM with all three amino acid changes in the C terminus found in the TIGR4 locus and the entire blpN locus from TIGR4 (Fig. 1B). This chimeric construct was used to determine if the difference in killing between the two strains was the result of the differences in these amino acids. To confirm this result and to demonstrate an absence of additional mutations outside the locus explaining the phenotype, a PCR product containing the corresponding original parental type 6A locus was used to replace the janus cassette. All strains were tested for a loss of in vitro inhibitory activity by the plate overlay method against strains TIGR4 and 6AΔblpMNO and used as an overlay against the type 6A isolate to look for a loss of immunity (Fig. 1A and C).
In vitro assays for bacteriocin activity demonstrated that both the blpM and blpN genes are required for wild-type intraspecies inhibitory activity but not immunity. Unlike the blpM and -N deletions, the blpO deletion had wild-type levels of activity in both inhibition and immunity. Strain 6AΔblpMNO, containing a deletion of the entire locus, had a deficiency in both inhibition and immunity, suggesting that a gene in this locus contributes to the immunity phenotype. The construct containing the corrected wild-type locus, 6AblpMNOWT, had parental levels of activity, confirming that mutations outside blpMN could not account for the observed phenotypes. The type 6A strain expressing the chimeric form of BlpM and -N, 6AblpMNOTIGR4, was deficient in intraspecies inhibition, similar to the phenotype of wild-type TIGR4. This strain retained the parent strain immunity phenotype. These data suggest that both BlpM and -N are necessary for the bacteriocin activity seen in vitro. Moreover, the difference in activity between the TIGR4 and type 6A strains could be attributed to the five amino acids that differ between the two strains in the mature, processed forms of BlpM and -N.
Conservation of BlpM and -N sequences among pneumococcal strains.
It is known that bacteriocins tend to have a significant degree of divergence when different strains within the same species are compared. This divergence may allow for intraspecies competition. Small changes in the bacteriocin often require reciprocal changes in the immunity protein so that organisms expressing similar but not identical bacteriocins are not protected from each other by their own immunity proteins. In order to determine the relative conservation of the BlpM and -N proteins, blpM and -N coding sequences for the nine clinical isolates were analyzed. These strains include an array of clinical isolates of diverse capsular types that were isolated in different locations at different times. Seven of the nine isolates had sequences homologous to blpM and -N. The remaining two isolates contained coding regions for other bacteriocin-like peptides (blpI and blpK) homologous to those found in the TIGR4 locus. The BlpM and -N sequences were aligned and analyzed for conserved amino acids (Fig. 3). Interestingly, the seven BlpM sequences seemed to be divided into two groups. Group 1 contains those with 100% identity to the TIGR4 sequence. Group 2 comprises those with 98 to 100% identity to the type 6A strain's sequence. In comparing the BlpN sequences, the RL amino acid sequence at amino acids 40 and 41 was seen in all strains containing the group 1 BlpM sequence, while the KI sequence was seen in strains containing the group 2 BlpM sequence. In vitro inhibition assays with the seven clinical isolates demonstrated that only strains in group 2 had detectible activity. One strain in this group, a type 12F strain, showed no detectible inhibitory activity on overlay assays against any strain tested, and the five strains in group 1 also had no detectible inhibitory activity.
FIG. 3.
Amino acid alignment of sequences of BlpM and BlpN from a selection of clinical isolates of the serotypes indicated. Shaded amino acids are areas of nonconservation. Arrows designate putative cleavage sites of preproteins.
The blp locus is functional in vivo during colonization.
In order for the blp locus to play a role in intra- and interspecies competition, not only must it be expressed in the polymicrobial environment of the nasopharynx, but organisms must be in close enough proximity to be affected by secreted antimicrobial proteins. To determine if the blp locus is both expressed and functional during colonization, we performed competition experiments in BALB/c mice. Because the type 6A strain was highly virulent in mice in the nasal colonization model, we performed competition experiments with the serotype 19A strain from group 2. An unmarked mutation of the blpMNO operon and a replacement of the wild-type operon were created in this strain and analyzed by the overlay assay for phenotype. Like the type 6A strain, strain 19AΔblpMNO was deficient in growth inhibition when tested against TIGR4 and had an immunity defect when tested against the parent strain (Fig. 1A and C). The corrected mutant, 19AblpMNOWT, had the expected wild-type phenotype in both inhibition and immunity. The type 19A strain, TIGR4, 19AblpMNOWT, and 19AΔblpMNO were inoculated intranasally either alone or in pairs. Singly inoculated mice were colonized with TIGR4, 19A, 19AΔblpMNO, or 19AblpMNOWT at equivalent levels (Fig. 4A and B). Dually colonized mice given 19A and 19AΔblpMNO were colonized predominantly with the type 19A strain (Fig. 4B). Dually colonized mice given TIGR4 and 19AblpMNOWT were colonized primarily with the 19A strain, mimicking our in vitro inhibition results (Fig. 4A). The competitive advantage of the 19A strain was eliminated when TIGR4 was coinoculated with 19AΔblpMNO. In fact, these animals were colonized primarily with TIGR4, with little detectible colonization by the mutant strain. These experiments suggest that production of bacteriocins by the wild-type strain was able to inhibit growth of immunity-deficient strains during colonization, verifying the role of these peptides in vivo.
FIG. 4.
19AΔblpMNO is outcompeted by TIGR4 (A) or its parent type 19A strain (B) during mouse nasopharyngeal colonization. Six-week-old BALB/c mice were challenged intranasally with single or dual inoculations of the type 19A parental strain (19A; open circles), the 19AblpMNOWT corrected mutant (19A; closed circles), 19AΔblpMNO (closed diamonds), and TIGR4 (19Ablp-; closed triangles) (A) or with single or dual inoculations of the type 19A strain and19AΔblpMNO (B). The colonizing strain is depicted on the x axis and was detected in lavage fluid at 4 days postinoculation at the density indicated (y axis). Coinoculated strains are shown in parentheses. Statistical analysis was done by the Mann-Whitney test, and horizontal lines indicate median values. Dashed lines denote the limit of detection.
DISCUSSION
The presence of the blp operon in pneumococci has been known for several years, but there exists little information regarding the functional characteristics of the various proteins encoded by the locus. We were unable to appreciate any bacteriocin-like activity by using in vitro assays for either of the two strains for which the locus has been best characterized (R6 and TIGR4). However, we identified two clinical isolates with the ability to inhibit the growth of several other strains in vitro. Identification of such isolates allowed us to further investigate which genes were responsible for intraspecies inhibition and whether the locus was important during colonization.
The requirement for two genes suggests that BlpM and BlpN comprise a type IIb, or two-component, bacteriocin (4, 16). Deletion of the entire operon resulted in a loss of immunity, suggesting that a protein involved in immunity to the BlpMN bacteriocins is encoded in this operon. Because none of the mutants with single deletions of blpM, blpN, or blpO was deficient in immunity, the gene encoding the immunity protein is likely the ORF identified between blpN and -O. de Saizieu et al. (3) have shown using microarray analysis that application of purified BlpC results in the upregulation of genes within the blp locus only, with the exception of the unlinked putative bacteriocin gene blpU. The loss of intraspecies inhibition with mutations in blpMN shows that blpU or other putative bacteriocin genes do not make a significant contribution under these conditions in the strain backgrounds tested.
Because the type 6A strain is able to inhibit the growth of TIGR4, either the entire blp locus in TIGR4 is inactive, including the production of immunity proteins, or the differences between the bacteriocins produced by the two strains are sufficient to result in failure of the TIGR4 immunity protein to protect against the type 6A BlpMN bacteriocins. Our data suggest that the latter is true. Alignment of the type 6A and TIGR4 BlpM and -N protein sequences with particular attention to the active portion following the double-glycine motif demonstrates that there are only three amino acid differences in BlpM and two amino acid differences in BlpN. Our chimeric protein contained the N-terminal processing and secretion domain of the type 6A BlpM fused to the remainder of BlpM and -N from TIGR4. This chimeric protein was unable to restore inhibitory activity to strain 6A. Expression of wild-type immunity in the chimeric strain suggests that the blpMNO operon is transcribed. Thus, our data suggest that the specificity of the in vitro activities of the two bacteriocins is likely dictated by the five amino acids that differ between the two proteins in the mature peptide. Because these chimeric proteins were unable to inhibit growth of TIGR4 when placed behind an active promoter, this finding suggests either that TIGR4 actively produces an immunity protein that protects it from its own bacteriocin but not that of the type 6A strain or that the bacteriocins produced by TIGR4 are nonfunctional.
Alignment of a number of clinical isolates demonstrates that there are two subtypes of BlpMN, with one that resembles the TIGR4 proteins (group I) and one that is homologous to the protein in the type 6A strain (group II). Examination of the available fully sequenced pneumococcal genomes reveals that there are other pneumococcal strains that have no coding sequence for BlpMN. These include the type 23F strain sequenced by the Sanger Centre (sequence data were produced by the S. pneumoniae Sequencing Group at the Sanger Institute and can be obtained from http://www.sanger.ac.uk/Projects/S_pneumoniae/), which has genes homologous to blpIJ from TIGR4 (22), and the laboratory strain R6, which has no bacteriocin gene homologues within the blp locus (8). Using our clinical strains, we were able to show for one of the group II isolates that the pattern of inhibition was similar to that for the type 6A strain, while the remainder of the isolates had no detectable activity. The lack of appreciable activity in a large number of strains may be due to differences in inducing conditions for these isolates in our in vitro assay. Alternatively, we may have failed to identify the correct target bacteria, whether pneumococci or other species, for their bacteriocins. It is clear that the regulation of the blp locus is complex, likely involving at least two separate two-component systems and a pheromone. Mascher et al. demonstrated that the blpXYZ promoter as well as the blpABC promoter contains a binding site for the global response regulator CiaR (14). Peterson et al. have also shown that blpABC, blpXYZ, and SP0547 are induced early in competence (18). In addition, there are differences in transcription as well as functional activity between the opaque and transparent phenotypic variants of pneumococcus (11). We have found that the transparent variant of the type 6A isolate has very little appreciable inhibitory activity compared with its opaque variant. Despite this difference, these variants show no discernible difference in immunity (data not shown).
Previous work by Throup et al. has shown that mutants in blpR and -H are attenuated in the mouse model of respiratory infection (23). It is unclear how a locus involved in production of antimicrobial peptides would play a role in the typically sterile environment of the lung. Our work addressed the effects of mutations in the blp locus on colonization of the mouse nasopharynx, a host environment where it seems most likely that the locus may be functional. In order to remove the possible influence of BlpR/H-regulated genes not involved in bacteriocin production, we performed colonization experiments using a specific unmarked deletion of the blpMNO operon. The 19AΔblpMNO strain showed wild-type levels of colonization when given alone but was outcompeted by its isogenic parent strain when both strains were given in equivalent numbers. In order to address whether the production of BlpMN could influence colonization when tested against nonisogenic strains, we performed cocolonization experiments with TIGR4 and either 19AblpMNOWT or 19AΔblpMNO. When the blpMNO mutant was compared to the parent strain for the ability to outcompete TIGR4 during colonization, only the parent strain expressing bacteriocins was able to suppress the levels of TIGR4. This finding suggests that the BlpMN bacteriocins can play a role in intraspecies competition within the polymicrobial environment of the nasopharynx. Elaboration of pneumococcal bacteriocins in the nasopharynx may contribute to defining the organism's microenvironment. Efficient removal of competitors may allow certain strains of the pneumococcus to colonize both more efficiently and for longer periods of time, thus increasing their potential for transmission. The observation that expression of bacteriocins may provide producers with a competitive advantage in colonization of the nasopharynx is particularly intriguing when considering our data for the serotype 19A strain. This serotype has emerged in the postvaccine era as an increasingly prevalent cause of invasive disease. The correlation between bacteriocin production and the ability of pneumococci to colonize and cause disease in a larger panel of clinical isolates is currently being investigated.
The environment of the nasopharynx is subject to constant fluxes in the abundance of particular inhabitants as potential competitors wax and wane. A better understanding of the bacterial factors driving these alterations may allow for the creation of novel ways to block colonization, an obligatory step to invasive disease.
Acknowledgments
This work was supported by Public Health Service grants RO1-AI38446, R21-AI054647, RO1-AI44231, and T32-AI007634-05 (S.D.) and by a MedImmune Career Development Award in Pediatric Infectious Diseases (S.D.).
Editor: F. C. Fang
Footnotes
Published ahead of print on 30 October 2006.
REFERENCES
- 1.Aniansson, G., B. Alm, B. Andersson, P. Larsson, O. Nylen, H. Peterson, P. Rigner, M. Svanborg, and C. Svanborg. 1992. Nasopharyngeal colonization during the first year of life. J. Infect. Dis. 165(Suppl. 1):S38-S42. [DOI] [PubMed] [Google Scholar]
- 2.Bakir, M., A. Yagci, N. Ulger, C. Akbenlioglu, A. Ilki, and G. Soyletir. 2001. Asymptomatic carriage of Neisseria meningitidis and Neisseria lactamica in relation to Streptococcus pneumoniae and Haemophilus influenzae colonization in healthy children: apropos of 1400 children sampled. Eur. J. Epidemiol. 17:1015-1018. [DOI] [PubMed] [Google Scholar]
- 3.de Saizieu, A., C. Gardes, N. Flint, C. Wagner, M. Kamber, T. J. Mitchell, W. Keck, K. E. Amrein, and R. Lange. 2000. Microarray-based identification of a novel Streptococcus pneumoniae regulon controlled by an autoinduced peptide. J. Bacteriol. 182:4696-4703. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Eijsink, V. G., L. Axelsson, D. B. Diep, L. S. Havarstein, H. Holo, and I. F. Nes. 2002. Production of class II bacteriocins by lactic acid bacteria; an example of biological warfare and communication. Antonie Leeuwenhoek 81:639-654. [DOI] [PubMed] [Google Scholar]
- 5.Garcia-Rodriguez, J. A., and M. J. Fresnadillo Martinez. 2002. Dynamics of nasopharyngeal colonization by potential respiratory pathogens. J. Antimicrob. Chemother. 50(Suppl. 2):59-73. [DOI] [PubMed] [Google Scholar]
- 6.Ghaffar, F., T. Barton, J. Lozano, L. S. Muniz, P. Hicks, V. Gan, N. Ahmad, and G. H. McCracken, Jr. 2004. Effect of the 7-valent pneumococcal conjugate vaccine on nasopharyngeal colonization by Streptococcus pneumoniae in the first 2 years of life. Clin. Infect. Dis. 39:930-938. [DOI] [PubMed] [Google Scholar]
- 7.Gundel, M. 1933. Bakteriologische und epidemiologische untersuchungen uber die Besiedlung der oberen atmungswege gesunder mit pneumokokken. Z. Hyg. Infekt. 114:647-704. [Google Scholar]
- 8.Hoskins, J., W. E. Alborn, Jr., J. Arnold, L. C. Blaszczak, S. Burgett, B. S. DeHoff, S. T. Estrem, L. Fritz, D. J. Fu, W. Fuller, C. Geringer, R. Gilmour, J. S. Glass, H. Khoja, A. R. Kraft, R. E. Lagace, D. J. LeBlanc, L. N. Lee, E. J. Lefkowitz, J. Lu, P. Matsushima, S. M. McAhren, M. McHenney, K. McLeaster, C. W. Mundy, T. I. Nicas, F. H. Norris, M. O'Gara, R. B. Peery, G. T. Robertson, P. Rockey, P. M. Sun, M. E. Winkler, Y. Yang, M. Young-Bellido, G. Zhao, C. A. Zook, R. H. Baltz, S. R. Jaskunas, P. R. Rosteck, Jr., P. L. Skatrud, and J. I. Glass. 2001. Genome of the bacterium Streptococcus pneumoniae strain R6. J. Bacteriol. 183:5709-5717. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Huang, S. S., R. Platt, S. L. Rifas-Shiman, S. I. Pelton, D. Goldmann, and J. A. Finkelstein. 2005. Post-PCV7 changes in colonizing pneumococcal serotypes in 16 Massachusetts communities, 2001 and 2004. Pediatrics 116:e408-e413. [DOI] [PubMed] [Google Scholar]
- 10.Kim, J. O., and J. N. Weiser. 1998. Association of intrastrain phase variation in quantity of capsular polysaccharide and teichoic acid with the virulence of Streptococcus pneumoniae. J. Infect. Dis. 177:368-377. [DOI] [PubMed] [Google Scholar]
- 11.King, S. J., K. R. Hippe, J. M. Gould, D. Bae, S. Peterson, R. T. Cline, C. Fasching, E. N. Janoff, and J. N. Weiser. 2004. Phase variable desialylation of host proteins that bind to Streptococcus pneumoniae in vivo and protect the airway. Mol. Microbiol. 54:159-171. [DOI] [PubMed] [Google Scholar]
- 11a.Lacks, S., and R. D. Hotchkiss. 1960. A study of the genetic material determining an enzyme activity in pneumococcus. Biochim. Biophys. Acta 39:508-517. [DOI] [PubMed] [Google Scholar]
- 12.Leiberman, A., R. Dagan, E. Leibovitz, P. Yagupsky, and D. M. Fliss. 1999. The bacteriology of the nasopharynx in childhood. Int. J. Pediatr. Otorhinolaryngol. 49(Suppl. 1):S151-S153. [DOI] [PubMed] [Google Scholar]
- 13.Lipsitch, M. 1999. Bacterial vaccines and serotype replacement: lessons from Haemophilus influenzae and prospects for Streptococcus pneumoniae. Emerg. Infect. Dis. 5:336-345. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Mascher, T., D. Zahner, M. Merai, N. Balmelle, A. B. de Saizieu, and R. Hakenbeck. 2003. The Streptococcus pneumoniae cia regulon: CiaR target sites and transcription profile analysis. J. Bacteriol. 185:60-70. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.McCool, T. L., and J. N. Weiser. 2004. Limited role of antibody in clearance of Streptococcus pneumoniae in a murine model of colonization. Infect. Immun. 72:5807-5813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Nissen-Meyer, J., H. Holo, L. S. Havarstein, K. Sletten, and I. F. Nes. 1992. A novel lactococcal bacteriocin whose activity depends on the complementary action of two peptides. J. Bacteriol. 174:5686-5692. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Pai, R., M. R. Moore, T. Pilishvili, R. E. Gertz, C. G. Whitney, B. Beall, and Active Bacterial Core Surveillance Team. 2005. Postvaccine genetic structure of Streptococcus pneumoniae serotype 19A from children in the United States. J. Infect. Dis. 192:1988-1995. [DOI] [PubMed] [Google Scholar]
- 18.Peterson, S. N., C. K. Sung, R. Cline, B. V. Desai, E. C. Snesrud, P. Luo, J. Walling, H. Li, M. Mintz, G. Tsegaye, P. C. Burr, Y. Do, S. Ahn, J. Gilbert, R. D. Fleischmann, and D. A. Morrison. 2004. Identification of competence pheromone responsive genes in Streptococcus pneumoniae by use of DNA microarrays. Mol. Microbiol. 51:1051-1070. [DOI] [PubMed] [Google Scholar]
- 19.Reichmann, P., and R. Hakenbeck. 2000. Allelic variation in a peptide-inducible two-component system of Streptococcus pneumoniae. FEMS Microbiol. Lett. 190:231-236. [DOI] [PubMed] [Google Scholar]
- 20.St. Sauver, J., C. F. Marrs, B. Foxman, P. Somsel, R. Madera, and J. R. Gilsdorf. 2000. Risk factors for otitis media and carriage of multiple strains of Haemophilus influenzae and Streptococcus pneumoniae. Emerg. Infect. Dis. 6:622-630. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Sung, C. K., H. Li, J. P. Claverys, and D. A. Morrison. 2001. An rpsL cassette, Janus, for gene replacement through negative selection in Streptococcus pneumoniae. Appl. Environ. Microbiol. 67:5190-5196. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Tettelin, H., K. E. Nelson, I. T. Paulsen, J. A. Eisen, T. D. Read, S. Peterson, J. Heidelberg, R. T. DeBoy, D. H. Haft, R. J. Dodson, A. S. Durkin, M. Gwinn, J. F. Kolonay, W. C. Nelson, J. D. Peterson, L. A. Umayam, O. White, S. L. Salzberg, M. R. Lewis, D. Radune, E. Holtzapple, H. Khouri, A. M. Wolf, T. R. Utterback, C. L. Hansen, L. A. McDonald, T. V. Feldblyum, S. Angiuoli, T. Dickinson, E. K. Hickey, I. E. Holt, B. J. Loftus, F. Yang, H. O. Smith, J. C. Venter, B. A. Dougherty, D. A. Morrison, S. K. Hollingshead, and C. M. Fraser. 2001. Complete genome sequence of a virulent isolate of Streptococcus pneumoniae. Science 293:498-506. [DOI] [PubMed] [Google Scholar]
- 23.Throup, J. P., K. K. Koretke, A. P. Bryant, K. A. Ingraham, A. F. Chalker, Y. Ge, A. Marra, N. G. Wallis, J. R. Brown, D. J. Holmes, M. Rosenberg, and M. K. Burnham. 2000. A genomic analysis of two-component signal transduction in Streptococcus pneumoniae. Mol. Microbiol. 35:566-576. [DOI] [PubMed] [Google Scholar]
- 24.Whitney, C. G., M. M. Farley, J. Hadler, L. H. Harrison, N. M. Bennett, R. Lynfield, A. Reingold, P. R. Cieslak, T. Pilishvili, D. Jackson, R. R. Facklam, J. H. Jorgensen, and A. Schuchat. 2003. Decline in invasive pneumococcal disease after the introduction of protein-polysaccharide conjugate vaccine. N. Engl. J. Med. 348:1737-1746. [DOI] [PubMed] [Google Scholar]