Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2006 Dec 28;73(4):1355–1361. doi: 10.1128/AEM.02268-06

Metabolic Engineering of Carotenoid Biosynthesis in Escherichia coli by Ordered Gene Assembly in Bacillus subtilis▿

Tomoko Nishizaki 1,†, Kenji Tsuge 2,‡, Mitsuhiro Itaya 2,‡, Nobuhide Doi 1, Hiroshi Yanagawa 1,*
PMCID: PMC1828653  PMID: 17194842

Abstract

We attempted to optimize the production of zeaxanthin in Escherichia coli by reordering five biosynthetic genes in the natural carotenoid cluster of Pantoea ananatis. Newly designed operons for zeaxanthin production were constructed by the ordered gene assembly in Bacillus subtilis (OGAB) method, which can assemble multiple genes in one step using an intrinsic B. subtilis plasmid transformation system. The highest level of production of zeaxanthin in E. coli (820 μg/g [dry weight]) was observed in the transformant with a plasmid in which the gene order corresponds to the order of the zeaxanthin metabolic pathway (crtE-crtB-crtI-crtY-crtZ), among a series of plasmids with circularly permuted gene orders. Although two of five operons using intrinsic zeaxanthin promoters failed to assemble in B. subtilis, the full set of operons was obtained by repressing operon expression during OGAB assembly with a pR promoter-cI repressor system. This result suggests that repressing the expression of foreign genes in B. subtilis is important for their assembly by the OGAB method. For all tested operons, the abundance of mRNA decreased monotonically with the increasing distance of the gene from the promoter in E. coli, and this may influence the yield of zeaxanthin. Our results suggest that rearrangement of biosynthetic genes in the order of the metabolic pathway by the OGAB method could be a useful approach for metabolic engineering.


Carotenoids are found in bacteria, fungi, algae, and higher plants and act as photoprotecting agents. Because of their antioxidant functions, carotenoids have been proposed to act as anticancer agents (3). In the last decade, there has been an increasing demand for carotenoids as foods, health supplements, and animal feeds, and thus, improvements have been made in the production of carotenoids by transforming bacteria, yeasts, and plants with gene clusters encoding carotenoid biosynthetic enzymes (1, 18). In particular, noncarotenogenic Escherichia coli has been widely used as a host for improved carotenoid productivity by transformation with appropriate gene clusters, and methods were developed for increasing the biosynthesis of isopentenyl pyrophosphate and geranylgeranyl pyrophosphate (GGPP) as precursors in E. coli (10, 11, 15, 26). Engineering of the metabolic flux in recombinant E. coli is a useful approach for enhancing carotenoid productivity (14, 17). Recently, optimization of metabolic flux in the carotenoid biosynthetic pathway was used to enhance the productivity of lycopene (2, 25) and β-carotene (27). On the other hand, new carotenoid biosynthetic pathways can be created by gene assembly approaches (23). In spite of the many studies on the metabolic engineering of carotenoids performed so far, only limited information is available on the functionality of basic carotenoid operons.

Previously, two of the authors (K.T. and M.I.) developed a novel method for assembly of multiple genes with a designated order on Bacillus subtilis-E. coli shuttling vectors (22). This method, named ordered gene assembly in B. subtilis (OGAB), allows one-step assembly of multiple DNA fragments with high efficiency, and thus, the method is advantageous in comparison with the classical recombinant technology using E. coli (22). In this study, we applied the OGAB method to metabolic engineering for the production of zeaxanthin in E. coli by rearranging the order of the crt genes from Pantoea ananatis (Erwinia uredovora) (19). In the Pantoea ananatis genome, the six crt genes for zeaxanthin-β-d-diglucoside production form two transcriptional units that are in orientations opposite to each other (Fig. 1A). The gene order in one transcriptional unit is PcrtE-crtE-crtX-crtY-crtI-crtB, where crtX encodes an enzyme for further modification of zeaxanthin and was not used in this study, and the other unit consists of a single gene, PcrtZ-crtZ.

FIG. 1.

FIG. 1.

(A) Organization of the carotenoid biosynthetic gene cluster of Pantoea ananatis. This cluster is composed of two transcriptional units; one is transcribed from PcrtE to crtE-crtX-crtY-crtI-crtB, and the other is PcrtZ-crtZ. (B) Carotenoid biosynthetic pathway. FPP, farnesyl pyrophosphate; IPP, isopentenyl diphosphate; GGPP, geranylgeranyl pyrophosphate; CrtE, GGPP synthase; CrtB, phytoene synthase; CrtI, phytoene desaturase; CrtY, lycopene cyclase; CrtZ, β-carotene hydroxylase; CrtX, zeaxanthin glucosyltransferase.

To investigate whether the gene order affects the final amount of zeaxanthin biosynthesized in transformed E. coli, we constructed an unprecedented operon according to the order of the zeaxanthin biosynthetic pathway (Fig. 1B), i.e., crtE-crtB-crtI-crtY-crtZ, as well as the circularly permuted variants crtB-crtI-crtY-crtZ-crtE, crtI-crtY-crtZ-crtE-crtB, crtY-crtZ-crtE-crtB-crtI, and crtZ-crtE-crtB-crtI-crtY, by the OGAB method. We found that the gene order does affect the mRNA expression levels of these genes, and consequently the yield of zeaxanthin, in E. coli.

MATERIALS AND METHODS

Bacterial strains and plasmids.

B. subtilis strain RM125 (24) was used for the OGAB assembly. BUSY9166 [RM125 proB::(cI857 spc)], which was constructed by insertion of a cI857-spc cassette from pCISP310B (9) into the NotI site of the proB gene, was also used for the OGAB assembly of a pR promoter-equipped vector to repress expression from the pR promoter. E. coli Top10 (Invitrogen) [F′{lacIq Tn10 (Tetr)} mcrAΔ(mrr-hsd RMS-mcrBC) φ80lacZΔM15 ΔlacX74 deoR recA1 araD139Δ(ara-leu)7697 galU galK rpsL(Strr) endA1 nupG], JM109 (Takara) [recA1 endA1 gyrA96 thi hsdR17(rK− mK+) e14− (mcrA) supE44 relA1 Δ(lac-proAB)/F′ traD36 proAB+ lacIq lacZ DM15], and GI724 (Invitrogen) (13, 16) [F− λ− lacIq lacPL8 ampC::PtrcI mcrA mcrB INV(rnnD-rnnE)] were used as host strains for cloning of assembled genes into the pCR-XL-TOPO vector (Invitrogen), pCrtP series, and pPrP series (see below), respectively. Plasmids pCAR25 and pACCAR25ΔcrtX (20) were kindly provided by N. Misawa (Marine Biotechnology Institute, Japan).

OGAB.

The protocol of the OGAB method was previously described (22). The oligonucleotide sequences used in this study are listed in Table 1.

TABLE 1.

Oligonucleotide sequences used in this studya

Oligonucleotide Sequence
CrtPr-Acc65I-F1 GGTACCGCACGGTCTGCCAATCC
CrtPr-DraIII-R2 GGTACCCACAGAGTGAGATCTCACAGTGTGTAAACGGATACATTTACGGCAA
PrP-Acc65I-F1 GGTACCCTCCTTAAATCTATCACC
PrP-DraIII-R2 GGTACCCACAGAGTGAGATCTCACAGTGTGTTAGTACATGCAACCATTATCACCG
CrtE-DraIII-F1 CACTACGTGTAAGGACAGCCCGAATGA
CrtE-DraIII-F2 CACACTGTGTAAGGACAGCCCGAATGAC
CrtB-DraIII-F1 CACGTTGTGGCTGGAGGATCTGATATGAA
CrtB-DraIII-F2 CACACTGTGGCTGGAGGATCTGATATGAA
CrtI-DraIII-F1 CACATGGTGTAAAGAGCGACTACATGAAACCAAC
CrtI-DraIII-F2 CACACTGTGTAAAGAGCGACTACATGAAACCAAC
CrtY-DraIII-F1 CACCTAGTGTAAGTGGGAGCGGCTATG
CrtY-DraIII-F2 CACACTGTGTAAGTGGGAGCGGCTATG
CrtZ-DraIII-F1 CACTGAGTGACCGGAGAAATTATGTTGTGGATTTG
CrtZ-DraIII-F2 CACACTGTGACCGGAGAAATTATGTTGTGGATTTG
CrtE-DraIII-R1 CACAACGTGTTAACTGACGGCAGCGAG
CrtE-DraIII-R2 CACAGAGTGTTAACTGACGGCAGCGAG
CrtB-DraIII-R1 CACCATGTGCTAGAGCGGGCGC
CrtB-DraIII-R2 CACAGAGTGCTAGAGCGGGCGC
CrtI-DraIII-R1 CACTAGGTGTCATATCAGATCCTCCAGCA
CrtI-DraIII-R2 CACAGAGTGTCATATCAGATCCTCCAGCA
CrtY-DraIII-R1 CACTCAGTGTTAACGATGAGTCGTCATAATGGC
CrtY-DraIII-R2 CACAGAGTGTTAACGATGAGTCGTCATAATGGC
CrtZ-DraIII-R1 CACGTAGTGTTACTTCCCGGATGCGG
CrtZ-DraIII-R2 CACAGAGTGTTACTTCCCGGATGCGG
RT-PCRcrtE-F GCTGGACGATTTGACCGAT
RT-PCRcrtE-R CACTGGCAAGCTGAAGATGT
RT-PCRcrtB-F ACGGCGAAGCAGGTTTAC
RT-PCRcrtB-R GCCAGCAGCAGCGTTAAT
RT-PCRcrtI-F CGTACCTTGAGCAGCATT
RT-PCRcrtI-R AACGGGCTCCACAGAAAAG
RT-PCRcrtY-F CCTGGCCTGTAGTGGATTA
RT-PCRcrtY-R GCCGACGTAAAGACATCAAG
RT-PCRcrtZ-F GCCATTCCGCTATATTCCAC
RT-PCRcrtZ-R CGCATAGAGGAAGCCAAAAG
a

Oligonucleotide sequences are indicated in the 5′-to-3′ direction. Underlined nucleotides are DraIII recognition sites, while italic nucleotides indicate protrusions generated by DraIII digestion. The start codons and the termination codons (complementary sequences) of genes are indicated as bold letters.

The putative 240-bp promoter region (PcrtE) upstream of crtE from Pantoea ananatis (Erwinia uredovora) (DDBJ accession number D90087) was amplified by PCR from pCAR25 with an Ex Taq DNA polymerase (Takara), using primers CrtPr-Acc65I-F1 and CrtPr-DraIII-R2. Similarly, the 128-bp pR promoter region of the λ phage was amplified by PCR from pBEST515C (8), using primers PrP-Acc65I-F1 and PrP-DraIII-R2. The PCR products were subcloned into pCR-XL-TOPO (Invitrogen) and confirmed by DNA sequencing with an ABI PRISM 3100 genetic analyzer (Applied Biosystems). Each plasmid was digested with Acc65I, and the resultant small fragment was inserted into the identical site of pGETS109SfiI (22), resulting in pGETS109SfiI-Pcrt and pGETS109SfiI-PrP, respectively (Fig. 2B).

FIG. 2.

FIG. 2.

(A) Schematic representation of the assembly of five genes for carotenoid biosynthesis. (B) DraIII fragments of shuttle vectors pGETS109SfiI-Pcrt and pGETS109SfiI-PrP used in this study. (C) Five circularly permuted DNA constructs assembled in this study.

Three types of five Pantoea ananatis genes, crtE (fragments E1 to E3, 932 bp), crtB (B1 to B3, 954 bp), crtI (I1 to I3, 1,502 bp), crtY (Y1 to Y3, 1,173 bp), and crtZ (Z1 to Z3, 549 bp), with DraIII sites at both ends, were amplified by PCR from pCAR25, using primers (Table 1) CrtE-DraIII-F1 and CrtE-DraIII-R1 (E1), CrtE-DraIII-F1 and CrtE-DraIII-R2 (E2), CrtE-DraIII-F2 and CrtE-DraIII-R1 (E3), CrtB-DraIII-F1 and CrtB-DraIII-R1 (B1), CrtB-DraIII-F1 and CrtB-DraIII-R2 (B2), CrtB-DraIII-F2 and CrtB-DraIII-R1 (B3), CrtI-DraIII-F1 and CrtI-DraIII-R1 (I1), CrtI-DraIII-F1 and CrtI-DraIII-R2 (I2), CrtI-DraIII-F2 and CrtI-DraIII-R1 (I3), CrtY-DraIII-F1 and CrtY-DraIII-R1 (Y1), CrtY-DraIII-F1 and CrtY-DraIII-R2 (Y2), CrtY-DraIII-F2 and CrtY-DraIII-R1 (Y3), CrtZ-DraIII-F1 and CrtZ-DraIII-R1 (Z1), CrtZ-DraIII-F1 and CrtZ-DraIII-R2 (Z2), and CrtZ-DraIII-F2 and CrtZ-DraIII-R1 (Z3), respectively. These 15 fragments were also subcloned into pCR-XL-TOPO and confirmed by DNA sequencing.

Two vector plasmids, pGETS109SfiI-Pcrt and pGETS109SfiI-PrP, and the 15 genes described above were digested with DraIII and gel purified. Each vector and an appropriate combination of five insert genes (Fig. 2C) were mixed (1.25 fmol/μl each) in a ligation buffer (66 mM Tris-HCl [pH 7.6], 6.6 mM MgCl2, 10 mM dithiothreitol, 100 μM ATP, 150 mM NaCl, 10% polyethylene glycol 6000 [Wako Pure Chemical]) and incubated with 4 U of T4 DNA ligase (Toyobo) at 37°C for 30 min. Each ligation solution was transformed into competent B. subtilis cells and incubated overnight on LB plates containing tetracycline at 37°C (for RM125) or 30°C (for BUSY9166). The resultant plasmids, the pCrtP series (pCrtP-EBIYZ, pCrtP-ZEBIY, and pCrtP-BIYZE) and the pPrP series (pPrP-EBIYZ, pPrP-ZEBIY, pPrP-YZEBI, pPrP-IYZEB, and pPrP-BIYZE), were confirmed by restriction mapping.

Carotenoid biosynthesis in E. coli.

The pCrtP series and pPrP series plasmids were retransformed into E. coli JM109 and GI724 cells, respectively. The JM109 transformants were grown in 50 ml of LB medium containing 100 μg/ml ampicillin at 37°C for 6, 12, or 24 h, and the cells were harvested by centrifugation. The GI724 transformants were grown in 50 ml of M9 minimal medium (21) containing 0.5% glucose, 0.2% Casamino Acids, 1 mM MgCl2, and 10 μg/ml tetracycline at 30°C. When the culture attained an optical density of 0.5 at 550 nm, l-tryptophan was added to a final concentration of 100 μg/ml to cancel the repression of the pR promoter by the cI repressor. After an additional 4, 8, or 12 h incubation at 37°C, the cells were harvested by centrifugation.

Carotenoids were extracted from the cells with acetone as previously described (5) and analyzed by high-performance liquid chromatography on a COSMOSIL 5C18-MS-II column (4.6 by 250 mm; Nacalai Tesque) with acetonitrile-methanol-isopropanol (90:6:4) at a flow rate of 1 ml/min. The column was calibrated with commercially available zeaxanthin, β-cryptoxanthin, β-carotene (DHI Water and Environment), and lycopene (Sigma).

Real-time RT-PCR.

Real-time reverse transcription (RT)-PCR was performed with a QuantiTect SYBR green RT-PCR kit (Roche) and gene-specific primer sets (the amplicon size was 113 to 137 bp; see below) on a LightCycler (Roche). The targeting region of the RT-PCR was positioned about two-thirds downstream from the initiation codon of each gene. Template mRNA was purified from E. coli cells by using an RNeasy Protect Bacteria mini kit (QIAGEN). The standard template mRNA was prepared as follows. Each gene was amplified by PCR with Ex Taq DNA polymerase (Takara), using specific primers (Table 1) RT-PCRcrtE-F and RT-PCRcrtE-R for crtE (137 bp), RT-PCRcrtB-F and RT-PCRcrtB-R for crtB (113 bp), RT-PCRcrtI-F and RT-PCRcrtI-R for crtI (129 bp), RT-PCRcrtY-F and RT-PCRcrtY-R for crtY (114 bp), and RT-PCRcrtZ-F and RT-PCRcrtZ-R for crtZ (115 bp). These PCR products were cloned into pDrive (QIAGEN), resulting in pDrive-E, pDrive-B, pDrive-I, pDrive-Y, and pDrive-Z. These plasmids were transcribed by the RiboMAX large-scale RNA production system SP6 (Promega), purified with an RNeasy mini kit (QIAGEN), and served as the standard mRNA.

RESULTS

Assembly of five genes for carotenoid biosynthesis by the OGAB method.

In this study, we designed new zeaxanthin operons consisting of five carotenoid biosynthetic genes, crtE, crtY, crtI, crtB, and crtZ, assembled as one transcriptional unit in a polycistronic manner by the OGAB method. Constructed plasmids were transferred into E. coli to assay the production of carotenoids (Fig. 2A). To this end, all genes and an assembly vector were prepared as DNA fragments with arbitrary 3′ 3-nucleotide protrusions that allowed the genes to be linked together in a specific order and orientation by the OGAB method. The protrusions were generated by type II restriction endonucleases that recognize two separate recognition sites, such as DraIII, which recognizes 5′-CACNNN/GTG-3′, where N is any nucleotide in arbitrary sequence; DraIII was chosen in this study since there is no DraIII site in the relevant genes and vectors.

As the first choice of a promoter of these operons, a natural carotenoid promoter in the upstream region of crtE (PcrtE) of Pantoea ananatis was inserted into the B. subtilis-E. coli shuttle vector pGETS109SfiI (22), together with two DraIII sites for assembly, resulting in pGETS109SfiI-Pcrt (Fig. 2B, top). Prior to assembly, pGETS109SfiI-Pcrt was converted to a fragment with 3′ 3-nucleotide protrusions at both ends by DraIII digestion.

Each gene used in this study was defined as a DNA fragment with one open reading frame from a ribosome-binding site to the termination codon of the protein-coding region. Five carotenoid genes were separately amplified by PCR, using primers with DraIII recognition sites at the 5′-end portions, and cloned into E. coli plasmid vector. After sequence confirmation, the relevant gene fragments were excised from these plasmids with DraIII to generate 3-nucleotide protrusions at the 3′ ends. For the five circularly permuted carotenoid operons, at least three gene fragments that have different protrusions are required for every five genes for defined assembly. Thus, we prepared in total 15 gene fragments, crtE (E1 to E3), crtB (B1 to B3), crtI (I1 to I3), crtY (Y1 to Y3), and crtZ (Z1 to Z3), as shown in Fig. 2C.

Taking the construction of pCrtP-EBIYZ as a representative example, we adjusted the concentrations of six of the DraIII fragments, crtE (E3), crtB (B1), crtI (I1), crtY (Y1), crtZ (Z2), and pGETS109SfiI-Pcrt, to be equimolar (Fig. 2A). After an equal volume of each was mixed, the mixture was ligated in a tandemly repeated form by T4 DNA ligase and transformed into B. subtilis RM125 cells, resulting in pCrtP-EBIYZ. As the colonies of B. subtilis transformant with the plasmid did not show any color, due to carotenoids, we concluded that production of carotenoids in B. subtilis cells is difficult and did not perform further investigation of B. subtilis. The plasmid could be used for carotenoid biosynthesis in the noncarotenogenic bacterium E. coli.

Similarly, for the construction of the other four circularly permuted plasmids, appropriate genes were selected, mixed, ligated, and transformed into B. subtilis RM125. However, only two out of four constructs (Fig. 2C), pCrtP-ZEBIY and pCrtP-BIYZE, were obtained by the OGAB method. The efficiency of the emergence of colonies with correct assemblies (the ratio of the number of positive B. subtilis colonies to the number of tetracycline-resistant colonies) was 58% for pCrtP-EBIYZ and pCrtP-ZEBIY and 17% for pCrtP-BIYZE. Despite two trials of OGAB assembly, the remaining two plasmids, pCrtP-YZEBI and pCrtP-IYZEB, could not be obtained in B. subtilis.

Carotenoid biosynthesis in E. coli JM109 with the pCrtP series plasmids.

The three pCrtP plasmids were transformed into E. coli JM109, which was then cultivated for 6, 12, or 24 h. The zeaxanthin production in the E. coli transformants with each of three pCrtP plasmids was confirmed by high-performance liquid chromatography, using commercially available zeaxanthin as a standard. As shown in Fig. 3, the highest zeaxanthin content of 820 ± 39 μg/g (dry weight) was obtained in the transformant with pCrtP-EBIYZ, whose order of the five genes (PcrtE-crtE-crtB-crtI-crtY-crtZ) corresponds to that for the zeaxanthin biosynthetic pathway (Fig. 1B). With pCrtP-BIYZE and pCrtP-ZEBIY, the amounts of zeaxanthin were 257 ± 16 μg/g (dry weight) and 172 ± 32 μg/g (dry weight), respectively. We also measured the yields of β-cryptoxanthin and β-carotene: the amounts of these intermediates were below the detection limit. Synthesis of zeaxanthin with pGETS109SfiI-derived pCrtP-EBIYZ was 4.4-fold higher than that of zeaxanthin with the original pACCA25ΔcrtX (187 ± 23 μg/g [dry weight]), whose gene order is native (PcrtE-crtE-crtY-crtI-crtB and convergent directional PcrtZ-crtZ [19]). Since differences between plasmids are known to affect carotenoid synthesis (20), we examined the effect of a pGETS109SfiI vector by inserting an NheI-HindIII fragment (6.5 kbp) carrying the carotenoid biosynthesis genes. Synthesis of zeaxanthin with the resultant pGETS109CAR25ΔcrtX plasmid (609 ± 14 μg/g [dry weight]) was 3.3-fold higher than that of zeaxanthin with pACCAR25ΔcrtX (Fig. 3).

FIG. 3.

FIG. 3.

Time course of the production of zeaxanthin (μg/g [dry weight {dw}]) in E. coli JM109 transformants with pCrtP series plasmids.

Improvement of the assembly efficiency of the OGAB method.

A possible reason why pCrtP-YZEBI and pCrtP- IYZEB could not be obtained by the OGAB method is the toxicity of the gene products of these plasmids to B. subtilis. In order to rigorously repress the gene expression of these plasmids in B. subtilis, we used a pR/cI repressor system (4). By replacement of the promoter and host cells with a pR promoter from the λ phage (Fig. 2B, bottom) and B. subtilis BUSY9166 cells expressing the cI repressor, respectively, all five circularly permuted plasmids (Fig. 2C) were obtained by the OGAB method; these were named the pPrP series. The efficiencies of the emergence of colonies with correct assemblies were 100% for pPrP-EBIYZ, 75% for pPrP-ZEBIY, 42% for pPrP-YZEBI, 33% for pPrP-IYZEB, and 92% for pPrP-BIYZE. These values are superior to those for the pCrtP series.

Carotenoid biosynthesis in E. coli GI724 with the pPrP series plasmids.

Five pPrP plasmids were separately introduced into E. coli GI724, in which the cI repressor is expressed and might repress the pR promoter to allow the expression of the relevant operons. In GI724, only a limited amount of carotenoids (<20 μg/g [dry weight]) was produced with pPrP series plasmids (Fig. 4, 0 h). When tryptophan was added to the culture in order to cancel the cI repression on the pR promoter, all the transformants produced carotenoids (Fig. 4). Analogously with the case of the pCrtP series, the highest carotenoid content was obtained in the transformant with pPrP-EBIYZ, which is the order in the zeaxanthin biosynthetic pathway (Fig. 1B), though not only zeaxanthin but also the precursors β-cryptoxanthin and β-carotene were included in the products. With the other four plasmids, little or no β-cryptoxanthin or β-carotene was observed. We also measured the concentrations of lycopene for all plasmids, but the values were below the detection limit. In most cases, the zeaxanthin content gradually increased, reaching a maximum after 12 h, whereas that of the transformant with pPrP-ZEBIY rapidly reached a maximum after 4 h (Fig. 4).

FIG. 4.

FIG. 4.

Time course of the production of β-carotene, β-cryptoxanthin, and zeaxanthin in E. coli GI724 transformants with pPrP series plasmids. dw, dry weight.

Expression profiles of the carotenoid genes in E. coli.

By use of real-time RT-PCR, the mRNA copy numbers of the five carotenoid genes in E. coli GI724 cells transformed with pPrP plasmids were determined. Before induction of gene expression, the copy numbers were low, but the expression level of the fifth gene positioned at the 3′ end of each operon seemed relatively high compared with those of genes at other positions (Fig. 5, 0 h). This was probably a result of measuring antisense mRNA transcribed from a promoter (P1) in the downstream flanking pBR322 sequence (6), since both mRNA strands can be amplified by the one-step RT-PCR used here. The mRNA expression levels of almost all carotenoid genes were increased at 4 to 8 h after their induction (Fig. 5), correlating with the production of total carotenoids (Fig. 4). Interestingly, the rank order of the gene expression levels in each plasmid corresponded to the sequential order of the five genes in the plasmid, irrespective of the gene content; for all transformants, the most abundant gene among the five genes was located at a downstream flanking position relative to the promoter, and the copy number of the transcript decreased monotonically with increasing separation from the promoter. For example, the five mRNA species in GI724/pPrP-EBIYZ at 8 h were present in the following order of decreasing abundance: crtE (100%), crtB (72%), crtI (22%), crtY (10%), and crtZ (8%), where the percentage is calculated with respect to the mRNA of crtE. The average profiles of mRNA distribution (means ± standard deviations) for the five operons at 8 h decreased monotonically as follows: 100% (first position from the promoter/first position from the promoter), 55% ± 20% (second/first), 27% ± 28% (third/first), 10% ± 6% (fourth/first), and 7% ± 4% (fifth/first). Thus, the mRNA abundance decreases by roughly half from one gene to the next. However, the average reduction rates (means ± standard deviations) between specific pairs of genes at 8 h were as follows: 109% ± 23% (crtB-crtE), 44% ± 29% (crtI-crtB), 55% ± 15% (crtY-crtI), 54% ± 22% (crtZ-crtY), and 33% ± 15% (crtE-crtZ).

FIG. 5.

FIG. 5.

RNA copy numbers of the carotenoid genes (orange, crtE; yellow, crtB; dark green, crtI; light green, crtY; blue, crtZ) in 1 ng of total RNA extracted from the E. coli GI724 transformants with assembled plasmids pPrP-EBIYZ (A), pPrP-ZEBIY (B), pPrP-YZEBI (C), pPrP-IYZEB (D), and pPrP-BIYZE (E) for incubation times of 0, 4, 8, and 12 h after induction. The quantitative real-time PCR data were obtained from at least two independent experiments, and the errors were in the range of 10 to 30%.

DISCUSSION

In this study, we constructed unprecedented zeaxanthin operons from Pantoea ananatis genes in various orders by means of the OGAB method and then expressed them in E. coli to produce zeaxanthin. Among the total of 120 (5!) possible combinatorial orders of the five genes, we chose to construct a series of five plasmids with circularly permuted gene orders, since we thought that this sequential position shift would allow us to evaluate the effect of a drastic position shift of the end-located gene on zeaxanthin production. The highest zeaxanthin production level of 820 μg/g (dry weight) was achieved by E. coli transformed with pCrtP-EBIYZ (Fig. 3), in which the genes were ordered according to the order in the metabolic pathway (Fig. 1B). The yield of zeaxanthin obtained using pCrtP-EBIYZ was improved in comparison with that obtained using the original pACCAR25ΔcrtX (187 μg/g [dry weight]) and also in comparison with other reported values. Ruther et al. examined various plasmids bearing carotenoid genes and various growth conditions for the transformed E. coli, obtaining a maximum zeaxanthin content of 289 μg/g (dry weight) (20). Matthews and Wurtzel increased the zeaxanthin content to 592 μg/g (dry weight) by coexpressing d-1-deoxyxylulose 5-phosphate synthase in E. coli transformed with pACCAR25ΔcrtX (15). While the zeaxanthin content of the strain transformed with pCrtP-EBIYZ was 820 μg/g (dry weight), those of two other two strains harboring pCrtP- ZEBIY and pCrtP-BIYZE were 257 and 172 μg/g (dry weight), respectively, i.e., even less than that of a strain harboring the assembly vector pGETS109CAR25ΔcrtX (609 μg/g [dry weight]), which is identical with the natural cluster. These results strongly imply that the gene order in an operon for a biosynthetic pathway is a very important determinant of the final amount of the product of the biosynthetic pathway.

The order of the genes in an operon also affects gene assembly in B. subtilis by the OGAB method, because two out of the five attempted constructs could not be obtained by using the pCrtP vector containing a Pantoea ananatis crtE promoter. Since no carotenoids were produced by B. subtilis strains with any of the pCrtP series plasmids, there are significant metabolic differences between B. subtilis and E. coli, and it remained possible that the two operons that could not be assembled in B. subtilis might be effective for expression in E. coli, if they could be prepared. To construct a complete set of circularly permuted operons by the OGAB method, we tried to repress the operon expression during OGAB assembly. To this end, the pR promoter was introduced into an assembly vector, and the assembly with this vector was performed in B. subtilis expressing the cI repressor. The combination of the pPrP vector, including the pR promoter and the BUSY9166-expressing cI repressor, allows successful preparation of all five constructs in B. subtilis. This result suggests that repressing the expression of foreign genes in B. subtilis is important for their assembly by the OGAB method.

How does the sequential order of the five carotenoid genes in each operon affect the amounts of their metabolic products? The results of real-time RT-PCR show that the mRNA expression pattern of the five genes was different for each plasmid. For all transformants, abundant genes among the five genes were located near the 5′ end of the operon and low-content genes were located near the 3′ end (Fig. 5). The reason is presumably runoff transcription or mRNA degradation by 3′→5′ exoribonucleases (7). Though there were some reduction biases, depending on specific genes, the average mRNA distribution profile decreased monotonically, roughly at a rate of one-half per gene (the average gene size is approximately 1 kb). Although the expression of each enzyme could not be directly quantified by two-dimensional electrophoresis, due to the low levels (data not shown), several theoretical studies have indicated that temporal enzyme expression is a powerful means for cells to adjust their metabolism (12, 28). Since abundant synthesis of an enzyme whose substrate is not fully supplied is uneconomical, a sequential expression pattern according to the biosynthetic pathway may be optimal for efficient synthesis of the product. More simply, the higher crtE expression level may be the main reason for the higher yield of carotenoids in E. coli with pPrP-EBIYZ, because the conversion from FPP to GGPP catalyzed by CrtE is the first bottleneck in the isoprenoid biosynthetic pathway (26).

Although the total amount of carotenoids in GI724/pPrP-EBIYZ was large, the ratio of zeaxanthin to total carotenoids was approximately 1/2 and was the lowest among all of the circularly permuted operons. Because the remaining carotenoids in GI724/pPrP-EBIYZ were β-carotene and β-cryptoxanthin, which are substrates of crtZ, it seems that crtZ expression levels several times greater would be required for complete conversion to zeaxanthin. Simply repositioning crtZ from the end position to a downstream flanking position in relation to the promoter might achieve this. Indeed, pPrP-ZEBIY, which has just this positioning, produced zeaxanthin in the highest purity, though the amount of carotenoids was small (Fig. 4). The natural carotenoid cluster has a secondary promoter only for the crtZ expression (Fig. 1), and this may contribute to maintaining zeaxanthin production at a high level.

In summary, we demonstrated that the rearrangement of crt genes by the OGAB method is a useful approach for metabolic engineering of carotenoid production. Further, we improved the efficiency of the OGAB assembly by using a pR promoter-cI repressor system. In the OGAB method, a variety of operons, each having a desired gene order, can be efficiently obtained. We believe that the study of new operons obtained by the OGAB method would also be useful for investigating the design principles of other metabolic pathways.

Acknowledgments

We thank Norihiko Misawa (Marine Biotechnology Institute, Japan) for plasmids pCAR25 and pACCAR25ΔcrtX.

This research was supported in part by the Development of a Technological Infrastructure for Industrial Bioprocess (2000 to 2006) program of the New Energy and Industrial Technology Development Organization (NEDO), which is under the auspices of the Ministry of Economy, Trade and Industry (METI) of Japan.

Footnotes

▿

Published ahead of print on 28 December 2006.

REFERENCES

  • 1.Al-Babili, S., and P. Beyer. 2005. Golden Rice—five years on the road—five years to go? Trends Plant Sci. 10:565-573. [DOI] [PubMed] [Google Scholar]
  • 2.Alper, H., K. Miyaoku, and G. Stephanopoulos. 2005. Construction of lycopene-overproducing E. coli strains by combining systematic and combinatorial gene knockout targets. Nat. Biotechnol. 23:612-616. [DOI] [PubMed] [Google Scholar]
  • 3.Bendich, A. 2004. From 1989 to 2001: what have we learned about the “biological actions of β-carotene”? J. Nutr. 134:225-230. [DOI] [PubMed] [Google Scholar]
  • 4.Breitling, R., A. V. Sorokin, and D. Behnke. 1990. Temperature-inducible gene expression in Bacillus subtilis mediated by the cI857-encoded repressor of bacteriophage lambda. Gene 93:35-40. [DOI] [PubMed] [Google Scholar]
  • 5.Britton, G. 1985. General carotenoid methods. Methods Enzymol. 111:113-149. [DOI] [PubMed] [Google Scholar]
  • 6.Brosius, J., R. L. Cate, and A. P. Perlmutter. 1982. Precise location of two promoters for the β-lactamase gene of pBR322. S1 mapping of ribonucleic acid isolated from Escherichia coli or synthesized in vitro. J. Biol. Chem. 257:9205-9210. [PubMed] [Google Scholar]
  • 7.Deutscher, M. P. 2006. Degradation of RNA in bacteria: comparison of mRNA and stable RNA. Nucleic Acids Res. 34:659-666. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Itaya, M. 1999. Effective cloning of unmarked DNA fragment in the Bacillus subtilis 168 genome. Biosci. Biotechnol. Biochem. 63:602-604. [DOI] [PubMed] [Google Scholar]
  • 9.Itaya, M., T. Nagata, T. Shiroishi, K. Fujita, and K. Tsuge. 2000. Efficient cloning and engineering of giant DNAs in a novel Bacillus subtilis genome vector. J. Biochem. 128:869-875. [DOI] [PubMed] [Google Scholar]
  • 10.Jones, K. J., S. J. Kim, and J. D. Keasling. 2000. Low-copy plasmids can perform as well as or better than high-copy plasmids for metabolic engineering of bacteria. Metab. Eng. 2:328-338. [DOI] [PubMed] [Google Scholar]
  • 11.Kim, S. W., and J. D. Keasling. 2001. Metabolic engineering of the nonmevalonate isopentenyl diphosphate synthesis pathway in Escherichia coli enhances lycopene production. Biotechnol. Bioeng. 72:408-415. [DOI] [PubMed] [Google Scholar]
  • 12.Klipp, E., R. Heinrich, and H. G. Holzhütter. 2002. Prediction of temporal gene expression: metabolic optimization by re-distribution of enzyme activities. Eur. J. Biochem. 269:5406-5413. [DOI] [PubMed] [Google Scholar]
  • 13.LaVallie, E. R., E. A. DiBlasio, S. Kovacic, K. L. Grant, P. F. Schendel, and J. M. McCoy. 1993. A thioredoxin gene fusion expression system that circumvents inclusion body formation in the E. coli cytoplasm. Bio/Technology 11:187-193. [DOI] [PubMed] [Google Scholar]
  • 14.Lee, P. C., and C. Schmidt-Dannert. 2002. Metabolic engineering towards biotechnological production of carotenoids in microorganisms. Appl. Microbiol. Biotechnol. 60:1-11. [DOI] [PubMed] [Google Scholar]
  • 15.Matthews, P. D., and E. T. Wurtzel. 2000. Metabolic engineering of carotenoid accumulation in Escherichia coli by modulation of the isoprenoid precursor pool with expression of deoxyxylulose phosphate synthase. Appl. Microbiol. Biotechnol. 53:396-400. [DOI] [PubMed] [Google Scholar]
  • 16.Mieshendahl, M., T. Petri, and U. Hänggi. 1986. A novel prophage independent trp regulated lambda PL expression system. Bio/Technology 4:802-808. [Google Scholar]
  • 17.Mijts, B. N., and C. Schmidt-Dannert. 2003. Engineering of secondary metabolite pathways. Curr. Opin. Biotechnol. 14:597-602. [DOI] [PubMed] [Google Scholar]
  • 18.Misawa, N., and H. Shimada. 1997. Metabolic engineering for the production of carotenoids in non-carotenogenic bacteria and yeasts. J. Biotechnol. 59:169-181. [DOI] [PubMed] [Google Scholar]
  • 19.Misawa, N., M. Nakagawa, K. Kobayashi, S. Yamano, Y. Izawa, K. Nakamura, and K. Harashima. 1990. Elucidation of the Erwinia uredovora carotenoid biosynthetic pathway by functional analysis of gene products expressed in Escherichia coli. J. Bacteriol. 172:6704-6712. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Ruther, A., N. Misawa, P. Böger, and G. Sandmann. 1997. Production of zeaxanthin in Escherichia coli transformed with different carotenogenic plasmids. Appl. Microbiol. Biotechnol. 48:162-167. [DOI] [PubMed] [Google Scholar]
  • 21.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • 22.Tsuge, K., K. Matsui, and M. Itaya. 2003. One step assembly of multiple DNA fragments with a designed order and orientation in Bacillus subtilis plasmid. Nucleic Acids Res. 31:e133. http://nar.oxfordjournals.org/cgi/content/full/31/21/e133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Umeno, D., A. V. Tobias, and F. H. Arnold. 2005. Diversifying carotenoid biosynthetic pathways by directed evolution. Microbiol. Mol. Biol. Rev. 69:51-78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Uozumi, T., T. Hoshino, K. Miwa, S. Horinouchi, T. Beppu, and K. Arima. 1977. Restriction and modification in Bacillus species: genetic transformation of bacteria with DNA from different species, part I. Mol. Gen. Genet. 152:65-69. [DOI] [PubMed] [Google Scholar]
  • 25.Vadali, R. V., Y. Fu, G. N. Bennett, and K. Y. San. 2005. Enhanced lycopene productivity by manipulation of carbon flow to isopentenyl diphosphate in Escherichia coli. Biotechnol. Prog. 21:1558-1561. [DOI] [PubMed] [Google Scholar]
  • 26.Wang, C. W., M. K. Oh, and J. C. Liao. 1999. Engineered isoprenoid pathway enhances astaxanthin production in Escherichia coli. Biotechnol. Bioeng. 62:235-241. [DOI] [PubMed] [Google Scholar]
  • 27.Yuan, L. Z., P. E. Rouviere, R. A. LaRossa, and W. Suh. 2006. Chromosomal promoter replacement of the isoprenoid pathway for enhancing carotenoid production in E. coli. Metab. Eng. 8:79-90. [DOI] [PubMed] [Google Scholar]
  • 28.Zaslaver, A., A. E. Mayo, R. Rosenberg, P. Bashkin, H. Sberro, M. Tsalyuk, M. G. Surette, and U. Alon. 2004. Just-in-time transcription program in metabolic pathways. Nat. Genet. 36:486-491. [DOI] [PubMed] [Google Scholar]

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES