Skip to main content
Applied and Environmental Microbiology logoLink to Applied and Environmental Microbiology
. 2007 Jan 26;73(6):1892–1898. doi: 10.1128/AEM.02219-06

Diagnostic Real-Time PCR Assays for the Detection of Emetic Bacillus cereus Strains in Foods and Recent Food-Borne Outbreaks▿ †

Martina Fricker 1, Ute Messelhäußer 2, Ulrich Busch 2, Siegfried Scherer 1, Monika Ehling-Schulz 1,*
PMCID: PMC1828801  PMID: 17259359

Abstract

Cereulide-producing Bacillus cereus can cause an emetic type of food-borne disease that mimics the symptoms provoked by Staphylococcus aureus. Based on the recently discovered genetic background for cereulide formation, a novel 5′ nuclease (TaqMan) real-time PCR assay was developed to provide a rapid and sensitive method for the specific detection of emetic B. cereus in food. The TaqMan assay includes an internal amplification control and primers and a probe designed to target a highly specific part of the cereulide synthetase genes. Additionally, a specific SYBR green I assay was developed and extended to create a duplex SYBR green I assay for the one-step identification and discrimination of the two emesis-causing food pathogens B. cereus and S. aureus. The inclusivity and exclusivity of the assay were assessed using a panel of 100 strains, including 23 emetic B. cereus and 14 S. aureus strains. Different methods for DNA isolation from artificially contaminated foods were evaluated, and established real-time assays were used to analyze two recent emetic food poisonings in southern Germany. One of the food-borne outbreaks included 17 children visiting a day care center who vomited after consuming a reheated rice dish, collapsed, and were hospitalized; the other case concerned a single food-poisoning incident occurring after consumption of cauliflower. Within 2 h, the etiological agent of these food poisonings was identified as emetic B. cereus by using the real-time PCR assay.


Bacillus cereus is increasingly recognized as the etiological agent of gastrointestinal and nongastrointestinal diseases. Two clinical pictures connected to food poisoning, diarrhea and emesis, can be distinguished. Heat-labile enterotoxins elicit diarrhea, while a heat-stable depsipeptide toxin, called cereulide, provokes emesis (for a review, see the works of Granum [18], Ehling-Schulz et al. [13], and Schoeni and Wong [43]). In general, both types of food-borne disease are relatively mild and self-limiting. Nevertheless, during the last few years, severe forms of disease caused by emetic B. cereus have occasionally involved hospitalization or even death (11, 27). Due to the increasing number of reports of food-borne disease, especially of severe cases, fast detection methods are required for diagnostic purposes as well as for the prevention of food contamination and food-borne outbreaks.

The true incidence of B. cereus food poisoning is unknown for a number of reasons, including misdiagnosis of the disease, which is symptomatically similar to other types of food poisoning. For example, the symptoms caused by emetic B. cereus resemble those caused by Staphylococcus aureus (13). Standard detection methods with enrichment, plating, and further identification require 3 days for B. cereus and up to 6 days for S. aureus (4, 30, 37). For the conclusive identification of the emetic toxin cereulide from B. cereus strains, additional laborious methods, such as high-performance liquid chromatography connected to ion trap mass spectrometry, are necessary (19). Only recently has progress been made in the development of molecular detection systems for emetic B. cereus strains. The first molecular assays, based on conventional PCR systems, for the identification of emetic strains and the detection of the toxin gene have been described previously (e.g., by Ehling-Schulz et al. [14, 15]). However, a major drawback of conventional PCR is the requirement for post-PCR analysis by gel electrophoresis, which is time consuming and bears the risk of false-positive results due to laboratory contamination.

The introduction of real-time PCR provides the opportunity for the rapid detection of pathogens in food and clinical settings. Apart from saving time, real-time PCR is highly specific and sensitive and offers the potential for quantification (25). The risk of cross-contamination is significantly reduced, and high-throughput performance and automation are possible since no post-PCR manipulations are required.

Recently, the biosynthetic code for nonribosomal synthesis of the emetic toxin cereulide has been deciphered (16, 26). We used this genetic information to develop a TaqMan-based, real-time PCR assay. The assay targets a highly specific part of the cereulide synthetase (ces) genes and includes an internal amplification control (IAC). In addition, a duplex SYBR green I real-time PCR assay for one-step differentiation between emetic B. cereus and S. aureus is reported. These novel diagnostic assays were successfully applied to identify of the causative agent of recent emetic food-poisoning outbreaks.

MATERIALS AND METHODS

Bacterial strains.

The reference strain for emetic toxin, B. cereus F4810/72, was used to develop both real-time PCR systems; in addition, S. aureus strain WS2608 was included to establish the duplex real-time PCR assay. Bacterial strains (n = 100) used to assess the inclusivity and exclusivity of the real-time PCR assays are listed in Table 1. Details on the origin of the bacterial strains included in this study are provided in the supplemental material. Strains were grown either on Luria-Bertani (LB) agar or in LB broth (10 g tryptone, 5 g NaCl, 5 g yeast extract, 15 g agar per liter) as described previously (14).

TABLE 1.

Bacterial species used to test the inclusivity and exclusivitya of the SYBR green I and TaqMan real-time PCR assays

Bacterial species (no. of species) No. of strains tested Result with the indicated detection method
TaqMan PCR SYBR green simplex SYBR green duplex
Bacillus cereus group (n = 5)
    Non-emetic Bacillus cereus 16 − − −
    Emetic Bacillus cereus 23 + + +
    Bacillus thuringiensis 4 − − −
    Bacillus mycoides 4 − − −
    Bacillus weihenstephanensis 4 − − −
    Bacillus anthracis 4 − − −
Bacillus sp. (n = 5)
    Bacillus brevis 3 − − −
    Bacillus subtilis 1 − − −
    Bacillus licheniformis 3 − − −
    Bacillus amyloliquefaciens 1 − − −
    Bacillus megaterium 1 − − −
Non-Bacillus species (n = 7)
    Staphylococcus aureus 14 − − +
    Clostridium perfringens 3 − − −
    Listeria monocytogenes 4 − − −
    Campylobacter sp. 3 − − −
    Escherichia coli (including serovar O157) 4 − − −
    Salmonella sp. 4 − − −
    Yersinia enterocolitica 4 − − −
Total no. of strains 100
a

Inclusivity and exclusivity are defined according to Malorny et al. (29).

DNA isolation.

Total DNA from strains used to test the specificity of the developed PCR assays was isolated from overnight cultures using the AquaPure genomic DNA isolation kit (Bio-Rad, Germany) according to the manufacturer's instructions. For the determination of the detection limit of the real-time PCR assays, B. cereus DNA from the emetic reference strain F4810/72 and the S. aureus strain WS2608 were isolated by phenol-chloroform extraction as described previously (9, 14) to obtain pure high-molecular-weight genomic DNA. For sensitivity and specificity tests, total DNA from food samples was isolated using either the AquaPure genomic DNA isolation kit (Bio-Rad, Germany) or the NucleoSpin food kit (Macherey-Nagel, Germany) according to the manufacturer's instructions. In addition, DNA from food samples was extracted using a simple boiling method. In brief, cells from 1 ml enriched samples were harvested by centrifugation and cell pellets were resuspended in 300 μl sterile Milli-Q, boiled for 10 min, and then cooled on ice. After cell and food residues were pelleted, a 5-μl aliquot of the supernatant was used as PCR template.

Primer and TaqMan probe design.

Primers and probes used in this study are listed in Table 2. The emetic B. cereus-specific TaqMan primers and probe as well as the SYBR green I primers were derived from the cereulide synthetase (ces) gene sequence (accession no. DQ360825), thereby targeting a region of the ces genes shown to be highly specific for emetic B. cereus (12). TaqMan and IAC primers and probes were designed using Primer3 software (frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). For the amplification of an S. aureus-specific genomic DNA fragment, primers targeting the tuf gene (31), which encodes the elongation factor Tu, were included in the SYBR green I-based real-time PCR assay. The specificity of the sequences was tested by searches against NCBI's nonredundant database using the BLASTN algorithm (5). All primers and probes were purchased from MWG Biotech (Germany). The target probe for emetic B. cereus was labeled at the 5′ end with the reporter dye 6-carboxyfluorescein, and the IAC probe was labeled at the 5′ end with 5-hexachloro-6-carboxyfluorescein. Both probes were labeled at the 3′ ends with tetramethyl-6-carboxyrhodamine.

TABLE 2.

Primers and probes used in this study

Primer Sequence from 5′ to 3′ enda Position Sequence reference Amplicon length Reference
ces_SYBR_F CACGCCGAAAGTGATTATACCAA 8743-8765 DQ360825 176 bp This study
ces_SYBR_R CACGATAAAACCACTGAGATAGTG 8895-8918
sa_SYBR_F CGTGTTGAACGTGGTCAAATCA 389-410 AF298796 262 bp Derived from reference 30
sa_SYBR_R CACCTTCGTCTTTTGATAATACG 628-650
ces_TaqMan_for CGCCGAAAGTGATTATACCAA 8745-8765 DQ360825 103 bp This study
ces_TaqMan_rev TATGCCCCGTTCTCAAACTG 8828-8847
ces_TaqMan_probe FAM-GGGAAAATAACGAGAAATGCA-TAMRA 8798-8818
IAC_for GCAGCCACTGGTAACAGGAT 1216-1235 L09137 118 bp This study
IAC_rev GCAGAGCGCAGATACCAAAT 1314-1333
IAC_probe HEX-AGAGCGAGGTATGTAGGCGG-TAMRA 1240-1259
a

FAM, 6-carboxyfluorescein; HEX, 5-hexachloro-6-carboxyfluorescein; TAMRA, tetramethyl-6-carboxyrhodamine.

Internal amplification control.

The commercially available plasmid pUC19 (Fermentas, Germany) was used as the IAC without any modifications. The TaqMan primers and probe were placed in the pMB1 replicon rep (Table 2). The optimal IAC concentration was assessed to be approximately 170 copies per PCR.

Real-time PCR assays.

A typical 25-μl PCR mixture for the TaqMan-based PCR assay contained 12.5 μl Brilliant QPCR Multiplex Mastermix (Stratagene), 0.5 μM of each primer (for emetic B. cereus and IAC each), 0.2 μM emetic B. cereus probe (ces_TaqMan_probe) and 0.2 μM IAC probe (IAC_probe), approximately 170 copies of plasmid DNA pUC19 (Fermentas, Germany), and 5 μl of the sample DNA. No-template controls that contained 5 μl Tris-EDTA buffer instead of DNA were included in each run to detect any contamination. Typical cycling conditions under a Stratagene MX3000P real-time PCR system (Stratagene) were 95°C for 10 min, followed by 40 cycles at 95°C for 15 s and 55°C for 60 s. The maximum ramp rate of the Stratagene MX3000P real-time PCR system was 2.5°C/s. A typical 25-μl PCR mixture for the SYBR green I real-time PCR assay consisted of 12.5 μl SYBR Premix Ex Taq (Takara Bio, Inc., Japan), 1 to 5 μl of template DNA (depending on extraction method), 0.3 μM for each B. cereus primer (ces_SYBR_F and ces_SYBR_R), and 0.12 μM for each S. aureus primer (sa_SYBR_F and sa_SYBR_R). Typical cycling conditions using a Stratagene MX3000P real-time PCR system (Stratagene) were 95°C for 10 s, followed by 45 cycles at 95°C for 10 s and 60°C for 30 s. The same conditions were used with the SmartCyclerII system (Cepheid), but with the ramp rate set on maximum (10°C/s) for the simplex detection of emetic B. cereus strains and altered to 3°C/s for simplex and duplex detection involving the primers specific for S. aureus. In the subsequent melting curve analysis, the temperature was raised from 60°C to 95°C with a ramp rate of 0.2°C/s. The specificity and robustness of the assays were tested in two independent labs on two different cycler systems (Stratagene MX3000P and SmartCyclerII), revealing consistent results and similar detection limits.

Standard curves and efficiency.

Total DNA from the strain F4810/72 used for the standard curves was isolated with phenol-chloroform extraction as described above. The concentration of DNA was determined by using a NanoDrop ND-1000 UV/Vis spectrophotometer (NanoDrop Technologies). Standard curves were generated using a tenfold dilution series of DNA ranging from 600 ng to 6 fg for the TaqMan assay on the Stratagene MX3000P as well as for the SYBR green I simplex assay on the SmartCyclerII. Cycle threshold (CT) values were calculated with the standard algorithms provided with the two cycler systems. The PCR efficiency (E) was calculated according to the method of Pfaffl (34) from the standard curve with the equation E = 10−1/slope − 1. Additionally, an assay precision test according to the method of Malorny et al. (29) was performed for the TaqMan and the SYBR green I simplex real-time assays.

Standard reference culture methods.

Cell counts in food samples were determined in accordance with standard reference culture methods recommended by food authorities (§64 Lebensmittel-, Bedarfsgegenstände- und Futtermittelgesetzbuch [LFGB], International Organization for Standardization [ISO], and the U.S. Food and Drug Administration [FDA]). In brief, 25 g of food sample was homogenized in a stomacher (Lab-Blender 400; Kleinfeld Labortechnik, Germany) with 225 ml BHIG broth (brain heart broth [Merck, Germany] supplemented with 0.1% glucose) and was incubated at 37°C for 24 h without shaking. Serial dilutions of the enrichment were plated on LB, PEMB (polymyxin-egg yolk-mannitol-bromothymol blue agar [Oxoid, Germany]), and Baird Parker agar and incubated at 37°C as prescribed.

Artificial inoculation of food samples.

Rice and pasta were purchased from local food stores in Germany. Food samples were cooked and tested for the absence of any naturally occurring contamination with B. cereus and S. aureus by the standard reference culture methods described above. As no B. cereus and S aureus bacteria were detected, the food was used for artificial contamination. Twenty-five grams of cooked rice or pasta was homogenized with 225 ml BHIG broth, and the mixture was inoculated with serial dilutions of F4810/72 and/or WS2608 overnight culture in the range of 100 to 103 CFU/g food. Enrichment was carried out at 37°C without shaking. Samples were taken after 0, 2, 4, and 6 h of enrichment for DNA isolation and the determination of cell counts on LB, PEMB, or Baird Parker agar. One-milliliter aliquots of enriched samples were centrifuged (13,000 × g for 4 min), and pellets were stored at −20°C until DNA isolation and PCR analysis. DNA isolation was carried out using the (i) AquaPure genomic DNA isolation kit (Bio-Rad, Germany), (ii) NucleoSpin food kit (Macherey-Nagel, Germany), and (iii) simple boiling method in parallel.

Investigation of two emetic outbreaks.

DNA for real-time PCR was isolated directly from the food remnants connected to two recent emetic outbreaks in southern Germany by using the commercial DNA isolation kits and the simple boiling method as described above. Additional cell counts were determined with the standard reference culture methods but without enrichment. Cereulide was extracted from the food remnants as follows: 5 g sample was homogenized in 5 ml sterile Milli-Q and was autoclaved (20 min at 21°C). Ten microliters of the supernatant was then tested in a HEp-2 cell culture assay as described previously (16). The commercially available enzyme-linked immunosorbent assay system VIDAS Staph enterotoxin II (bioMérieux, France) was used to test the food remnants for S. aureus enterotoxins according to the manufacturer's instructions.

RESULTS AND DISCUSSION

Design and analytical accuracy of real-time PCR assays for emetic B. cereus.

Diagnosis of B. cereus linked to the emetic type of food poisoning was hampered by the lack of genetic information on the toxin genes. Only recently were the genes encoding the enzymatic machinery required for biosynthesis of the emetic toxin cereulide identified and characterized (12, 16). Based on this information, primers and a probe were designed for the detection of emetic B. cereus in food by real-time PCR (Table 2). In principle, two different chemistries are available for real-time detection of PCR products: fluorescent probes that bind specifically to certain DNA sequences and fluorescent dyes that intercalate in any double-stranded DNA. Within this study, a 5′ nuclease (TaqMan) real-time PCR for diagnostic purposes as well as a SYBR green I-based system, representing an interesting economic alternative for high-throughput screening purposes, was developed. The primers of both PCR systems and the TaqMan probe anneal within an unusual insertion in the cesA1 domain which encodes a novel type of α-ketoreductase that performs chiral reduction of α-ketoacyl-S-carrier proteins as opposed to the typical ketoreductases found in polyketide synthetases (26). This insertion has been shown to be highly specific for emetic B. cereus by hybridization studies and database analysis (12). The primers used for the SYBR green I detection of these strains were selected in such a way as to give optimal results when combined with the primers specific for the S. aureus detection in the duplex assay, whereas the primers and the probe used for the TaqMan assay were designed with the Primer3 software and are located within the sequence amplified by the primers used for the SYBR green I assay. As the use of IAC in diagnostic PCR is becoming mandatory (20, 28), an IAC was included in the TaqMan assay (for details, see Materials and Methods). Such an internal control indicates the presence of PCR amplification inhibitors or the malfunction of the thermal cycler (3, 42).

The inclusivity and exclusivity (according to Malorny et al. [30]) of the TaqMan and SYBR green I assays were assessed using a test panel of 100 strains, including 23 emetic strains from different origins (Table 1; see Table S1 in the supplemental material). Only the emetic B. cereus strains showed positive results in the above-mentioned assays; all of the other strains tested negative. No cross-reaction was observed for any of the strains included in the test panel (Table 1); nevertheless the strain set included nonemetic B. cereus strains that carry potential nrps genes and known NRPS-carrying bacteria like the gramicidin and tyrocidine producer Bacillus brevis. The detection limits of the developed TaqMan (including the IAC) and the SYBR green I assays were determined in two independent runs with tenfold serial dilutions from purified genomic DNA of the reference strain for emetic toxin F4810/72. The limits were 0.6 pg for the TaqMan assay and 0.06 pg for the SYBR green I assay. The PCR amplification efficiency, calculated according to the method of Pfaffl (34), was 108% for the TaqMan assay and 91.5% for the SYBR green I assay (data not shown). Results for the detection probability from dilution series from pure culture are provided in the supplemental material. In addition, serial dilutions of B. cereus DNA were used to determine the precision of both assays as described previously by Malorny et al. (29). The repeatability standard deviation sr was calculated by using the measured mean CT values of 10 replicates from four consecutive runs (Table 3). The calculated sr values for the TaqMan (1.5 to 2.2%) and the SYBR green I assay (1.5 to 3.3%) indicate the high precision of the assay.

TABLE 3.

Mean CT and sr of tenfold serially diluted DNA from the reference strain for emetic toxin F4810/72 in the TaqMan real-time PCR assay in the presence of 170 IAC copy numbers and in the SYBR green simplex PCR assay

Amt of emetic B. cereus DNA/PCR Mean CT and sr usinga:
SYBR green simplex TaqMan PCR
ces-specific probe IAC-specific probe
600 ng 14.82 ± 0.24 18.98 ± 0.37 34.03 ± 2.76
60 ng 18.38 ± 0.27 22.60 ± 0.40 31.14 ± 2.43
6 ng 20.72 ± 0.46 25.73 ± 0.54 30.49 ± 1.48
600 pg 23.61 ± 0.74 28.93 ± 0.59 30.80 ± 1.18
60 pg 29.17 ± 0.52 32.20 ± 0.49 30.87 ± 1.13
6 pg 32.64 ± 1.07 35.41 ± 0.63 31.07 ± 1.41
0.6 pgb 35.45 ± 0.54 37.69 ± 0.83 30.96 ± 1.26
a

Results are shown as CT ± sr. CT values were calculated with the standard algorithms provided with the two cycler systems; sr values were calculated from 10 replicates from four consecutive runs.

b

Approximately 100 genomic equivalents correspond to 0.6 pg.

Recently, it has been shown that the cereulide synthetase gene cluster is located on a 208-kb megaplasmid that has high homology to the plasmids pXO1 of Bacillus anthracis and pBc10987 of B. cereus ATCC 10987 (12). According to Rasko et al. (35, 36), these are low-copy plasmids with copy numbers of between 1 and 3 per cell. Assuming similar numbers for the pBCE4810 plasmid, the detection limit of the real-time PCR assay (for pure cultures) would correspond to approximately 10 genomic equivalents for the SYBR green I simplex PCR assay and 100 genomic equivalents for the TaqMan assay (deduced from the genome size of B. cereus ATCC 10987 and calculated with the formula proposed by Rodríguez-Lázaro et al. [39]).

Duplex real-time PCR assay for one-step differentiation of two emesis-causing pathogens: B. cereus and S. aureus.

B. cereus and S. aureus are broadly distributed microorganisms that are often transferred to foodstuff. Typical cell counts in food samples connected to food poisoning are 105 to 108 CFU B. cereus/g (18) or 106 to 108 CFU S. aureus/g (21), sometimes less. Microbial norms in most countries tolerate low numbers of these pathogens, but threshold values often depend on the foodstuff in question, its further preparation (reheating or ready to eat), and the potential consumer (young, old, or immunocompromised people). For example, threshold values for B. cereus in Germany vary from 102 CFU/g in baby food to 104 CFU/g in spices (6) and those for S. aureus in France vary from 0 CFU/g in semicanned food to 103 CFU/g in some raw milk cheeses (24). Since the emetic syndrome caused by B. cereus cannot be differentiated symptomatically from intoxications with S. aureus (13), one-step detection and differentiation between these two pathogens would improve the speed and accuracy of diagnosis significantly. Of food-poisoning cases in which S. aureus had been suspected to be the causative agent, in only 2% (1 out of 50) was S. aureus identified (D. Mäde [Halle, Germany], personal communication). However, B. cereus was the main cause of food-borne disease from mass-catered food prepared by and served to the German Armed Forces from 1985 to 2000 and the most common pathogen isolated from food-borne illness in 1990 in Norway (2, 23). It is therefore tempting to speculate that a significant portion of those cases in which the causative agent remained unknown were actually elicited by emetic B. cereus.

SYBR green I-based duplex PCR has been shown to be suitable for the one-step detection and differentiation of food and plant pathogens (1, 8, 22). Product accumulation during PCR is monitored by the double-stranded DNA-specific cyanine dye SYBR green I, followed by the identification of amplicons by melting curve analyses. The melting temperature (Tm) of an amplicon depends on its GC content, length, and sequence characteristics, whereby different PCR products can be distinguished (38). We used this discriminatory feature to design a duplex real-time PCR assay for the one-step differentiation between emetic B. cereus and S. aureus.

The emetic B. cereus-specific primers (ces_SYBR_F and ces_SYBR_R) designed for the simplex assay were used in combination with S. aureus-specific primers (sa_SYBR_F and sa_SYBR_R) derived from published primers targeting the tuf gene (31). These primers allowed the amplification of PCR products with distinct melting temperature values, resulting in the formation of two distinct peaks representing the two targets (Fig. 1A). The 176-bp amplicon of emetic B. cereus (Tm, 80.0°C; GC content of 35%) could be clearly separated from the 262-bp amplicon of S. aureus (Tm, 83.5°C; GC content of 40%). Melting points showed a higher degree of variation in the duplex real-time PCR assay than in the simplex assay, but both amplicons were still clearly distinguishable from each other (Fig. 1A). The Tm in duplex PCR was 79.3 ± 0.2°C for the emetic B. cereus-specific amplicon and 83.4 ± 0.2°C for the S. aureus-specific amplicon. Detection limits in the SYBR green reactions were 0.06 pg for emetic B. cereus and 5 pg for S. aureus. The robustness of the duplex real-time PCR was tested with serial tenfold dilutions of DNA from one pathogen in the presence of constant amounts of DNA from the other pathogen. The results of two independent runs were comparable and are shown in Table 4. In brief, in the presence of 50 ng of S. aureus DNA, 0.5 pg of emetic B. cereus DNA could be detected, while amounts as low as 5 pg of S. aureus DNA could be detected in the presence of 50 ng of emetic B. cereus DNA.

FIG. 1.

FIG. 1.

(A) Melting curves of SYBR green I real-time PCR products used for the detection of emetic Bacillus cereus (F4810/72) and Staphylococcus aureus (WS2608). DNA was isolated with the NucleoSpin food kit from a duplex enrichment experiment with artificial inoculated rice after 6 h. Cell counts correspond to 108 CFU/g F4810/72 and 107 CFU/g WS2608 (Table 5). The melting point of emetic B. cereus in the simplex reaction is about 80.0°C and shifts down to 79.3°C in the duplex reaction, whereas the melting point for S. aureus is about 83.4°C in both reactions. (B) Melting curves of the duplex SYBR green I real-time PCR products from the food-borne outbreaks (for details on the outbreaks, see Results and Discussion). Only the amplicon specific for emetic B. cereus could be detected in both cases.

TABLE 4.

Robustness of the duplex SYBR green I real-time PCR for emetic B. cereus and S. aureus

Amt of DNA used as template
Species detecteda
Emetic B. cereus S. aureus Emetic B. cereus S. aureus
50 ng 0.5 pg + −
50 ng 50 pg + +
50 ng 50 ng + +
50 pg 50 ng + +
0.5 pg 50 ng + +
a

+, species was detected; −, species was not detected.

Real-time analysis of artificially contaminated foods.

Various methods have been described in the literature for DNA extraction from foods for real-time PCR, since it is highly sensitive towards inhibitory substances originating from the food matrix (32). Often these methods include a complexing step (e.g., cetyltrimethylammonium bromide), magnetic beads, or commercially available kits (33, 40, 41), but also simple methods like boiling have been reported to be suitable (10). In this study, two commercially available kits (see Materials and Methods) and a simple boiling method were used for DNA isolation from artificially contaminated foods to evaluate the robustness of the real-time assays.

Different foods were tested for the absence of natural contamination with B. cereus and were then used for artificial contamination experiments. Cooked rice and pasta, which had been inoculated with different amounts of the emetic toxin reference strain F4810/72, were analyzed by real-time PCR and in parallel by standard reference culture methods at different enrichment time points (for details, see Materials and Methods). The experiment was repeated three times independently, and DNA was isolated from two of these experiments. Without enrichment, the detection limit of the TaqMan-based assay including the IAC was 105 CFU/g (17 CFU per reaction) artificially contaminated rice for the boiling method and 103 CFU/g (2 CFU per reaction) for the kit-based DNA isolation method. With SYBR green I chemistry, the detection limit was 103 CFU/g rice for the boiling method and 101 CFU/g with the kit-based DNA isolation method. Considering the increase of cell numbers during enrichment (Table 5), a reliable detection of 100 CFU of emetic B. cereus per gram of food was possible with the simple boiling method after 6 h of enrichment for the TaqMan assay and after 4 h of enrichment for the SYBR green I assay. Using the kit-based DNA isolation methods, the enrichment time could be reduced to 2 h for the SYBR green I assay and to 4 h for the TaqMan assay. But as the kit-based DNA isolation method requires about 2 h (including incubation time), a longer enrichment time in combination with the simple boiling method can accelerate the results of the real-time PCR and lower the cost. Spiking experiments performed with artificially contaminated pasta revealed detection limits similar to those depicted for the rice experiments (data not shown).

TABLE 5.

Cell counts of the enrichment experiment with the reference strain for emetic toxin B. cereus F4810/72 and S. aureus WS2608 in ricea

Enrichment duration Cell count at inoculation level (CFU/g) for:
Enrichment with fresh overnight culture of F4810/72
Duplex enrichment with fresh overnight culture of F4810/72 and WS2608
100 101 102 103 103 (only F4810/72)
103 (only WS2608)
103 (F4810/72 and WS2608 together)
B. cereus S. aureus B. cereus S. aureus
0 h -b 2.0 × 101 3.3 × 102 1.8 × 103 2.6 × 103 7.5 × 103 2.5 × 103 7.9 × 103
2 h 6.0 × 101 1.3 × 102 1.8 × 103 1.6 × 104 2.0 × 104 2.1 × 104 2.8 × 104 2.2 × 104
4 h 9.5 × 102 6.6 × 103 1.7 × 105 2.2 × 106 3.3 × 106 4.2 × 105 5.2 × 106 4.1 × 105
6 h 1.3 × 105 6.6 × 105 2.5 × 107 1.2 × 108 2.2 × 108 1.5 × 107 2.7 × 108 1.2 × 107
a

Italic numbers indicate a positive result in the SYBR green assay, and bold numbers indicate a positive result in the TaqMan assay. DNA was isolated with the simple boiling method for the simplex detection and with the NucleoSpin food kit for duplex detection.

b

No colonies were detectable.

In addition, artificial inoculation experiments were conducted to determine the detection limit of the duplex real-time PCR assay. Rice was inoculated with the emetic reference strain F4810/72 or the S. aureus strain WS2608 or both strains together. Cell counts are provided in Table 5. DNA from these enrichment experiments was isolated with the NucleoSpin food kit. After 6 h of enrichment both pathogens could be detected simultaneously from the same artificially contaminated rice by the SYBR green I duplex assay.

In summary, the diagnostic accuracy of the real-time assays was determined and showed that the developed assays are suitable for the detection of 100 CFU/g emetic B. cereus in foods after a short enrichment time (4 to 6 h), while higher cell numbers (101 to 103 CFU/g) can be detected directly from food samples without the need for further enrichment steps. Since the typical cell counts reported in foods incriminated in emetic outbreaks have been reported to be about 105 to 108 CFU B. cereus/g (18), samples from emetic food poisonings can be processed and analyzed within 1.5 to 4 h, depending on the DNA isolation method applied. In food samples connected to S. aureus intoxications, cell counts of between 105 and 106 CFU/g have been reported (7). The SYBR green duplex assay allowed the detection of 103 CFU S. aureus/g food after 4 h of enrichment and after 6 h of enrichment when emetic B. cereus was present in the same enrichment. However, due to the heat stability of the emesis-causing toxins from both pathogens, molecular analysis by real-time PCR should be supplemented by toxin analysis methods, especially in the cases of reheated foods.

Identification of the etiological agent in recent food-borne outbreaks by real-time PCR.

In June 2006, 17 children (aged 3 to 5 years) visiting a day care center became sick after eating a rice dish with vegetables. One hour after the meal, the children began vomiting, collapsed, and were hospitalized. Food remnants contained 104 CFU B. cereus/g rice dish. Emetic B. cereus was detected in the rice dish by TaqMan real-time PCR, while S. aureus enterotoxin as a causative agent was excluded by using the commercial enzyme-linked immunosorbent assay system VIDAS Staph enterotoxin II (bioMérieux, France). These results were confirmed by the duplex SYBR green I real-time PCR assay developed in this study (Fig. 1B).

The second emetic food poisoning involved one student who consumed cooked cauliflower stored at room temperature for 1.5 days. The student began vomiting 75 min after consumption of about 20 g of the reheated food. DNA was isolated directly from the food remnants and used as template in the TaqMan and the duplex SYBR green I assays. Both assays were positive for emetic B. cereus, but the duplex assay was negative for S. aureus (Fig. 1B). This is in accordance with the results from conventional enrichment and plating performed in parallel using PEMB agar for selective detection of B. cereus and Baird Parker agar for the detection of S. aureus (data not shown) as recommended by food authorities (§64 LFGB, ISO, and FDA).

In both food-poisoning cases, the presence of the B. cereus emetic toxin cereulide in the food remnants was confirmed by the HEp-2 cytotoxicity assay (16, 17).

Conclusion.

We have introduced a TaqMan assay and a SYBR green I real-time PCR assay for the fast and conclusive identification of emetic B. cereus. The TaqMan assay includes an IAC to avoid false-negative results and therefore allows its implementation in routine food diagnostic laboratories. The SYBR green I-based assay represents an economically interesting alternative for the analysis of a large number of samples (e.g., in epidemiological studies) and can be extended to a duplex real-time PCR for the one-step differentiation of emetic B. cereus and S. aureus. The novel real-time PCR assays were shown to be fast, sensitive, and reliable diagnostic tools that complement the existing toxin analysis methods. The developed assays could contribute substantially to determining the true incidence of the emetic type of food poisoning caused by B. cereus, especially by reducing the rate of misdiagnosis.

Supplementary Material

[Supplemental material]

Acknowledgments

This work was supported by Bayerisches Staatsministerium für Landwirtschaft und Forsten (Sondervermögen der Milch- und Fettwirtschaft in Bayern).

We thank Genia Lücking for the HEp-2 cytotoxicity tests and Monica Dommel for proofreading the manuscript.

Footnotes

▿

Published ahead of print on 26 January 2007.

†

Supplemental material for this article may be found at http://aem.asm.org/.

REFERENCES

  • 1.Aarts, H. J. M., R. G. Joosten, M. H. C. Henkens, H. Stegeman, and A. H. A. M. van Hoek. 2001. Rapid duplex PCR assay for the detection of pathogenic Yersinia enterocolitica strains. J. Microbiol. Methods 47:209-217. [DOI] [PubMed] [Google Scholar]
  • 2.Aas, N., B. Gondrosen, and G. Langeland. 1992. Norwegian food authorities report on food associated diseases in 1990. SNT Report 3, Oslo, Norway.
  • 3.Abu Al-Soud, W. A., and P. Radström. 1998. Capacity of nine thermostable DNA polymerases to mediate DNA amplification in the presence of PCR-inhibiting samples. Appl. Environ. Microbiol. 64:3748-3753. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Alarcón, B., B. Vicedo, and R. Aznar. 2006. PCR-based procedures for detection and quantification of Staphylococcus aureus and their application in food. J. Appl. Microbiol. 100:352-364. [DOI] [PubMed] [Google Scholar]
  • 5.Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403-410. [DOI] [PubMed] [Google Scholar]
  • 6.Becker, B. 2005. Richt- und Warnwerte, p. 77-80. In B. Becker (ed.), Pathogene mikroorganismen: Bacillus cereus. B. Behr's Verlag GmbH Co. KG, Hamburg, Germany.
  • 7.Bennett, R. W. 2005. Staphylococcal enterotoxin and its rapid identification in foods by enzyme-linked immunosorbent assay-based methodology. J. Food Prot. 68:1264-1270. [DOI] [PubMed] [Google Scholar]
  • 8.Brandfass, C., and P. Karlovsky. 2006. Simultaneous detection of Fusarium culmorum and F. graminearum in plant material by duplex PCR with melting curve analysis. BMC Microbiol. 6:4. doi: 10.1186/1471-2180-6-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Carnio, M. C., T. Stachelhaus, K. P. Francis, and S. Scherer. 2001. Pyridinyl polythiazole class peptide antibiotic micrococcin P1, secreted by foodborne Staphylococcus equorum WS2733, is biosynthesized nonribosomally. Eur. J. Biochem. 268:6390-6400. [DOI] [PubMed] [Google Scholar]
  • 10.De Medici, D., L. Croci, E. Delibato, S. Di Pasquale, E. Filetici, and L. Toti. 2003. Evaluation of DNA extraction methods for use in combination with SYBR green I real-time PCR to detect Salmonella enterica serotype Enteritidis in poultry. Appl. Environ. Microbiol. 69:3456-3461. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dierick, K., E. van Coillie, I. Swiecicka, G. Meyfroidt, H. Devlieger, A. Meulemans, G. Hoedemaekers, L. Fourie, M. Heyndrickx, and J. Mahillon. 2005. Fatal family outbreak of Bacillus cereus-associated food poisoning. J. Clin. Microbiol. 43:4277-4279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ehling-Schulz, M., M. Fricker, H. Grallert, P. Rieck, M. Wagner, and S. Scherer. 2006. Cereulide synthetase gene cluster from emetic Bacillus cereus: structure and location on a mega virulence plasmid related to Bacillus anthracis toxin plasmid pXO1. BMC Microbiol. 6:20. doi: 10.1186/1471-2180-6-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Ehling-Schulz, M., M. Fricker, and S. Scherer. 2004. Bacillus cereus, the causative agent of an emetic type of food-borne illness. Mol. Nutr. Food Res. 48:479-487. [DOI] [PubMed] [Google Scholar]
  • 14.Ehling-Schulz, M., M. Fricker, and S. Scherer. 2004. Identification of emetic toxin producing Bacillus cereus strains by a novel molecular assay. FEMS Microbiol. Lett. 232:189-195. [DOI] [PubMed] [Google Scholar]
  • 15.Ehling-Schulz, M., M.-H. Guinebretiere, A. Monthán, O. Berge, M. Fricker, and B. Svensson. 2006. Toxin gene profiling of enterotoxic and emetic Bacillus cereus. FEMS Microbiol. Lett. 260:232-240. [DOI] [PubMed] [Google Scholar]
  • 16.Ehling-Schulz, M., N. Vukov, A. Schulz, R. Shaheen, M. Andersson, E. Märtlbauer, and S. Scherer. 2005. Identification and partial characterization of the nonribosomal peptide synthetase gene responsible for cereulide production in emetic Bacillus cereus. Appl. Environ. Microbiol. 71:105-113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Finlay, W. J. J., N. A. Logan, and A. D. Sutherland. 1999. Semiautomated metabolic staining assay for Bacillus cereus emetic toxin. Appl. Environ. Microbiol. 65:1811-1812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Granum, P. E. 2001. Bacillus cereus, p. 373-381. In M. P. Doyle, L. R. Beuchat, and T. J. Montville (ed.), Food microbiology: fundamentals and frontiers, 2nd ed. ASM Press, Washington, DC.
  • 19.Häggblom, M. M., C. Apetroaie, M. A. Andersson, and M. S. Salkinoja-Salonen. 2002. Quantitative analysis of cereulide, the emetic toxin of Bacillus cereus, produced under various conditions. Appl. Environ. Microbiol. 68:2479-2483. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Hoorfar, J., N. Cook, B. Malorny, M. Wagner, D. De Medici, A. Abdulmawjood, and P. Fach. 2003. Making internal amplification control mandatory for diagnostic PCR. J. Clin. Microbiol. 41:5835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Johnson, E., J. Nelson, and M. Johnson. 1990. Microbiological safety of cheese made from heat-treated milk. Part II. Microbiology. J. Food Prot. 53:519-540. [DOI] [PubMed] [Google Scholar]
  • 22.Jothikumar, N., X. Wang, and M. W. Griffiths. 2003. Real-time multiplex SYBR green I-based PCR assay for simultaneous detection of Salmonella serovars and Listeria monocytogenes. J. Food Prot. 66:2141-2145. [DOI] [PubMed] [Google Scholar]
  • 23.Kleer, J., A. Bartholomä, R. Levetzow, T. Reiche, H.-J. Sinell, and P. Teufel. 2001. Bakterielle Lebensmittel-Infektionen und -Intoxikationen in Einrichtungen zur Gemeinschaftsverpflegung 1985-2000. Arch. Lebensmittelhyg. 52:76-79. [Google Scholar]
  • 24.Le Loir, Y., F. Baron, and M. Gautier. 2003. Staphylococcus aureus and food poisoning. Genet. Mol. Res. 31:63-76. [PubMed] [Google Scholar]
  • 25.Mackay, I. M. 2004. Real-time PCR in the microbiology laboratory. Clin. Microbiol. Infect. 10:190-212. [DOI] [PubMed] [Google Scholar]
  • 26.Magarvey, N. A., M. Ehling-Schulz, and C. T. Walsh. 2006. Characterization of the cereulide NRPS α-hydroxy acid specifying modules: activation of α-keto acids and chiral reduction on the assembly line. J. Am. Chem. Soc. 128:10698-10699. [DOI] [PubMed] [Google Scholar]
  • 27.Mahler, H., A. Pasi, J. M. Kramer, P. Schulte, A. C. Scoging, W. Bär, and S. Krähenbühl. 1997. Fulminant liver failure in association with the emetic toxin of Bacillus cereus. N. Engl. J. Med. 336:1142-1148. [DOI] [PubMed] [Google Scholar]
  • 28.Malorny, B., J. Hoorfar, C. Bunge, and R. Helmuth. 2003. Multicenter validation of the analytical accuracy of Salmonella PCR: towards an international standard. Appl. Environ. Microbiol. 69:290-296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Malorny, B., E. Paccassoni, P. Fach, C. Bunge, A. Martin, and R. Helmuth. 2004. Diagnostic real-time PCR for detection of Salmonella in food. Appl. Environ. Microbiol. 70:7046-7052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Malorny, B., P. T. Tassios, P. Radström, N. Cook, M. Wagner, and J. Hoorfar. 2003. Standardization of diagnostic PCR for the detection of foodborne pathogens. Int. J. Food Microbiol. 83:39-48. [DOI] [PubMed] [Google Scholar]
  • 31.Martineau, F., F. J. Picard, D. Ke, S. Paradis, P. H. Roy, M. Ouellette, and M. G. Bergeron. 2001. Development of a PCR assay for identification of staphylococci at genus and species level. J. Clin. Microbiol. 39:2541-2547. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.McKillip, J. L., and M. Drake. 2004. Real-time nucleic acid-based detection methods for pathogenic bacteria in food. J. Food Prot. 67:823-832. [DOI] [PubMed] [Google Scholar]
  • 33.Nakano, S., T. Kobayashi, K. Funabiki, A. Matsumura, Y. Nagao, and T. Yamada. 2004. PCR detection of Bacillus and Staphylococcus in various foods. J. Food Prot. 67:1271-1277. [DOI] [PubMed] [Google Scholar]
  • 34.Pfaffl, M. W. 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29:2002-2007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Rasko, D. A., M. R. Altherr, C. S. Han, and J. Ravel. 2005. Genomics of the Bacillus cereus group of organisms. FEMS Microbiol. Rev. 29:303-329. [DOI] [PubMed] [Google Scholar]
  • 36.Rasko, D. A., J. Ravel, O. A. Okstad, E. Helgason, R. Z. Cer, L. Jiang, K. A. Shores, D. E. Fouts, N. J. Tourasse, S. V. Angiuoli, J. Kolonay, W. C. Nelson, A. B. Kolsto, C. M. Fraser, and T. D. Read. 2004. The genome sequence of Bacillus cereus ATCC 10987 reveals metabolic adaptations and a large plasmid related to Bacillus anthracis pXO1. Nucleic Acids Res. 32:977-988. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Rhodehamel, E. J., and S. M. Harmon. 1998. Bacillus cereus. In U.S. Food and Drug Administration, Bacteriological analytical manual, 8th ed., revision A. AOAC International, Gaithersburg, MD. http://www.cfsan.fda.gov/∼ebam/bam-14.html.
  • 38.Ririe, K. M., R. P. Rasmussen, and C. T. Wittwer. 1997. Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal. Biochem. 245:154-160. [DOI] [PubMed] [Google Scholar]
  • 39.Rodríguez-Lázaro, D., M. D'Agostino, A. Herrewegh, M. Pla, N. Cook, and J. Ikonomopoulos. 2005. Real-time PCR-based methods for detection of Mycobacterium avium subsp. paratuberculosis in water and milk. Int. J. Food Microbiol. 101:93-104. [DOI] [PubMed] [Google Scholar]
  • 40.Romero, C., and I. Lopez-Goni. 1999. Improved method for purification of bacterial DNA from bovine milk for detection of Brucella spp. by PCR. Appl. Environ. Microbiol. 65:3735-3737. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Rudi, K., H. K. Nogva, B. Moen, H. Nissen, S. Bredholt, T. Moretro, K. Naterstad, and A. Holck. 2002. Development and application of new nucleic acid-based technologies for microbial community analysis in foods. Int. J. Food Microbiol. 78:171-180. [DOI] [PubMed] [Google Scholar]
  • 42.Schoder, D., A. Schmalwieser, G. Schauberger, M. Kuhn, J. Hoorfar, and M. Wagner. 2003. Physical characteristics of six new thermocyclers. Clin. Chem. 49:960-963. [DOI] [PubMed] [Google Scholar]
  • 43.Schoeni, J. L., and A. C. L. Wong. 2005. Bacillus cereus food poisoning and its toxins. J. Food Prot. 68:636-648. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

[Supplemental material]
aem_73_6_1892__S2.doc (29KB, doc)

Articles from Applied and Environmental Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES