Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2006 Nov 15;45(2):453–460. doi: 10.1128/JCM.01971-06

Horizontal Gene Transfer in a Polyclonal Outbreak of Carbapenem-Resistant Acinetobacter baumannii▿

Jubelle K Valenzuela 1, Lee Thomas 1,2, Sally R Partridge 1, Tanny van der Reijden 3, Lenie Dijkshoorn 3, Jon Iredell 1,*
PMCID: PMC1829019  PMID: 17108068

Abstract

In the last few years, phenotypically carbapenem resistant Acinetobacter strains have been identified throughout the world, including in many of the hospitals and intensive care units (ICUs) of Australia. Genotyping of Australian ICU outbreak-associated isolates by pulsed-field gel electrophoresis of whole genomic DNA indicated that different strains were cocirculating within one hospital. The carbapenem-resistant phenotype of these and other Australian isolates was found to be due to carbapenem-hydrolyzing activity associated with the presence of the blaOXA-23 gene. In all resistant strains examined, the blaOXA-23 gene was adjacent to the insertion sequence ISAba1 in a structure that has been found in Acinetobacter baumannii strains of a similar phenotype from around the world; blaOXA-51-like genes were also found in all A. baumannii strains but were not consistently associated with ISAba1, which is believed to provide the promoter required for expression of linked antibiotic resistance genes. Most isolates were also found to contain additional antibiotic resistance genes within the cassette arrays of class 1 integrons. The same cassette arrays, in addition to the ISAba1-blaOXA-23 structure, were found within unrelated strains, but no common plasmid carrying these accessory genetic elements could be identified. It therefore appears that antibiotic resistance genes are readily exchanged between cocirculating strains in epidemics of phenotypically indistinguishable organisms. Epidemiological investigation of major outbreaks should include whole-genome typing as well as analysis of potentially transmissible resistance genes and their vehicles.


Acinetobacter spp. are emerging opportunistic nosocomial pathogens, with increasing prevalence worldwide. Their epidemiology is complex, and genotypic methods or a combination of genotypic and phenotypic methods are required for species identification (28). Differentiation of Acinetobacter baumannii and Acinetobacter genomic species 3 and 13TU (the three most clinically important members of the genus) and the environmental species A. calcoaceticus is impractical in the routine laboratory, and these four species are generally grouped phenotypically as the A. calcoaceticus-A. baumannii complex. DNA fingerprinting by ApaI digestion of total DNA and pulsed-field gel electrophoresis (PFGE) is regarded as the typing method of choice for outbreak investigation and can be used to compare outbreaks in different locations when the methodology is uniform (41).

Studies at the species level have shown that the problems of epidemic spread of antibiotic-resistant Acinetobacter strains are mostly due to bacteria belonging to the A. calcoaceticus-A. baumannii complex (3). The potential for acquisition of transferable carbapenem resistance has long been recognized (37a), and the adjusted mortality risk for intensive-care patients infected by carbapenem resistant Acinetobacter may be increased more than threefold (33).

Carbapenem resistance in strains of the A. calcoaceticus-A. baumannii complex has been associated with altered outer membrane proteins (see, e.g., references 12 and 24), modification of penicillin-binding proteins (see, e.g., reference 12), and production of carbapenem-hydrolyzing enzymes (carbapenemases) (see, e.g., references 2 and 4). The carbapenemases are divisible into the metalloenzymes (Ambler class B) and the serine-proteases (Ambler class D; OXA-type). Transmissible genes encoding metalloenzymes are found in Acinetobacter spp. and have been associated with several carbapenem-resistant outbreaks (see, e.g., references 19 and 53). However, resistance associated with serine proteases is more widespread in Acinetobacter spp. (34). blaOXA-23 (ARI-1) was first identified in Scotland in 1995 (11) and subsequently in many different locations (6, 20, 27, 47, 52). More recently, blaOXA-58 has also been associated with carbapenem resistance in A. baumannii in many parts of the world (34), and minor variants of blaOXA-51 seem to be characteristic of all A. baumannii strains. The insertion sequence ISAba1 (40) has been found in association with a number of antibiotic resistance genes, including blaOXA-23, blaOXA-58, and blaOXA-51, and it appears to provide the promoter required for gene expression (35, 39, 48).

At Westmead Hospital in Sydney, Australia, carbapenem-resistant Acinetobacter began emerging about 1999, and increasing reports of similar isolates from other major cities on the Australian Eastern seaboard soon followed. Since we have collected strains from this hospital during the period 1995 to 2000, and our collection thus encompasses carbapenem-sensitive as well as -resistant strains, we were able to follow this emergence over several years. The aim of our study was to determine the genetic basis for carbapenem resistance in our intensive-care-unit (ICU) strains and to evaluate the epidemiology of transmissible genes associated with carbapenem resistance in Acinetobacter sp. strains more generally.

MATERIALS AND METHODS

Clinical samples.

The Westmead (WM) sample collection consists of 177 pure cultures of Acinetobacter spp. collected from patients, mostly in the ICU, at Westmead Hospital (Sydney, Australia) between 1995 and 2000. A small number of strains were selected to represent each ApaI PFGE type and were subjected to detailed analysis, including repeat PFGE; these were renamed (e.g., WM96 for a representative isolate from 1996). Nine carbapenem-resistant Acinetobacter isolates from ICU patients at Prince of Wales (PW) Hospital (Sydney, New South Wales, Australia) and Royal Brisbane (RB) Hospital (Brisbane, Queensland, Australia) were also included (PW01a to -c and RB01 from 2001; RB02a to -e from 2002).

Strain and species identification and antibiotic susceptibility testing.

After initial identification in source laboratories, Acinetobacter typing and species identification were performed at the Leiden University Medical Center (LUMC) by random amplification of polymorphic DNA (RAPD) analysis and by high-resolution genomic fingerprinting by AFLP and amplified rRNA gene restriction analysis (ARDRA). RAPD analysis for strain identification (typing) used primers M13 and DAF4 as described previously (16). ARDRA was performed by restricting the 16S rRNA gene with CfoI, AluI, MboI, RsaI, and MspI (9). AFLP fingerprints and the combined ARDRA restriction profiles were compared against AFLP and ARDRA libraries of reference strains in the LUMC collection, which had been identified by DNA-DNA hybridization. MICs were determined by Phoenix NMIC-ID (Becton Dickinson, NJ) and by Etest (AB Biodisk, Solna, Sweden).

Pulsed-field gel electrophoresis.

Genomic DNAs of all Acinetobacter isolates were prepared in agarose blocks and digested with the restriction enzyme ApaI (New England Biolabs, MA). DNA fragments were separated by electrophoresis in a CHEF-DR III (Bio-Rad Laboratories, CA) system, and results were interpreted according to the criteria of Tenover et al. (45).

Cell fractionation.

The cell fractionation method used was modified from that of Osborne and Silhavy (31). Logarithmic-phase cells from 100 ml of nutrient broth containing 20 μg/ml ampicillin were pelleted (at 10,000 × g for 20 min at 4°C) and resuspended in 1 ml of 30 mM Tris-HCl-20% sucrose (pH 8.1); then 100 μl lysozyme (100 mg/ml in 0.1 M EDTA [pH 7.3]) was added, and the mixture held on ice for 30 min. After centrifugation to pellet spheroplasts (at 10,000 × g for 15 min at 4°C), the supernatant, enriched for periplasmic content, was stored at −20°C. The spheroplast pellet was held at −70°C for 30 min; then it was reconstituted in 3 ml of 3 mM EDTA (pH 7.3) and sonicated at a 50% cycle for 60 s. After centrifugation (at 35,000 × g for 60 min at 4°C), the supernatant (cytoplasmic extract) was stored at −20°C, and the pellet (membrane fraction) was resuspended in 1 ml of 0.25 M Tris (pH 7.5). Protein concentrations were determined using the Coomassie Plus protein assay according to the manufacturer's instructions (Pierce Biotechnology Inc., IL). Subfractions were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis to ensure uniformity and to confirm that there was no significant contamination of periplasmic extracts with cytoplasmic proteins.

Hydrolysis assay (Masuda testing).

A disc assay adapted from the method of Masuda et al. (25), as modified by Bou et al. (4), was used for the detection of a carbapenem-hydrolyzing activity in resistant isolates. An antibiotic disc (10 μg imipenem [IPM], 10 μg ampicillin or 30 μg aztreonam; BBL, MD) was placed at the center of a Mueller-Hinton agar plate (Oxoid, United Kingdom) spread with a sensitive Escherichia coli indicator strain. Filter discs loaded with increasing amounts (100 μg, 150 μg, 200 μg) of the periplasmic extract or with 10 μl of phosphate-buffered saline (PBS) were placed 10 mm from the antibiotic disc, within the predicted zone of inhibition, and the plate was incubated overnight at 37°C. Growth of the indicator strain within the zone of inhibition indicated hydrolysis of the antibiotic.

EDTA synergy tests.

EDTA disc synergy tests were performed as previously described (23). Briefly, test or control isolates (Klebsiella pneumoniae expressing the IMP-4 metalloprotease or carbapenem-sensitive Pseudomonas aeruginosa) suspended in 0.9% (wt/vol) saline (a McFarland standard of approximately 0.5; 1.5 × 108 CFU/ml) were swabbed onto Mueller-Hinton plates. A disc soaked in EDTA (10 mM) was placed 10 mm from a 10-μg IPM disc in the center of each plate. The IPM inhibition zone, evident after overnight incubation at 37°C, was augmented by EDTA in metalloenzyme-expressing strains.

DNA purification.

Crude whole-cell lysates, made from overnight cultures of bacterial isolates by resuspending cells in 1 ml water to a 3.0 McFarland standard and incubating at 96°C for 30 min, were used as DNA templates for PCR. Genomic DNA for PCR was extracted from selected isolates using a Wizard genomic DNA purification kit (Promega). Plasmid DNA for electroporation was prepared using a Wizard Plus mini-prep kit (Promega). Plasmid DNA for profiling was prepared using a modification of published methods (21, 43). Cells from overnight growth on horse blood agar plates were suspended in 50 μl of TE buffer (10 mM Tris-HCl, 1 mM EDTA [pH 8.5]), and 200 μl of lysis solution (3% [wt/vol] sodium dodecyl sulfate, 50 mM Tris [pH 12.5]) was added. After 90 min (for A. baumannii) or 60 min (for Enterobacteriaceae containing control plasmids) at 60°C, lysed mixtures were extracted with phenol-chloroform-isoamyl alcohol (25:24:1). Samples were electrophoresed through 0.6% (wt/vol) agarose in 1× Tris-acetate-EDTA buffer at 100 V for 6 h, and the buffer was replaced hourly.

PCR amplification.

PCR primers are listed in Table 1. Amplification was carried out in 50-μl volumes with 1× reaction buffer, 1 U of Taq polymerase (Bioline, London, United Kingdom), 200 μM each deoxynucleoside triphosphate, 1.5 mM MgCl2, 10 pmol of each primer, and 4 μl of lysed cells as the template. PCR conditions generally were as follows: a hot start at 94°C for 5 min; 35 cycles of 30 s at 94°C, 45 s at either 41°C (blaGIM-1), 48°C (blaOXA-51), 50°C (ISAba1), 52°C (blaOXA-58), or 55°C (others), and 60 s at 72°C; and a final step of 10 min at 72°C. The intI genes of class 1 to class 3 integrons, and class 1 integron cassette arrays, were amplified as previously described (10) using the primers listed in Table 1.

TABLE 1.

Oligonucleotide primers

Primer Sequence (5′-3′) Reference or source
OXA23-F GATGTGTCATAGTATTCGTCG 2
OXA23-R TCACAACAACTAAAAGCACTG 2
OXA24-F GTACTAATCAAAGTTGTGAA 2
OXA24-R TTCCCCTAACATGAATTTGT 2
preOXA-58prom+ TTATCAAAATCCAATCGGC 17
preOXA-58B TAACCTCAAACTTCTAATTC 17
OXA-58A CGATCAGAATGTTCAAGCGC 17
OXA-58B ACGATTCTCCCCTCTGCGC 17
5′OXA51-like-all F ATGAACATTAAAGCACTC 48
3′OXA51-like-all R CTATAAAATACCTAATTGTTC 48
IMP-F CTACCGCAGAGTCTTTG 42
IMP-R AACCAGTTTTGCCTTACCAT 42
VIM-F AGTGGTGAGTATCCGACAG 46
VIM-R ATGAAAGTGCGTGGAGAC 46
blaSPM-1-F GCGTTTTGTTTGTTGCTC 44
blaSPM-1-R TTGGGGATGTGAGACTAC 44
GIM-1F GATTTCCAAATGAAAAATGTA This work (AJ620678)
GIM1-R TTAATCAGCCGACGCTTC This work (AJ620678)
ISAba1R2 CTTAAAATTGCCAAAATTTCCT This work (www-is.biotoul.fr)
ISAba1L2 TCTAACGACGAATACTATGAC This work (www-is.biotoul.fr)
JVFTnox TCCACGTTTATTAAGCAATG This work (www-is.biotoul.fr)
TNORF2-1 AAGCTTATAGCTAACACC This work (www-is.biotoul.fr)
hep58 TCATGGCTTGTTATGACTGT 50
hep59 GTAGGGCTTATTATGCACGC 50
IntI1-Fa CAGTGGACATAAGCCTGTTC 22
IntI1-Ra CCCGAGGCATAGACTGTA 22
IntI2-Fa GTAGCAAACGAGTGACGAAATG 26
IntI2-Ra CACGGATATGCGACAAAAAGGT 26
IntI3-Fa GCCTCCGGCAGCGACTTTCAG 26
IntI3-Ra ACGGATCTGCCAAACCTGACT 26
a

Primers used together in a multiplex PCR (10).

Conjugation.

Transfer of plasmids to E. coli UB5201Rf, a spontaneous rifampin-resistant derivative of UB5201 (8a), was attempted using a filter mating method (adapted from reference 8). Recipient cells were harvested from overnight growth on a nutrient agar plate, and donor cells were harvested from 1 ml of an overnight culture in nutrient broth. After a wash with PBS and centrifugation, cell pellets were resuspended in 0.1 ml PBS, the suspensions were mixed, and 0.1 ml was spotted onto a nitrocellulose filter placed on a blood agar plate. Following incubation at 37°C for 4 h, cells were washed off the filter with PBS, and 0.1-ml aliquots of appropriate dilutions were spread on nutrient agar plates containing 80 μg/ml rifampin (Sigma-Aldrich, MO) and 20 μg/ml ampicillin (CSL Ltd.).

Electroporation.

Plasmid DNA (25 ng) was mixed with 200 μl of electrocompetent E. coli DH5α prepared by standard methods (37), and the mixture was pulsed (25 μF, 2.5 kV, 200 Ω, 4 s). After addition of 1 ml of nutrient broth and incubation for 60 min at 37°C with shaking, the mixture was plated onto nutrient agar containing 20 μg/ml ampicillin.

DNA sequencing and analysis.

PCR products were sequenced using a Dye-Terminator sequencer (Applied Biosystems Inc., CA) and DNA templates prepared according to the manufacturer's specifications. Sequence comparisons were carried out using BLAST searches (www.angis.org.au; www-is.biotoul.fr/).

Nucleotide sequence accession numbers.

The sequences of the cassette arrays have been submitted to GenBank under the following accession numbers: PW01c (aacC1-orfP-orfQ-aadA1), EF015496; WM98a (blaP1), EF015497; WM98b (dfrA17-aadA5), EF015498; WM99c (aacC1-orfP-orfP-orfQ-aadA1), EF015498. The ISAba1-blaOXA-23 sequence from isolate WM99c has been submitted under accession no. EF015500.

RESULTS

A common phenotype in unrelated cocirculating strains.

Prior to about 1999, most clinically significant Acinetobacter isolates from Westmead Hospital were resistant to several antibiotics, including ticarcillin-clavulanate and gentamicin, commonly used in combination in this hospital, while occasional isolates were relatively antibiotic susceptible (see Table 2 for examples). From 1999, isolates that were resistant to multiple antibiotics, including the carbapenems imipenem and meropenem, began to appear. Nine isolates from Brisbane (RB) and elsewhere in Sydney (PW) collected after 1999 were also carbapenem resistant.

TABLE 2.

Antibiotic MICs for representative isolates

Isolate MIC (μg/ml)a of the following antibiotic:
Pulsotype
AMK GEN TOB CIP CTX CAZ TIC TIM IPMb
WM96 ≤8 >8 ≤2 >2 32 4 >64 >64/2 ≤1 I
WM98 ≤8 >8 ≤2 >2 >32 8 >64 >64/2 ≤1 I
WM97a ≤8 >8 >8 ≤0.5 >32 >16 >64 >64/2 2 II
WM97b ≤8 ≤2 ≤2 ≤0.5 8 4 8 8/2 ≤1 III
WM98a 32 >8 4 ≤0.5 8 4 >64 64/2 ≤1 IV
WM98b >32 >8 8 ≤0.5 8 2 8 8/2 ≤1 IV
WM98c ≤8 ≤2 ≤2 ≤0.5 8 4 16 8/2 ≤1 V
WM99a ≤8 >8 >8 >2 >32 >16 >64 >64/2 >8 VI
WM99b ≤8 >8 >8 >2 >32 >16 >64 >64/2 >8 VI
WM99c ≤8 >8 ≤2 >2 >32 >16 >64 >64/2 >8 VII
WM00 ≤8 >8 >8 >2 >32 >16 >64 >64/2 >8 VIII
RB02a 32 >8 >8 >2 >32 >16 >64 >64/2 >8 IX
RB02b ≤8 >8 >8 >2 >32 >16 >64 >64/2 >8 IX
RB02c ≤8 >8 >8 >2 >32 >16 >64 >64/2 >8 IX
RB02d ≤8 >8 >8 >2 >32 >16 >64 >64/2 >8 IX
RB02e ≤8 >8 >8 >2 >32 >16 >64 >64/2 >8 IX
RB01 ≤8 >8 ≤2 >2 >32 >16 >64 >64/2 >8 X
PW01a ≤8 >8 ≤2 >2 >32 >16 >64 >64/2 >8 X
PW01b ≤8 >8 ≤2 >2 >32 >16 >64 >64/2 >8 X
PW01c ≤8 >8 ≤2 >2 >32 >16 >64 >64/2 >8 XI
a

MICs determined by Phoenix. AMK, amikacin; GEN, gentamicin; TOB, tobramycin; CIP, ciprofloxacin; CTX, cefotaxime; CAZ, ceftazidime; TIC, ticarcillin; TIM, Timentin (ticarcillin disodium/clavulanate potassium; the MIC of clavulanate potassium was 2 for all isolates tested). All strains were additionally resistant to ampicillin (MIC, >2), cephalothin (MIC, >16), and aztreonam (MIC, >16).

b

For all isolates for which the IPM MIC was >8, the MICs of both IPM and meropenem were >32 by Etest.

ApaI PFGE fingerprint analysis performed on all 177 WM isolates distinguished eight pulsotypes (I to VIII) by the criteria of Tenover et al. (45) (Fig. 1). Three additional pulsotypes (IX to XI) were found among the nine isolates from the other two hospitals, with type X common to both sites. The differences between types VI to X were relatively minor. Pulsotypes III, IV, and V, all of which were relatively antibiotic susceptible (Table 2), were seen rarely (Table 3). The initial carbapenem-susceptible pulsotype I appeared to be gradually outnumbered by pulsotype II, although both pulsotypes were still present when the first of the carbapenem resistance pulsotypes appeared in 1999. Each of the three carbapenem resistance pulsotypes (VI to VIII) appeared to displace its predecessor within a year. Different pulsotypes thus clearly cocirculated in our ICU, and the carbapenem-resistant phenotype, once established, appeared to persist in successive clonal waves.

FIG. 1.

FIG. 1.

ApaI PFGE of selected isolates. Representatives of different pulsotypes are shown as indicated. Lanes 1 to 8, WM; lanes 10 to 15, RB; lanes 17 to 19, PW; lanes 9 and 16, Lambda ladder pulsed-field gel electrophoresis marker (New England Biolabs).

TABLE 3.

Temporal distribution of Westmead pulsotypes

Pulsotype No. isolated in the following yr:
Total
1995 1996 1997 1998 1999 2000
I 10 17 13 9 2 1 52
II 9 22 18 15 64
III 3 3
IV 2 2
V 2 2
VIa 10 10
VIIa 4 34 38
VIIIa 6 6
Total 10 26 38 31 31 41 177
a

Carbapenem-resistant pulsotype.

Detailed genotypic strain and species identification by RAPD, AFLP, and ARDRA was applied to selected WM isolates chosen as representative of pulsotypes that immediately predated and/or cocirculated with the initial carbapenem-resistant strains (Table 4). By using AFLP and ARDRA library typing for species identification, most of the tested isolates proved to be A. baumannii, while isolates with the rare pulsotypes III and IV corresponded to the unnamed genomic species 3 and 13TU, respectively. The carbapenem-resistant phenotype was confined to A. baumannii. The detailed comparative typing by RAPD and AFLP generally supported the ApaI PFGE typing data, apart from the carbapenem-resistant strains WM99a (pulsotype VI) and WM99b (pulsotype VII). These isolates were on the borderline of the Tenover criteria (45) for relatedness, and RAPD and ARDRA data suggested epidemiological relatedness. Indeed, taken together, the typing data suggest that WM99a (type VI) and WM99c (nominally, type VII) are minor variants of the same strain.

TABLE 4.

Detailed subtyping of selected isolates

Strain Typing result
Species identification
PFGE RAPD
AFLPa ARDRA
AFLP
DAF4 M13 Profileb Species
WM96 I 1 1 1 1 1 1 2 1 A. baumannii A. baumannii
WM98 I 1 2 1A 1 1 1 2 1 A. baumannii A. baumannii
WM97a II 2 3 2 1 1 1 2 1 A. baumannii A. baumannii
WM97b III 3 4 3 2 1 3 1 3 Genospecies 3 Genospecies 3
WM98a IV 4 5 4 2+3 1 1 1 3 13TU 13TU
WM98c V 5 6 5 1 1 1 2 3 A. baumannii A. baumannii
WM99a VI 6 7 6 1 1 1 2 3 A. baumannii A. baumannii
WM99c VII 6 7′ 6 1 1 1 2 3 A. baumannii A. baumannii
a

WM96 and WM98 clustered at 90% in the dendrogram created by cluster analysis (data not shown), which is borderline for designation as the same type (51).

b

Profile of the combined restriction patterns of 16S rRNA gene sequences generated with the enzymes CfoI, AluI, MboI, RsaI, and MspI, respectively.

Of note, cluster analysis of the AFLP profiles of WM96 and WM98 (both pulsotype I) indicated >82% relatedness (generally used as the A. baumannii clone delineation level) to strains of the widespread epidemic-associated A. baumannii EU clone II (29) (data not shown).

Carbapenem-resistant isolates contain blaOXA-23.

Outer membrane protein preparations revealed no consistent difference between carbapenem-susceptible and carbapenem-resistant isolates (data not shown), suggesting that outer membrane variation is an unlikely primary explanation for the resistant phenotype. Periplasmic extracts from selected susceptible isolates hydrolyzed ampicillin, but neither imipenem nor aztreonam, in vitro (in a Masuda test). In the same assay, resistant isolates hydrolyzed both ampicillin and imipenem but not aztreonam, consistent with the presence of a periplasmic carbapenemase of the OXA type.

EDTA did not augment the imipenem susceptibilities of representative carbapenem-resistant strains from WM, PW, and RB, arguing strongly against any contribution from a metalloenzyme. No PCR products were obtained using primers to detect the genes encoding the metalloenzymes SPM-1 and GIM-1 or some of the IMP and VIM variants that are now well established (49) (Table 1). PCR amplification using proven primers to detect blaOXA-24 (2) and blaOXA-58 (17) indicated that neither gene was present in any of the isolates for which results are given in Table 5. By contrast, blaOXA-23 was present in all carbapenem-resistant strains (n = 13). Sequencing of the blaOXA-23 genes amplified from pulsotypes VII and XI (WM99c and PW3, respectively) indicated that they were both identical to the original blaOXA-23 gene (ARI-1; GenBank accession no. AJ132105) (11).

TABLE 5.

Genetic context of WM ICU and comparison isolates of Acinetobacter spp.

Isolate ApaI pulsotype Genomic speciesa Result for the following test:
Cassette arrayc Specimen
Masuda EDTA disc synergy PCR
bla ISAba1 intI
WM96 I A. baumannii Imps ND ISAba1 intI1 aacC1-P-P-Q-aadA1 Pleural fluid
WM98 I A. baumannii Imps ND ISAba1 intI1 aacC1-P-P-Q-aadA1 Wound
WM97a II A. baumannii Imps ND ISAba1 intI1 dfrA17-aadA5 Sputum
WM97b III Group 3 ND ND intI1 - Not recordedd
WM98a IV 13TU Imps ND intI1 blaP1 Blood
WM98b IV 13TUb Imps ND intI1 dfrA17-aadA5 Sputum
WM98c V A. baumannii Imps ND ISAba1 intI1 Not recorded
WM99a VI A. baumannii ND ND blaOXA-23 ISAba1 intI1 Not recorded
WM99b VI A. baumanniib Impr Serine blaOXA-23 ISAba1 intI1 aacC1-P-P-Q-aadA1 Urine
WM99c VII A. baumannii Impr Serine blaOXA-23 ISAba1 intI1 aacC1-P-P-Q-aadA1 Sputum
WM00 VIII A. baumanniib Impr Serine blaOXA-23 ISAba1 BAL
RB02a IX ND ND Serine blaOXA-23 ISAba1 intI1 aacC1-P-P-Q-aadA1 Rectal swab
RB02b IX ND ND Serine blaOXA-23 ISAba1 intI1 aacC1-P-P-Q-aadA1 Sputum
RB02c IX ND ND Serine blaOXA-23 ISAba1 Rectal swab
RB02d IX ND ND Serine blaOXA-23 ISAba1 intI1 aacC1-P-P-Q-aadA1 ETA
RB02e IX ND ND Serine blaOXA-23 ISAba1 intI1 aacC1-P-P-Q-aadA1 Rectal swab
RB01 X ND ND Serine blaOXA-23 ISAba1 intI1 aacC1-P-P-Q-aadA1 Blood culture
PW01a X ND ND Serine blaOXA-23 ISAba1 intI1 aacC1-P-P-Q-aadA1 Not recorded
PW01b X ND ND Serine blaOXA-23 ISAba1 intI1 aacC1-P-P-Q-aadA1 Not recorded
PW01c XI ND ND Serine blaOXA-23 ISAba1 intI1 aacC1-P-Q-aadA1 Not recorded
a

Determined by ARDRA, AFLP, and RAPD (see Table 2). 13TU, Acinetobacter genospecies 13TU; ND, not determined.

b

Presumed on the basis of PFGE relatedness to a fully identified strain(s).

c

P, orfP (also called orfX and orfXA); Q, orfQ (also called orfX′, orfY, and orfXB).

d

All specimens were deemed clinically significant at the time of reporting. BAL, bronchoalveolar lavage; ETA, endotracheal aspirate.

The “forward” primer used here, and in most other published studies, to amplify the blaOXA-23 gene actually lies outside the gene itself in the insertion sequence ISAba1. Primers internal to ISAba1 (ISAba1L2 and ISAba1R2) (Table 1) gave the expected product with all of the A. baumannii strains examined, including those that were carbapenem sensitive, but not with the 13TU or DNA group-3 strains. PCR primers ISAba1R2 and OXA23-R (Table 1) amplified a product that included most of ISAba1 upstream and a complete blaOXA-23 gene in all carbapenem-resistant strains listed in Table 5 but in none of the carbapenem-susceptible strains. Interestingly, this first blaOXA-23 sequence (ARI-1; AJ132105) differs from all other blaOXA-23 sequences in the databases, and from all those that we sequenced (e.g., WM99c; accession no. EF015500), by the absence of 7 bp (CTCTTTT) immediately adjacent to the inverted repeat of ISAba1.

All A. baumannii isolates were positive for blaOXA-51-like genes, while blaOXA-23 was found in all carbapenem-resistant and no carbapenem-susceptible A. baumannii strains. Primers in two different locations within ISAba1 (JVFTnox and TNORF2-1), paired with a primer in blaOXA-51 (3′OXA51-like-all R), generated amplicons of the correct size for a direct linkage of ISAba1 upstream of blaOXA-51 in several carbapenem-resistant strains and no carbapenem-susceptible strains. However, blaOXA-51 was disrupted by a large (>1-kb) insertion in WM99c, and several carbapenem-resistant strains were negative by PCR for the ISAba1-blaOXA-51 sequence (data not shown). Thus, while the presence of an intact and complete ISAba1-blaOXA-23 sequence correlated exactly with resistance for all A. baumannii isolates examined, blaOXA-51 was massively disrupted in at least one carbapenem-resistant strain and lacked any demonstrable association with ISAba1 (and the promoter it provides) in others.

Class 1 integrons and cassette arrays in Acinetobacter strains.

Since gene cassettes in class 1 integrons are common in Acinetobacter spp. (see, e.g., references 15 and 22), all the strains in Table 5 were tested for these features. A multiplex PCR method targeting the specific integrase genes (intI) for class 1, -2, and -3 integrons (10) failed to identify intI2 (encoding the class 2 integrase) or intI3 (class 3) in any isolate. However, intI1 was identified in all carbapenem-sensitive isolates and all but two of the carbapenem-resistant isolates (WM00 [type VIII] and RB02c [type IX]). WM00 and RB02c also failed to yield cassette array products following several attempts using published primers targeting the 5′- and 3′-conserved segments of class 1 integrons (50). Cassette arrays were found in all intI1-positive isolates except for the single representatives of types III (WM97b) and V (WM98c) and one of the pulsotype VI strains (WM99a; very closely related to WM99c) (Table 5). WM97a (A. baumannii) and the unrelated WM98b (13TU) both contained the two-cassette array dfrA17-aadA5, while the other 13TU strain, WM98a, had a single cassette, blaP1 (the product of which is also known as PSE-1 or CARB-2).

A 3.1-kb amplicon was common to two almost indistinguishable carbapenem-sensitive strains (both A. baumannii, pulsotype I) and most of the carbapenem-resistant isolates (1 of 2 type VI isolates, 4 of 5 type IX isolates, and single examples of types VII and X), while PW01c (pulsotype XI) yielded a 2.6-kb amplicon. The PCR products from WW99c (3.1 kb) and PW01c (2.6 kb) were completely sequenced and found to contain closely related arrays, aacC1-orfP-orfP-orfQ-aadA1 and aacC1-orfP-orfQ-aadA1, respectively (Table 5). AvaI restriction digestion of the 3.1-kb PCR products from representatives of each relevant pulsotype resulted in identical patterns (data not shown).

Plasmid profiling.

Plasmid profiling has been suggested as an epidemiological marker for Acinetobacter spp. (14), and plasmids provide efficient vehicles for transferable resistance. Electrophoresis of plasmid preparations revealed a number of high-molecular-weight plasmids, along with smaller plasmids (illustrated for selected isolates in Fig. 2), but none were both unique to carbapenem-resistant (blaOXA-23-positive) strains and present in all of them. Repeated attempts to transfer a plasmid from strain WM99c into E. coli UB5201Rf by conjugation, or into E. coli DH5α by electroporation, with selection for ampicillin (blaOXA-23), were unsuccessful.

FIG. 2.

FIG. 2.

Plasmid profiling of representative Acinetobacter strains. Lane 1, WM96; lane 2, WM97a; lane 3, WM98a; lane 4, WM99c; lane 5, PW01c; lane 6, RB02d; lane 7, RB01; lane M1, 1-kb marker (Gibco); lane M2, 2.5-kb Molecular Ruler (Bio-Rad); lane i, E. coli DH5α chromosomal DNA; lane ii, uncut pBC-SK (3.4 kb; Stratagene); lane iii, EcoRI-restricted pBC-SK; lane iv, R751 (53.0 kb); lane v, R934 (72 kb).

DISCUSSION

It seems likely that the carbapenem-resistant phenotype of the Australian Acinetobacter baumannii isolates that we examined is attributable primarily to the serine protease encoded by blaOXA-23. This gene was consistently and uniquely associated with EDTA-independent carbapenemase activity in the periplasm for a number of distinct strains, and only the presence of ISAba1-blaOXA-23 predicted a resistant phenotype.

The presence of blaOXA-23 in a number of different pulsotypes present at different times and isolated from different hospitals implies mobility. Conjugative plasmids may be important in Acinetobacter (7), and blaOXA-23 has previously been associated with plasmid-mediated transfer into Acinetobacter junii (18, 37a). However, other studies have suggested a chromosomal location for blaOXA-23 or the minor variant blaOXA-27 (2, 20). We were unable to transfer ampicillin-resistant conjugative plasmids to E. coli, although it is not clear whether ISAba1-blaOXA-23 at low copy numbers would confer an ampicillin-resistant phenotype on E. coli (Espedido and Iredell, unpublished).

Although the blaOXA-23 gene has been always reported in the same genetic context, there is an expected reporting bias relating to the use of the primers outside the blaOXA-23 open reading frame. In all isolates examined here and in all available GenBank sequences of blaOXA-23 (AJ132105, AY795964, DQ029069, AY554200) and its variants blaOXA-27 (T162C A283G) (AF201828) and blaOXA-49 (GGC inserted between positions 656 and 657) (AY288523), the insertion sequence ISAba1 lies adjacent to the start of the gene. It is evident that ISAba1 is a general feature of A. baumannii (38), and we found this insertion element to be present in all A. baumannii strains that we examined but in none of the DNA group 3 or 13TU strains.

Previous studies of blaOXA-23-positive A. baumannii outbreaks have generally described them as clonal (6, 20, 27). Localized expansions of successful clones are to be expected, but in these studies, isolates were collected over a limited period. Our study included a larger number of carbapenem-resistant isolates that were collected over a much longer (4-year) period and revealed mini-epidemics of cocirculating, partially related or unrelated isolates, all carrying the same carbapenem resistance determinant (blaOXA-23), in a single ICU and in other centers. The nature and apparent ubiquity of the associated insertion element ISAba1 is such that formation of independently mobile composite transposons might be predicted. One such structure has been described recently (35a) and might help explain the establishment of blaOXA-23 and the carbapenem-resistant phenotype in successive cocirculating A. baumannii strains.

The presence of class 1 integrons has been suggested as a diagnostic marker for epidemic strains of A. baumannii (22, 47). We detected class 1 integrons in the majority of, but not all, isolates, including species other than A. baumannii, and in the rare pulsotype V, which would not be considered epidemic. It also has been suggested that “integron typing” may provide useful information for epidemiological studies (47), but it is important not to equate a “cassette array” with an “integron” in this context. Class 1 integrons include conserved segments that flank the variable cassette array region, as well as other components, and cassette arrays have the potential to move between integrons with different structures by homologous recombination (32).

Cassette arrays in class 1 integrons have previously been found in strains containing blaOXA-23 (47) and were also present in some of the isolates examined here. Multiple sequences of the dfrA17-aadA5 and blaP1 arrays found here are available in GenBank, but there is only one recent example of blaP1 in Acinetobacter (GenBank accession no. DQ519091), and dfrA17-aadA5 has not been seen previously in this genus. The aacC1-orfP-orfP-orfQ-aadA1 and aacC1-orfP-orfQ-aadA1 cassette arrays seen here occur independently of blaOXA-23, and these arrays have previously been identified in different geographic locations. However, they appear to be largely restricted to A. baumannii (1, 13, 15, 30, 36, 47, 53), with only a single known example outside this species, in Serratia marcescens (5).

The identification of common genetic elements (ISAba1-blaOXA-23 and the aacC1-orfP-orfP-orfQ-aadA1 cassette array) in isolates with different cocirculating pulsotypes suggests horizontal transfer, which makes it difficult to define the clonality of an outbreak; isolates with the same genetic background can acquire different accessory genetic elements, and the same element may be associated with different “clones”. We believe that insightful analysis of the problem phenotype in our center was achieved with the application of a few widely used methods and required neither complex molecular biology nor extensive multicenter surveys. Whole genomic restriction followed by PFGE (ApaI PFGE) has proven a reliable epidemiological marker for Acinetobacter spp., even between centers (41). However, we believe that such epidemiological tools should be complemented by analysis of potentially mobile genetic elements, including plasmids, integrons, and cassette arrays, and elements such as ISAba1-blaOXA-23, and that this may be considerably more informative.

Acknowledgments

This study was supported in part by unrestricted educational grants from Bristol-Myers Squibb, AstraZeneca, and Wyeth Labs Australia and by grants from the Australia New Zealand Intensive Care Foundation, the National Health and Medical Research Council (Australia), and NSW Health (New South Wales Government, to CIDM-Public Health). J.K.V. was supported by a scholarship from CIDM-Public Health.

We owe thanks to Peter Jelfs (ICPMR, Westmead) for assistance with PFGE and provision of isolates and to David Mitchell (Westmead), Jeannette Pham (Prince of Wales), and Joan Faoagali (Royal Brisbane Hospital) for provision of isolates.

Footnotes

▿

Published ahead of print on 15 November 2006.

REFERENCES

  • 1.Abbott, Y., R. O'Mahony, N. Leonard, P. J. Quinn, T. van der Reijden, L. Dijkshoorn, and S. Fanning. 2005. Characterization of a 2.6 kbp variable region within a class 1 integron found in an Acinetobacter baumannii strain isolated from a horse. J. Antimicrob. Chemother. 55:367-370. [DOI] [PubMed] [Google Scholar]
  • 2.Afzal-Shah, M., N. Woodford, and D. M. Livermore. 2001. Characterization of OXA-25, OXA-26, and OXA-27, molecular class D β-lactamases associated with carbapenem resistance in clinical isolates of Acinetobacter baumannii. Antimicrob. Agents Chemother. 45:583-588. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Bergogne-Bérézin, E., and K. J. Towner. 1996. Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin. Microbiol. Rev. 9:148-165. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Bou, G., A. Oliver, and J. Martínez-Beltrán. 2000. OXA-24, a novel class D β-lactamase with carbapenemase activity in an Acinetobacter baumannii clinical strain. Antimicrob. Agents Chemother. 44:1556-1561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Centrón, D., and P. H. Roy. 2002. Presence of a group II intron in a multiresistant Serratia marcescens strain that harbors three integrons and a novel gene fusion. Antimicrob. Agents Chemother. 46:1402-1409. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Dalla-Costa, L. M., J. M. Coelho, H. A. Souza, M. E. Castro, C. J. Stier, K. L. Bragagnolo, A. Rea-Neto, S. R. Penteado-Filho, D. M. Livermore, and N. Woodford. 2003. Outbreak of carbapenem-resistant Acinetobacter baumannii producing the OXA-23 enzyme in Curitiba, Brazil. J. Clin. Microbiol. 41:3403-3406. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.De, A., and L. Deodhar. 1995. Antibiotic resistance pattern and R-plasmids of Acinetobacter calcoaceticus subsp. anitratus. Indian J. Pathol. Microbiol. 38:185-188. [PubMed] [Google Scholar]
  • 8.Dehio, C., and M. Meyer. 1997. Maintenance of broad-host-range incompatibility group P and group Q plasmids and transposition of Tn5 in Bartonella henselae following conjugal plasmid transfer from Escherichia coli. J. Bacteriol. 179:538-540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8a.de la Cruz, and J. Grinsted. 1982. Genetic and molecular characterization of Tn21, a multiple resistance transposon from R100.1. J. Bacteriol. 151:222-228. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dijkshoorn, L., B. Van Harsselaar, I. Tjernberg, P. J. Bouvet, and M. Vaneechoutte. 1998. Evaluation of amplified ribosomal DNA restriction analysis for identification of Acinetobacter genomic species. Syst. Appl. Microbiol. 21:33-39. [DOI] [PubMed] [Google Scholar]
  • 10.Dillon, B., L. Thomas, G. Mohmand, A. Zelynski, and J. Iredell. 2005. Multiplex PCR for screening of integrons in bacterial lysates. J. Microbiol. Methods 62:221-232. [DOI] [PubMed] [Google Scholar]
  • 11.Donald, H. M., W. Scaife, S. G. Amyes, and H.-K. Young. 2000. Sequence analysis of ARI-1, a novel OXA β-lactamase, responsible for imipenem resistance in Acinetobacter baumannii 6B92. Antimicrob. Agents Chemother. 44:196-199. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Fernández-Cuenca, F., L. Martínez-Martínez, M. C. Conejo, J. A. Ayala, E. J. Perea, and A. Pascual. 2003. Relationship between β-lactamase production, outer membrane protein and penicillin-binding protein profiles on the activity of carbapenems against clinical isolates of Acinetobacter baumannii. J. Antimicrob. Chemother. 51:565-574. [DOI] [PubMed] [Google Scholar]
  • 13.Fournier, P. E., D. Vallenet, V. Barbe, S. Audic, H. Ogata, L. Poirel, H. Richet, C. Robert, S. Mangenot, C. Abergel, P. Nordmann, J. Weissenbach, D. Raoult, and J.-M. Claverie. 2006. Comparative genomics of multidrug resistance in Acinetobacter baumannii. PLoS Genet. 2:62-72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Garcia, D. C., M. M. Nociari, D. O. Sordelli, A. Di Martino, and M. Catalano. 1996. The use of plasmid profile analysis and ribotyping for typing Acinetobacter baumannii isolates. J. Hosp. Infect. 34:139-144. [DOI] [PubMed] [Google Scholar]
  • 15.Gombac, F., M. L. Riccio, G. M. Rossolini, C. Lagatolla, E. Tonin, C. Monti-Bragadin, A. Lavenia, and L. Dolzani. 2002. Molecular characterization of integrons in epidemiologically unrelated clinical isolates of Acinetobacter baumannii from Italian hospitals reveals a limited diversity of gene cassette arrays. Antimicrob. Agents Chemother. 46:3665-3668. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Grundmann, H. J., K. J. Towner, L. Dijkshoorn, P. Gerner-Smidt, M. Maher, H. Seifert, and M. Vaneechoutte. 1997. Multicenter study using standardized protocols and reagents for evaluation of reproducibility of PCR-based fingerprinting of Acinetobacter spp. J. Clin. Microbiol. 35:3071-3077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Héritier, C., A. Dubouix, L. Poirel, N. Marty, and P. Nordmann. 2005. A nosocomial outbreak of Acinetobacter baumannii isolates expressing the carbapenem-hydrolysing oxacillinase OXA-58. J. Antimicrob. Chemother. 55:115-118. [DOI] [PubMed] [Google Scholar]
  • 18.Héritier, C., L. Poirel, T. Lambert, and P. Nordmann. 2005. Contribution of acquired carbapenem-hydrolyzing oxacillinases to carbapenem resistance in Acinetobacter baumannii. Antimicrob. Agents Chemother. 49:3198-3202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Houang, E. T. S., Y.-W. Chu, W.-S. Lo, K.-Y. Chu, and A. F. B. Cheng. 2003. Epidemiology of rifampin ADP-ribosyltransferase (arr-2) and metallo-β-lactamase (blaIMP-4) gene cassettes in class 1 integrons in Acinetobacter strains isolated from blood cultures in 1997 to 2000. Antimicrob. Agents Chemother. 47:1382-1390. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Jeon, B.-C., S. H. Jeong, I. K. Bae, S. B. Kwon, K. Lee, D. Young, J. H. Lee, J. S. Song, and S. H. Lee. 2005. Investigation of a nosocomial outbreak of imipenem-resistant Acinetobacter baumannii producing the OXA-23 β-lactamase in Korea. J. Clin. Microbiol. 43:2241-2245. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Kado, C. I., and S.-T. Liu. 1981. Rapid procedure for detection and isolation of large and small plasmids. J. Bacteriol. 145:1365-1373. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Koeleman, J. G., J. Stoof, M. W. Van Der Bijl, C. M. Vandenbroucke-Grauls, and P. H. Savelkoul. 2001. Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J. Clin. Microbiol. 39:8-13. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Lee, K., Y. Chong, H. B. Shin, Y. A. Kim, D. Yong, and J. H. Yum. 2001. Modified Hodge and EDTA-disk synergy tests to screen metallo-β-lactamase-producing strains of Pseudomonas and Acinetobacter species. Clin. Microbiol. Infect. 7:88-91. [DOI] [PubMed] [Google Scholar]
  • 24.Limansky, A. S., M. A. Mussi, and A. M. Viale. 2002. Loss of a 29-kilodalton outer membrane protein in Acinetobacter baumannii is associated with imipenem resistance. J. Clin. Microbiol. 40:4776-4778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Masuda, G., S. Tomioka, and M. Hasegawa. 1976. Detection of β-lactamase production by gram-negative bacteria. J Antibiot. (Tokyo) 29:662-664. [DOI] [PubMed] [Google Scholar]
  • 26.Mazel, D., B. Dychinco, V. A. Webb, and J. Davies. 2000. Antibiotic resistance in the ECOR collection: integrons and identification of a novel aad gene. Antimicrob. Agents Chemother. 44:1568-1574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Naas, T., M. Levy, C. Hirschauer, H. Marchandin, and P. Nordmann. 2005. Outbreak of carbapenem-resistant Acinetobacter baumannii producing the carbapenemase OXA-23 in a tertiary care hospital of Papeete, French Polynesia. J. Clin. Microbiol. 43:4826-4829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Nemec, A., L. Dijkshoorn, and P. Jezek. 2000. Recognition of two novel phenons of the genus Acinetobacter among non-glucose-acidifying isolates from human specimens. J. Clin. Microbiol. 38:3937-3941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Nemec, A., L. Dijkshoorn, and T. J. van der Reijden. 2004. Long-term predominance of two pan-European clones among multi-resistant Acinetobacter baumannii strains in the Czech Republic. J. Med. Microbiol. 53:147-153. [DOI] [PubMed] [Google Scholar]
  • 30.Nemec, A., L. Dolzani, S. Brisse, P. van den Broek, and L. Dijkshoorn. 2004. Diversity of aminoglycoside-resistance genes and their association with class 1 integrons among strains of pan-European Acinetobacter baumannii clones. J. Med. Microbiol. 53:1233-1240. [DOI] [PubMed] [Google Scholar]
  • 31.Osborne, R. S., and T. J. Silhavy. 1993. PrlA suppressor mutations cluster in regions corresponding to three distinct topological domains. EMBO J. 12:3391-3398. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Partridge, S. R., H. J. Brown, and R. M. Hall. 2002. Characterization and movement of the class 1 integron known as Tn2521 and Tn1405. Antimicrob. Agents Chemother. 46:1288-1294. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Playford, E. G., J. C. Craig, and J. R. Iredell. Carbapenem-resistant Acinetobacter baumanii in intensive care unit patients: risk factors for acquisition, infection and their consequences. J. Hosp. Infect., in press. [DOI] [PubMed]
  • 34.Poirel, L., and P. Nordmann. 2006. Carbapenem resistance in Acinetobacter baumannii: mechanisms and epidemiology. Clin. Microbiol. Infect. 12:826-836. [DOI] [PubMed] [Google Scholar]
  • 35.Poirel, L., and P. Nordmann. 2006. Genetic structures at the origin of acquisition and expression of the carbapenem-hydrolyzing oxacillinase gene blaOXA-58 in Acinetobacter baumannii. Antimicrob. Agents Chemother. 50:1442-1448. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35a.Poirel, L., S. Corvec, H. Drugeon, and P. Nordmann. 2006. Genetics of acquisition and expression of the carbapenem-hydrolyzing oxacillinase gene blaOXA-23 in Acinetobacter baumannii, abstr. C1-57. Abstr. 46th Intersci. Conf. Antimicrob. Agents Chemother. [DOI] [PMC free article] [PubMed]
  • 36.Ribera, A., J. Vila, F. Fernández-Cuenca, L. Martínez-Martínez, A. Pascual, A. Beceiro, G. Bou, J. M. Cisneros, J. Pachón, and J. Rodríguez-Bano. 2004. Type 1 integrons in epidemiologically unrelated Acinetobacter baumannii isolates collected at Spanish hospitals. Antimicrob. Agents Chemother. 48:364-365. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed., vol. 1. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
  • 37a.Scaife, W., H.-K. Young, R. H. Paton, and S. G. B. Amyes. 1995. Letter. J. Antimicrob. Chemother. 36:585-587. [DOI] [PubMed] [Google Scholar]
  • 38.Segal, H., S. Garny, and B. G. Elisha. 2005. Is ISABA-1 customized for Acinetobacter? FEMS Microbiol. Lett. 243:425-429. [DOI] [PubMed] [Google Scholar]
  • 39.Segal, H., E. C. Nelson, and B. G. Elisha. 2004. Genetic environment and transcription of ampC in an Acinetobacter baumannii clinical isolate. Antimicrob. Agents Chemother. 48:612-614. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Segal, H., R. Thomas, and B. G. Elisha. 2003. Characterization of class 1 integron resistance gene cassettes and the identification of a novel IS-like element in Acinetobacter baumannii. Plasmid 49:169-178. [DOI] [PubMed] [Google Scholar]
  • 41.Seifert, H., L. Dolzani, R. Bressan, T. van der Reijden, B. van Strijen, D. Stefanik, H. Heersma, and L. Dijkshoorn. 2005. Standardization and interlaboratory reproducibility assessment of pulsed-field gel electrophoresis-generated fingerprints of Acinetobacter baumannii. J. Clin. Microbiol. 43:4328-4335. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Senda, K., Y. Arakawa, S. Ichiyama, K. Nakashima, H. Ito, S. Ohsuka, K. Shimokata, N. Kato, and M. Ohta. 1996. PCR detection of metallo-β-lactamase gene blaIMP in gram-negative rods resistant to broad-spectrum β-lactams. J. Clin. Microbiol. 34:2909-2913. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Shahcheraghi, F., M. M. Feizabadi, V. Yamin, R. Abiri, and Z. Abedian. 2003. Serovar determination, drug resistance patterns and plasmid profiles of Pseudomonas aeruginosa isolated from burn patients at two hospitals of Tehran (Iran). Burns 29:547-551. [DOI] [PubMed] [Google Scholar]
  • 44.Shibata, N., Y. Doi, K. Yamane, T. Yagi, H. Kurokawa, K. Shibayama, H. Kato, K. Kai, and Y. Arakawa. 2003. PCR typing of genetic determinants for metallo-β-lactamases and integrases carried by gram-negative bacteria isolated in Japan, with focus on the class 3 integron. J. Clin. Microbiol. 41:5407-5413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tsakris, A., S. Pournaras, N. Woodford, M. F. Palepou, G. S. Babini, J. Douboyas, and D. M. Livermore. 2000. Outbreak of infections caused by Pseudomonas aeruginosa producing VIM-1 carbapenemase in Greece. J. Clin. Microbiol. 38:1290-1292. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Turton, J. F., M. E. Kaufmann, J. Glover, J. M. Coelho, M. Warner, R. Pike, and T. L. Pitt. 2005. Detection and typing of integrons in epidemic strains of Acinetobacter baumannii found in the United Kingdom. J. Clin. Microbiol. 43:3074-3082. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Turton, J. F., M. E. Ward, N. Woodford, M. E. Kaufmann, R. Pike, D. M. Livermore, and T. L. Pitt. 2006. The role of ISAba1 in expression of OXA carbapenemase genes in Acinetobacter baumannii. FEMS Microbiol. Lett. 258:72-77. [DOI] [PubMed] [Google Scholar]
  • 49.Walsh, T. R., M. A. Toleman, L. Poirel, and P. Nordmann. 2005. Metallo-β-lactamases: the quiet before the storm? Clin. Microbiol. Rev. 18:306-325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.White, P. A., C. J. McIver, Y.-M. Deng, and W. D. Rawlinson. 2000. Characterisation of two new gene cassettes, aadA5 and dfrA17. FEMS Microbiol. Lett. 182:265-269. [DOI] [PubMed] [Google Scholar]
  • 51.Wroblewska, M. M., L. Dijkshoorn, H. Marchel, M. van den Barselaar, E. Swoboda-Kopec, P. J. van den Broek, and M. Luczak. 2004. Outbreak of nosocomial meningitis caused by Acinetobacter baumannii in neurosurgical patients. J. Hosp. Infect. 57:300-307. [DOI] [PubMed] [Google Scholar]
  • 52.Yu, Y. S., Q. Yang, X. W. Xu, H. S. Kong, G. Y. Xu, and B. Y. Zhong. 2004. Typing and characterization of carbapenem-resistant Acinetobacter calcoaceticus-baumannii complex in a Chinese hospital. J. Med. Microbiol. 53:653-656. [DOI] [PubMed] [Google Scholar]
  • 53.Zarrilli, R., M. Crispino, M. Bagattini, E. Barretta, A. Di Popolo, M. Triassi, and P. Villari. 2004. Molecular epidemiology of sequential outbreaks of Acinetobacter baumannii in an intensive care unit shows the emergence of carbapenem resistance. J. Clin. Microbiol. 42:946-953. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES