Abstract
Using the genomic sequence of Clostridium difficile strain 630, we developed multiple-locus variable-number tandem-repeat analysis (MLVA) with automated fragment analysis and multicolored capillary electrophoresis as a typing method for C. difficile. All reference strains, representing 31 serogroups, 25 toxinotypes, and 7 known subtypes of PCR ribotype 001, could be discriminated from each other. Application of MLVA to 28 isolates from 7 outbreaks due to the emerging hypervirulent PCR ribotype 027-pulsed-field gel electrophoresis type NAP1 resulted in recognition of 13 clusters. Additionally, 29 toxin A-negative, toxin B-positive isolates belonging to PCR ribotype 017 from eight different countries revealed eight country-specific clusters. MLVA is a highly discriminatory genotyping method and a new tool for subtyping of newly emerging variants of C. difficile.
To study the epidemiology of Clostridium difficile, a typing method with higher discriminatory power, typeability, and reproducibility than currently available methods is required. Multiple-locus variable-number tandem-repeat analysis (MLVA) is a new candidate technique that has already been applied successfully to a number of bacterial and fungal species (5, 10). Recently, MLVA using automated sequence detection and subsequent manual determination of the number of repeat loci has been developed for C. difficile (12). For faster and easier application of the MLVA to C. difficile, we developed an MLVA method using smaller short tandem repeats (2 to 9 bp) to facilitate automated fragment analysis with multicolored capillary electrophoresis instead of sequencing. Subsequently, we applied MLVA to seven subtypes of a common PCR ribotype, 001, and two other, emerging PCR ribotypes of C. difficile. Since 2004, a new toxin-hyperproducing C. difficile strain, characterized as PCR ribotype 027, toxinotype III, pulsed-field gel electrophoresis (PFGE) type NAP1, and restriction endonuclease analysis (REA) group BI, has been recognized in Canada, the United States, the United Kingdom, The Netherlands, Belgium, and France as an important cause of hospital outbreaks (3, 8, 9, 11, 13). Additionally, an increasing number of reports mention severe infections and outbreaks due to toxin A-negative, toxin B-positive isolates (1, 2, 7, 14). These toxin A-negative, toxin B-positive isolates belong to PCR ribotype 017, REA group CF, and toxinotype VIII and were first recognized as the cause of an outbreak in 1999 in Canada (1, 2).
Bacterial strains.
Isolates included in the analysis were 57 reference strains, all seven subtypes of PCR ribotype 001, 27 toxin A-negative, toxin B-positive isolates belonging to PCR ribotype 017 from eight different countries, and 29 isolates belonging to PCR ribotype 027 from The Netherlands (Table 1) and the United Kingdom. Of these 29 PCR ribotype 027 strains, 28 strains were outbreak related, from six different hospitals in The Netherlands and one in the United Kingdom, and 1 strain was a sporadic isolate from 2003 (8). The United Kingdom strain was obtained from Jon Brazier (Anaerobe Reference Laboratory, NPHS Microbiology Cardiff, Cardiff, United Kingdom). The outbreak strains of each hospital were randomly selected. DNA was isolated from colonies of C. difficile by QiaAmp DNA isolation columns (QIAGEN, Hilden, Germany) according to the manufacturer's recommendations. PCR ribotyping was performed as described previously (4), and the method of Rupnik et al. was used for toxinotyping (15).
TABLE 1.
Isolates included in this study
| Characteristic | No. of isolates (total, 120) | Isolate identification | Outbreak or sporadic | Origin (reference) |
|---|---|---|---|---|
| Serogroups | 31 | A to I, K, X, A1 to A11, A13 to A17, S1 to S4 | NAa | Gift from M. Delmée |
| Toxinotypes | 25 | I to XXII | NA | Gift from M. Rupnik |
| Strain 630 | 1 | 630 | NA | Gift from P. Mastrantonio |
| Subtypes of PCR ribotype 001, by REP-PCRb | 7 | 001-1 to 001-7 | NA | Gift from J. Brazier |
| Toxin A-negative, toxin B-positive isolates, PCR ribotype 017 | 12 | Arg28, -31, -32, -36 to -38, -77, -126, -127, -134, -143, -152 | Outbreak | Argentina; gift from C. Legaria |
| 2 | CD16, CD17 | Outbreak | Amsterdam, The Netherlands (18) | |
| 2 | Can1, Can3 | Outbreak | Canada (18) | |
| 1 | 123825R | Endemic | Leiden, The Netherlands | |
| 2 | 1110/98, 1745/00 | Endemic | Poland (18) | |
| 2 | 60, 99-3050 | Endemic | France (18) | |
| 2 | CF2, CF4 | Endemic | United States (18) | |
| 2 | R10205, R10430 | Endemic | United Kingdom (18) | |
| 2 | GAI95601, GAI95602 | Endemic | Japan (18) | |
| Isolates belonging to PCR ribotype 027 | 5 | AF1 to -5 | Outbreak | Amersfoort, The Netherlands (8) |
| 7 | AMC1 to -7 | Outbreak | Amsterdam-1, The Netherlands (8) | |
| 1 | VUMC | Endemic | Amsterdam-2, The Netherlands (8) | |
| 3 | SV1 to -3 | Outbreak | Amsterdam-3, The Netherlands (8) | |
| 4 | HL1 to -4 | Outbreak | Haarlem, The Netherlands (8) | |
| 5 | HW1 to -5 | Outbreak | Harderwijk, The Netherlands (8) | |
| 3 | UMC1 to -3 | Outbreak | Utrecht, The Netherlands (8) | |
| 1 | UK027 | Outbreak | United Kingdom (gift from J. Brazier) |
NA, not applicable.
REP, repetitive extragenic palindromic.
MLVA.
Seven regions with short tandem repeats spread over the genome, designated markers MLVA C. difficile A6 (A6Cd), B7Cd, C6Cd, E7Cd, F3Cd, G8Cd, and H9Cd, were identified using Tandem Repeat Finder, version 3.21, on the genome of C. difficile strain 630 (http://www.sanger.ac.uk/Projects/C_difficile/) (16). Four of these, MLVA A6Cd, B7Cd, E7Cd, and G8Cd, were identical to CDR4, CDR49, CDR48, and CDR9, respectively, in the assay described recently by Marsh et al. (12). Primers were designed based on the flanking sequences of the repeats using the Primer3 program (http://www.broad.mit.edu/cgi-bin/primer/primer3_www.cgi). Three separate duplex PCRs (MLVA A6Cd-H9Cd, B7Cd-F3Cd, and C6Cd-E7Cd) and one singleplex PCR (MLVA G8Cd) were developed (Table 2). The repeats were amplified using a single PCR protocol. The amplification reactions were performed in a 50-μl final volume containing 25 μl of HotStar Taq master mix (QIAGEN, Hilden, Germany), 1 μM each primer, 3 mM magnesium chloride, and 5 μl of DNA. After an initial enzyme activation step of 15 min at 95°C, the protocol consisted of 35 cycles of 30 s at 94°C for denaturation, 30 s at 51°C for annealing, and 30 s at 72°C for elongation. A final elongation step was performed for 10 min at 72°C. The forward primer of each PCR was labeled at the 5′ end with either carboxyfluorescein (FAM), hexachlorofluorescein (HEX), 2′-chloro-7′-phenyl-1,4-dichloro-6-carboxyfluorescein (VIC), or 2′-chloro-5′-fluoro-7′,8′-fused phenyl-1,4-dichloro-6-carboxyfluorescein (NED). PCR fragments were analyzed using multicolored capillary electrophoresis on an ABI3100 genetic analyzer, with a ROX500 marker as an internal marker for each sample. The size of each marker was determined by Genescan software (Applied Biosystems). Markers from a selected number of isolates were sequenced to verify accurate assignment of repeat numbers. All sequence results were equal to the results of fragment analysis by the ABI system and to the calculated repeat numbers. The repeat numbers were analyzed using BioNumerics (version 3.5) software (Applied Maths, Kortrijk, Belgium) and the unweighted-pair group method with arithmetic averages (UPGMA) with the multistate categorical similarity coefficient (MCSC). All markers were given equal weight, irrespective of the number of repeats. The percentages in the dendrogram reflect the percentage of homology between the specific markers. Thus, if two strains have an equal number of repeats in six of seven markers, they are 86% identical.
TABLE 2.
Characteristics of markers and primers
| Marker | Repeat motif | Locationa | Forward primer sequence (label-5′→3′) | Reverse primer sequence (5′→3′) |
|---|---|---|---|---|
| A6Cd | AAGAGC | 755721 | FAM-TTAATTGAGGGAGAATGTTAAA | AAATACTTTTCCCACTTTCATAA |
| B7Cd | ATCTTCT | 3688632 | FAM-CTTAATACTAAACTAACTCTAACCAGTAA | TTATATTTTATGGGCATGTTAAA |
| C6Cd | TATTGC | 3239736 | HEX-GTTTAGAATCTACAGCATTATTTGA | ATTGGAATTGAATGTAACAAAA |
| E7Cd | ATAGATT | 167124 | FAM-TGGAGCTATGGAAATTGATAA | CAAATACATCTTGCATTAATTCTT |
| F3Cd | TTA | 1954915 | HEX-TTTTTGAAACTGAACCAACATA | ACAAAAGACTGTGCAAATATACTAA |
| G8Cd | TAAAAGAG | 664660 | NED-TGTATGAAGCAAGCTTTTTATT | AATCCAGCAATCTAATAATCCA |
| H9Cd | TCTTCTTCC | 4116072 | VIC-GTTTTGAGGAAACAAACCTATC | GATGAGGAAATAGAAGAGTTCAA |
Location on the genomic sequence of strain 630 (36).
C. difficile control strain 630 revealed identical results in five different experiments using both separate cultures and DNA extractions. The stability of the repeat numbers of the different markers was tested in duplicate after isolates belonging to PCR ribotypes 014 and 027 were subcultured a total of 10 and 30 times. The repeats from the isolate belonging to type 014 were stable in all experiments. An expansion of 1 repeat unit in marker A6Cd was observed in one duplicate sample of the type 027 isolate after 10 subcultures, which subsequently returned to the original number of repeats after 30 subcultures. For marker C6Cd, a reduction of 1 repeat unit could be detected after 30 subcultures for this isolate. Based on the stability tests, we concluded that a difference of 1 repeat unit between strains should not be interpreted as indicative of separate types or subtypes. This conclusion is in complete concordance with the study of the stability of C. difficile MLVA loci by Marsh et al. (12). They found three pairs of serial isolates from individual patients with a single-locus variation of only 1 tandem repeat and one pair of isolates with a double-locus variation of 1 tandem repeat each. Therefore, they concluded that isolates with a summed tandem repeat difference of ≤2 are genetically related. MLVA discriminated between isolates belonging to all 31 serogroups, the 7 subtypes of PCR ribotype 001, and all 25 toxinotypes, except for toxinotypes XII, XIII, and XIV. An isolate belonging to serogroup A15 was completely identical (100%) to toxinotype V, as has been observed previously (15). Toxinotypes XII, XIII, and XIV were clustered into one MLVA type with 100% similarity, indicating that toxinotyping is a method that merely reflects the status of the toxin genes (15). With one marker difference, toxinotype XIb was comparable to the 100% cluster of toxinotypes XII to XIV. The similarity of isolate 630 to serogroup C (the closest match) was only 43% (3 of the 7 markers), although markers B7Cd and E7Cd differed by only 1 repeat. PCR ribotype 001 isolates were quite stable in markers E7Cd (5 to 7 repeats), F3Cd (5 repeats), G8Cd (6 to 8 repeats), and H9Cd (2 repeats). By using these characteristics, type 001 isolates can be discriminated from most serogroups and toxinotypes. Consequently, MLVA is able to replace PCR ribotyping and PFGE for identification and recognition of subtypes of PCR ribotype 001. Until recently, strains belonging to PCR ribotype 001 were the most common in the United Kingdom, and the importance of the ability to subtype these strains is high (6, 17). A recent Health Protection Agency report (available at http://www.hpa.org.uk/) indicated that PCR ribotypes 106 and 027 are the most common in the United Kingdom, followed by type 001 (still approximately 25%) (6a).
Among the isolates belonging to PCR ribotype 027 (n = 29), 100% similarity (Fig. 1) was detected for isolate AF4 with HW3, for isolate SV1 with SV2, for isolate AF5 with AMC4, HW1, HW2, and HW5, and for isolate AMC3 with AMC6 and AMC7. With 86% similarity, 14 clusters were detected among the 29 isolates. Hospital-specific clusters were seen for SV, HW, HL, and AMC (Fig. 1). The sporadic endemic isolate recovered in 2003 was only 53% similar to the outbreak isolates and 71% similar to isolate HL3. The United Kingdom isolate was only 40% identical to all Dutch outbreak isolates. For all type 027 isolates, markers E7Cd, F3Cd, and H9Cd were completely identical, except for the United Kingdom isolate, which had 6 repeats for marker E7Cd (Fig. 1).
FIG. 1.
Dendrogram based on profiles of seven markers for all PCR ribotype 027 isolates (n = 29) tested in this study. Numbers of repeats for the specified markers in each strain are given on the right.
Toxin A-negative, toxin B-positive isolates (including the two reference strains belonging to serogroup F and toxinotype VIII) (n = 29), belonging to PCR ribotype 017 and toxinotype VIII, could be divided into eight clusters at a similarity of 86% (6 markers identical) (Table 3, clusters G to N). Six clusters with 100% homology were recognized (Table 3, clusters A to F). All isolates with 100% similarity were country specific (clusters A to F), as were clusters H and I. Toxin A-negative, toxin B-positive isolates could be differentiated from all other types by using the combination of markers A6Cd (2 repeats), F3Cd (5 repeats), G8Cd (fragment size, >400 bp), and H9Cd (2 repeats). For marker G8Cd, all PCR ribotype 017 isolates showed the previously described larger fragment size, exceeding the 400 bp detectable by our system. MLVA discriminated toxin A-negative, toxin B-positive isolates better than amplified fragment length polymorphism (18).
TABLE 3.
MLVA results and cluster information for toxin A-negative, toxin B-positive isolates belonging to PCR ribotype 017 isolatesa tested in this study
| Isolate | Origin | No. of repeats detected for the following marker:
|
Cluster(s)b | ||||||
|---|---|---|---|---|---|---|---|---|---|
| A6Cd | B7Cd | C6Cd | E7Cd | F3Cd | G8Cd | H9Cd | |||
| Arg32 | Argentina | 2 | 7 | 18 | 7 | 5 | >400 | 2 | G |
| Arg38 | Argentina | 2 | 7 | 17 | 7 | 5 | >400 | 2 | G |
| CF2 | United States | 2 | 7 | 31 | 7 | 5 | >400 | 2 | G |
| Can3 | Canada | 2 | 9 | 20 | 7 | 5 | >400 | 2 | H |
| 1110/98 | Poland | 2 | 10 | 23 | 7 | 5 | >400 | 2 | I |
| 1745/00 | Poland | 2 | 10 | 15 | 7 | 5 | >400 | 2 | I |
| R10205 | United Kingdom | 2 | 8 | 26 | 8 | 5 | >400 | 2 | A, J |
| R10430 | United Kingdom | 2 | 8 | 26 | 8 | 5 | >400 | 2 | A, J |
| Can1 | Canada | 2 | 8 | 22 | 8 | 5 | >400 | 2 | J |
| CF4 | United States | 2 | 8 | 30 | 8 | 5 | >400 | 2 | J |
| F | Reference strain | 2 | 13 | 22 | 8 | 5 | >400 | 2 | K |
| CD16 | Amsterdam | 2 | 10 | 30 | 8 | 5 | >400 | 2 | B, L |
| CD17 | Amsterdam | 2 | 10 | 30 | 8 | 5 | >400 | 2 | B, L |
| 123825R | Leiden | 2 | 10 | 32 | 8 | 5 | >400 | 2 | L |
| GAI95601 | Japan | 2 | 10 | 43 | 8 | 5 | >400 | 2 | L |
| GAI95602 | Japan | 2 | 10 | 40 | 8 | 5 | >400 | 2 | L |
| Arg77 | Argentina | 2 | 7 | 20 | 8 | 5 | >400 | 2 | C, M |
| Arg134 | Argentina | 2 | 7 | 20 | 8 | 5 | >400 | 2 | C, M |
| Arg152 | Argentina | 2 | 7 | 19 | 8 | 5 | >400 | 2 | D, M |
| Arg37 | Argentina | 2 | 7 | 19 | 8 | 5 | >400 | 2 | D, M |
| Arg127 | Argentina | 2 | 7 | 19 | 8 | 5 | >400 | 2 | D, M |
| Arg31 | Argentina | 2 | 7 | 18 | 8 | 5 | >400 | 2 | E, M |
| Arg126 | Argentina | 2 | 7 | 18 | 8 | 5 | >400 | 2 | E, M |
| Arg28 | Argentina | 2 | 7 | 21 | 8 | 5 | >400 | 2 | F, M |
| Arg36 | Argentina | 2 | 7 | 21 | 8 | 5 | >400 | 2 | F, M |
| Arg143 | Argentina | 2 | 7 | 22 | 8 | 5 | >400 | 2 | M |
| 60 (fr) | France | 2 | 7 | 28 | 8 | 5 | >400 | 2 | M |
| 99-3050 | France | 2 | 7 | 24 | 8 | 5 | >400 | 2 | M |
| VIII | Reference strain | 2 | 9 | 21 | 8 | 5 | >400 | 2 | N |
n = 29.
Clusters at 100% similarity: A to F. Clusters at 86% similarity: G to N.
Application of MLVA to C. difficile isolates was easy to perform and consisted of four separate PCR mixes and a single PCR protocol. Although MLVA has yet to show its value in longer-term epidemiology or phylogeny studies, MLVA can be widely applied in outbreak situations. Therefore, MLVA is an important new tool for study of the epidemiology of toxin A-negative, toxin B-positive PCR ribotype 017 isolates and PCR ribotype 027-PFGE NAP1-REA BI isolates, which are newly emerging worldwide. MLVA is a highly discriminatory genotyping method for C. difficile and is able to discriminate between isolates with identical PCR ribotypes belonging to types 001, 017, and 027. MLVA also clearly differentiated these PCR ribotypes from other PCR ribotypes included in this study. Future studies should be performed on all currently available PCR ribotypes to explore this in more detail.
Acknowledgments
This work was supported by a grant from the Foundation Microbiology Leiden, The Netherlands.
We thank, in alphabetical order, Michelle Alfa (University of Manitoba, Winnipeg, Canada), Frederic Barbut (Centre Hospitalo-Universitaire Saint-Antoine, Paris, France), Jon Brazier (University Hospital of Wales, United Kingdom), Stu Johnson (Northwestern University, Chicago, IL), Haru Kato (Gifu University School of Medicine, Gifu, Japan), Cristina Legaria (Hospital Tornú, Buenos Aires, Argentina), Paola Mastrantonio (Instituto Superiore di Sanita, Rome, Italy), Hanna Pituch (Medical University of Warsaw, Warsaw, Poland), and Maja Rupnik (University of Maribor, Maribor, Slovenia) for kindly providing the isolates used in this study.
Footnotes
Published ahead of print on 13 December 2006.
REFERENCES
- 1.al Barrak, A., J. Embil, B. Dyck, K. Olekson, D. Nicoll, M. Alfa, and A. Kabani. 1999. An outbreak of toxin A negative, toxin B positive Clostridium difficile-associated diarrhea in a Canadian tertiary-care hospital. Can. Commun. Dis. Rep. 25:65-69. [PubMed] [Google Scholar]
- 2.Alfa, M. J., A. Kabani, D. Lyerly, S. Moncrief, L. M. Neville, A. al Barrak, G. K. Harding, B. Dyck, K. Olekson, and J. M. Embil. 2000. Characterization of a toxin A-negative, toxin B-positive strain of Clostridium difficile responsible for a nosocomial outbreak of Clostridium difficile-associated diarrhea. J. Clin. Microbiol. 38:2706-2714. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Anonymous. 2005. Outbreak of Clostridium difficile in a hospital in south east England. CDR Weekly 15:1-2. [Google Scholar]
- 4.Bidet, P., F. Barbut, V. Lalande, B. Burghoffer, and J. C. Petit. 1999. Development of a new PCR-ribotyping method for Clostridium difficile based on ribosomal RNA gene sequencing. FEMS Microbiol. Lett. 175:261-266. [DOI] [PubMed] [Google Scholar]
- 5.de Valk, H. A., J. F. Meis, I. M. Curfs, K. Muehlethaler, J. W. Mouton, and C. H. Klaassen. 2005. Use of a novel panel of nine short tandem repeats for exact and high-resolution fingerprinting of Aspergillus fumigatus isolates. J. Clin. Microbiol. 43:4112-4120. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Fawley, W. N., P. Parnell, P. Verity, J. Freeman, and M. H. Wilcox. 2005. Molecular epidemiology of endemic Clostridium difficile infection and the significance of subtypes of the United Kingdom epidemic strain (PCR ribotype 1). J. Clin. Microbiol. 43:2685-2696. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6a.Health Protection Agency. 24July2006, posting date. Clostridium difficile: findings and recommendations from a review of the epidemiology and a survey of directors of infection prevention and control in England. Health Protection Agency, London, United Kingdom. [Online.] http://www.hpa.org.uk/infections/topics_az/clostridium_difficile/documents/Clostridium_difficile_survey_findings_recommendations.pdf.
- 7.Kuijper, E. J., J. de Weerdt, H. Kato, N. Kato, A. P. van Dam, E. R. van der Vorm, J. Weel, C. van Rheenen, and J. Dankert. 2001. Nosocomial outbreak of Clostridium difficile-associated diarrhoea due to a clindamycin-resistant enterotoxin A-negative strain. Eur. J. Clin. Microbiol. Infect. Dis. 20:528-534. [DOI] [PubMed] [Google Scholar]
- 8.Kuijper, E. J., R. J. van den Berg, S. Debast, C. E. Visser, D. Veenendaal, A. Troelstra, T. van der Kooi, S. van den Hof, and D. W. Notermans. 2006. Clostridium difficile ribotype 027, toxinotype III, The Netherlands. Emerg. Infect. Dis. 12:827-830. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Kuijper, E. J., B. Coignard, and P. Tüll. 2006. Emergence of Clostridium difficile-associated disease in Canada, the United States of America and Europe. Clin. Microbiol. Infect. 12(Suppl. 6):2-18. [DOI] [PubMed] [Google Scholar]
- 10.Lindstedt, B. A. 2005. Multiple-locus variable number tandem repeats analysis for genetic fingerprinting of pathogenic bacteria. Electrophoresis 26:2567-2582. [DOI] [PubMed] [Google Scholar]
- 11.Loo, V. G., L. Poirier, M. A. Miller, M. Oughton, M. D. Libman, S. Michaud, A. M. Bourgault, T. Nguyen, C. Frenette, M. Kelly, A. Vibien, P. Brassard, S. Fenn, K. Dewar, T. J. Hudson, R. Horn, P. Rene, Y. Monczak, and A. Dascal. 2005. A predominantly clonal multi-institutional outbreak of Clostridium difficile-associated diarrhea with high morbidity and mortality. N. Engl. J. Med. 353:2442-2449. [DOI] [PubMed] [Google Scholar]
- 12.Marsh, J. W., M. M. O'Leary, K. A. Shutt, A. W. Pasculle, S. Johnson, D. N. Gerding, C. A. Muto, and L. H. Harrison. 2006. Multilocus variable-number tandem-repeat analysis for investigation of Clostridium difficile transmission in hospitals. J. Clin. Microbiol. 44:2558-2566. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Pepin, J., L. Valiquette, M. E. Alary, P. Villemure, A. Pelletier, K. Forget, K. Pepin, and D. Chouinard. 2004. Clostridium difficile-associated diarrhea in a region of Quebec from 1991 to 2003: a changing pattern of disease severity. CMAJ 171:466-472. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Pituch, H., J. S. Brazier, P. Obuch-Woszczatynski, D. Wultanska, F. Meisel-Mikolajczyk, and M. Luczak. 2005. Prevalence and association of PCR ribotypes of Clostridium difficile isolated from symptomatic patients from Warsaw with macrolide-lincosamide-streptogramin B (MLSB) type resistance. J. Med. Microbiol. 55:207-213. [DOI] [PubMed] [Google Scholar]
- 15.Rupnik, M., V. Avesani, M. Janc, C. Eichel-Streiber, and M. Delmee. 1998. A novel toxinotyping scheme and correlation of toxinotypes with serogroups of Clostridium difficile isolates. J. Clin. Microbiol. 36:2240-2247. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Sebaihia, M., B. W. Wren, P. Mullany, N. F. Fairweather, N. Minton, R. Stabler, N. R. Thomson, A. P. Roberts, A. M. Cerdeno-Tarraga, H. Wang, M. T. Holden, A. Wright, C. Churcher, M. A. Quail, S. Baker, N. Bason, K. Brooks, T. Chillingworth, A. Cronin, P. Davis, L. Dowd, A. Fraser, T. Feltwell, Z. Hance, S. Holroyd, K. Jagels, S. Moule, K. Mungall, C. Price, E. Rabbinowitsch, S. Sharp, M. Simmonds, K. Stevens, L. Unwin, S. Whithead, B. Dupuy, G. Dougan, B. Barrell, and J. Parkhill. 2006. The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome. Nat. Genet. 38:779-786. [DOI] [PubMed] [Google Scholar]
- 17.Stubbs, S. L., J. S. Brazier, G. L. O'Neill, and B. I. Duerden. 1999. PCR targeted to the 16S-23S rRNA gene intergenic spacer region of Clostridium difficile and construction of a library consisting of 116 different PCR ribotypes. J. Clin. Microbiol. 37:461-463. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.van den Berg, R. J., E. C. Claas, D. H. Oyib, C. H. Klaassen, L. Dijkshoorn, J. S. Brazier, and E. J. Kuijper. 2004. Characterization of toxin A-negative, toxin B-positive Clostridium difficile isolates from outbreaks in different countries by amplified fragment length polymorphism and PCR ribotyping. J. Clin. Microbiol. 42:1035-1041. [DOI] [PMC free article] [PubMed] [Google Scholar]