Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2007 Jan 10;45(3):874–880. doi: 10.1128/JCM.01556-06

Multiplex Real-Time PCR Targeting the RNase P RNA Gene for Detection and Identification of Candida Species in Blood

Åsa Innings 1, Måns Ullberg 1, Anders Johansson 1,2, Carl Johan Rubin 1, Niklas Noreus 1, Magnus Isaksson 1, Björn Herrmann 1,*
PMCID: PMC1829127  PMID: 17215340

Abstract

We have developed a single-tube multiplex real-time PCR method for the detection of the eight most common Candida species causing septicemia: Candida albicans, C. dubliniensis, C. famata, C. glabrata, C. guilliermondii, C. krusei, C. parapsilosis, and C. tropicalis. The method developed targets the RNase P RNA gene RPR1. Sequences of this gene were determined for seven of the Candida species and showed surprisingly large sequence variation. C. glabrata was found to have a gene that was five times longer gene than those of the other species, and the nucleotide sequence similarity between C. krusei and C. albicans was as low as 55%. The multiplex PCR contained three probes that enabled the specific detection of C. albicans, C. glabrata, and C. krusei and a fourth probe that allowed the general detection of the remaining species. The method was able to detect 1 to 10 genome copies when the detection limit was tested repeatedly for the four species C. albicans, C. glabrata, C. krusei, and C. guilliermondii. No significant difference in the detection limit was seen when the multiplex format was compared with single-species PCR, i.e., two primers and one probe. The method detected eight clinically relevant Candida species and did not react with other tested non-Candida species or human DNA. The assay was applied to 20 blood samples from nine patients and showed a sensitivity similar to that of culture.


Invasive fungal infections have become an important cause of morbidity and mortality among immunocompromised patients, many of whom will undergo long-term treatment with antifungal agents. Although there is little evidence of emerging resistance in Candida albicans (17), long-term treatment may lead to an increase in non-C. albicans Candida infections (16). Two Candida species are problematic in this respect, as C. glabrata has low susceptibility to fluconazole and C. krusei is innately resistant (17). Early detection of the systemic fungal infection and rapid species identification are crucial for early and specific initiation of antifungal therapy.

The “gold standard” for the detection of systemic Candida infection is blood culture. However, blood cultures are slow, as at least 2 days must pass for a positive culture and up to 7 days must pass before a sample can be reliably declared negative. Species identification can also be laborious and time-consuming. Given the high mortality rates from candidemia, there is an obvious need for more rapid strategies based on nucleic acid amplification technologies.

The introduction of real-time PCR methods opens up new perspectives. Aside from the time saved, real-time PCR, compared with conventional PCR, decreases the risk of false-positive results due to PCR product carryover, and it allows a rapid comparison of the efficiencies of primers, probes, DNA extraction methods, and other criteria. The sensitivity of the PCR assay is, in addition to the DNA target and amplification efficiency, dependent on the sample preparation and DNA extraction method (3). The extraction method is particularly essential for sample materials such as blood. A very small quantity of fungal cells, or cell-free DNA, is expected, and therefore, a large amount of sample material is desirable. A number of real-time PCR methods for Candida detection from blood have been described previously (4, 14, 20, 26). However, no TaqMan probe-based real-time PCR to detect the main Candida species in a single test tube with high specificity and sensitivity has been developed.

Genes encoding ribozyme RNA have alternating conserved and variable regions, enabling the production of short PCR fragments that are especially suitable as real-time PCR targets. The gene coding for the RNA subunit of RNase P is present in cells in all three domains of life and has been shown to be an excellent target for the identification of bacterial species within the genera Streptococcus (10, 22), Legionella (19), and Chlamydia (9). The eukaryotic gene RPR1 appears to be more variable within genera than the corresponding gene, rnpB, in prokaryotes, but a conserved core has been found (23). Yeast RPR1 contains high sequence variability and is used here as the target for real-time PCR.

The real-time PCR assay presented here detects eight Candida species: C. albicans, C. dubliniensis, C. famata, C. glabrata, C. guilliermondii, C. krusei, C. parapsilosis, and C. tropicalis. The two most common species, C. albicans and C. glabrata, as well as the fluconazole-resistant species C. krusei were identified using species-specific TaqMan probes. The remaining species were detected by a broad-range TaqMan probe. Using a four-channel real-time instrument, the multiplex reaction can be performed in a single test tube.

MATERIALS AND METHODS

Fungal strains.

Culture collection strains were used to design the assay (Table 1). Validation of the multiplex PCR was performed using a collection of 35 clinical isolates and the culture collection strains Candida carpophila CBS 5256, C. famata CBS 1795 (anamorph of Debaromyces hansenii var. hansenii), Candida fermentati CBS 2022, C. glabrata CBS 138 (type strain), C. guilliermondii CBS 566, Candida kefyr CCUG 34328, and Saccharomyces cerevisiae CCUG 32994. Twenty-two of the clinical strains were obtained from blood isolates, nine were obtained from Uppsala University Hospital between 2001 and 2004, and 13 were obtained from the Swedish Reference Group for Antimycotics. The remaining samples were isolated from other sample materials at Uppsala University Hospital during 2002 to 2004. The clinical isolates included four C. albicans isolates, seven C. glabrata isolates, four C. krusei isolates, five C. parapsilosis isolates, eight C. tropicalis isolates, two C. dubliniensis isolates, one C. guilliermondii isolate, two C. lusitaniae isolates, one C. kefyr isolate, and one Cryptococcus neoformans isolate. All isolates were stored at −70°C and were identified using traditional morphology and the biochemical identifying methods ID32 C and VITEK 2 ID-YST (bioMérieux, France).

TABLE 1.

Strains used and GenBank accession numbers for the RPR1 gene

Strain GenBank accession no.
C. albicans ATCC 90028/CCUG 32728a DQ660433
C. albicans ATCC 64548/CCUG 46390
C. albicans ATCC 64550
C. dubliniensis CBS 7987b DQ660438
C. glabrata ATCC 90030/CCUG 32725 DQ660434
C. guilliermondii CCUG 35875 DQ660437
C. krusei ATCC 6258/CCUG 35869T DQ660435
C. parapsilosis ATCC 22019/CCUG 32995T DQ660436
C. tropicalis ATCC 750/CCUG 34274T DQ660439
a

ATCC, American Type Culture Collection; CCUG, Culture Collection of the University of Gothenburg.

b

CBS, Centraal Bureau voor Schimmelcultures, Baarn, The Netherlands.

Clinical blood samples.

Clinical blood samples in EDTA vacutainer tubes were collected at Uppsala University Hospital from patients with positive blood culture bottles (four patients) or from immunosuppressed or transplant patients with suspected candidemia (five patients). The multiplex PCR was compared with the result from incubated blood culture bottles collected the same day as the EDTA tube, when available. An amount of 3 to 5 ml of collected blood was centrifuged at 3,600 rpm (1,800 × g) for 10 min. Approximately 1 ml of the plasma was removed, and Candida DNA was separately extracted from it.

Blood cultures.

The BacT/Alert 3D automated blood culture system (bioMérieux) was used for blood cultures. Aerobic FA bottles were inoculated with 10 ml of blood bedside and incubated in the BacT/Alert 3D system for 7 days. Positive bottles were subcultured using Sabouraud agar and CHROMagar Candida (ILS Laboratories Scandinavia).

DNA extraction.

Candida DNA was extracted essentially as described previously by Löffler et al. (12) using the QIAamp tissue protocol (QIAGEN, Hilden, Germany).

Fungal cell culture.

A suspension of Candida cells in phosphate-buffered saline was pelleted at 16,000 × g for 10 min. Fungal spheroplasts were produced with 150 U of lyticase (L-5263; Sigma, St Louis, MO)/sample in 500 μl of a solution containing 50 mM Tris (pH 7.5), 10 mM EDTA, and 28 mM β-mercaptoethanol at 37°C for 30 min. The spheroplasts were collected by centrifugation at 16,000 × g for 10 min. The pellet was resuspended in 180 μl ATL buffer and 20 μl proteinase K provided in the QIAamp DNA Mini kit and incubated at 55°C for 15 min. DNA was extracted according to the QIAamp DNA tissue protocol without RNA digestion and eluted twice with 50 μl of water.

Blood samples.

Three to five milliliters of EDTA-collected blood samples was centrifuged, and after approximately 1 ml of plasma had been separated, the remaining sample was subjected to sequential lysis of blood cells. Since this procedure almost completely removes the plasma, the initial separation of plasma does not interfere with the following extraction of the whole-blood sample. A mixture of the blood sample and 15 ml of red cell lysis buffer (10 mM Tris [pH 7.6], 5 mM MgCl2, 10 mM NaCl) was incubated on ice for 15 min and centrifuged at 2,000 × g. After the supernatant was discarded, the procedure was repeated. Leukocytes were lysed by incubation with 1 ml of red cell lysis buffer with the addition of 200 μg proteinase K (QIAGEN) at 65°C for 45 min. The remaining cells were pelleted at 3,000 × g, fungal spheroplasts were produced, and the DNA was extracted as described above, except that a single eluate of 50 μl was used.

Plasma samples.

DNA in plasma was extracted using the QIAamp Blood and Body Fluid Spin protocol (QIAGEN) from 400 μl of material and eluted in 50 μl.

PCR amplification and sequencing of RPR1.

By sequence comparisons of available fungal RPR1 sequences in GenBank, primers were designed in regions CR-I and CR-V based on the nomenclature described previously by Chen and Pace (5) and as shown in Fig. 1. The strains shown in Table 1, three clinical isolates of C. albicans, and one clinical isolate of C. krusei were sequenced. The PCR products obtained were purified using the QIAquick PCR purification kit (QIAGEN). Thermal cycling with BigDye Terminator v3.1 (Applied Biosystems, Foster City, CA) and the same primers as those in the primary PCR as well as the subsequent purification were performed according to instructions provided by the manufacturer. The samples were then analyzed with an ABI3130 (Applied Biosystems) instrument. For C. glabrata, no PCR product of the expected size was amplified, and therefore, degenerated unspecific primers together with biotinylated Candida-specific primers were used as described previously by Sorensen et al. (21). Five clinical C. glabrata strains were then sequenced using primers in the CR-III and CR-V regions. Primer regions and following flanking regions for the other species were also determined as described previously by Sorensen et al. (21).

FIG. 1.

FIG. 1.

Two-dimensional representation of RNase P RNA in (A) C. albicans and in (B) C. glabrata. The conserved regions (CR) and the paired regions (P) are shown in the figure. Two large inserts in the C. glabrata molecule, represented by lines instead of nucleotides in the figure, explain the large difference in the number of nucleotides between the two molecules. A conserved nucleotide, C, in position 38 is indicated with an arrow in the C. albicans molecule.

Primer and probe design for diagnostic PCR assay.

Broad-range primers were designed in the conserved regions CR-I and CR-V and were named cand-CR1 and cand-CR5 (Table 2 and Fig. 2). These primers amplified a sequence of 224 to 277 bases in the genomes of C. albicans, C. dubliniensis, C. famata, C. guilliermondii, C. parapsilosis, and C. tropicalis. In C. glabrata, a 1,042-base fragment was amplified. Another primer was designed for C. glabrata in region CR-III, gla-CR3, which, together with primer cand-CR5, amplified a 364-nucleotide fragment. The forward primer cand-CR1 and a modified primer in the CR-V region, named krus-CR5, amplified 337 bases in C. krusei.

TABLE 2.

Sequences and modifications of the primers and probes used in the multiplex real-time PCR

Primer or probe Sequence 5′-3′ Modifications (5′, 3′) Target
Primers
    cand-CR1 (forward) CGGGTGGGAAATTCGGT Broad range
    cand-CR5 (reverse) CAATGATCGGTATCGGGT Broad range
    gla-CR3 (forward) RGCAACGGCTGGGAAT C. glabrata
    krus-CR5 (reverse) TAGTGATCGGTATCGAGTT C. krusei
Probes
    alb-FAM (reverse) CAGCTTGTAGTAAAGAATTACTCAC 6-FAM, BHQ1 C. albicans
    gla-JOE (reverse) TAAAGCCTCACCACGATTTTGACAC JOE, BHQ1 C. glabrata
    cand-ROX (reverse) TTCGCATATTgCAcTAAaYaGa ROX, BHQ2 Broad range
    krus-Cy5 (reverse) CCAAAGTTGTACAAGCAAGTACCA Cy5, BHQ2 C. krusei
a

Lowercase letters are locked nucleic acid bases.

FIG. 2.

FIG. 2.

Primers and probes for the seven Candida species. The forward (Fwd) primer is broad range, targeting the CR-I region for all species but C. glabrata, whose specific primer is in the CR-III region. The two reverse (Rev) primers are in CR-V, one with a minor modification targeting C. krusei and another for the remaining species. The TaqMan probes are in a reverse orientation close to the reverse primer. The species-specific probes are located between CR-IV and CR-V, and the broad-range one is located in CR-IV. All four probes are labeled with different fluorophores, enabling species-specific detection of three species and broad-range detection of the remaining four species.

Three species-specific TaqMan probes labeled with different fluorophores were designed in the regions between the primers for C. albicans, C. glabrata, and C. krusei, respectively. A broad-range probe detecting C. albicans, C. dubliniensis, C. famata, C. guilliermondii, C. parapsilosis, and C. tropicalis was designed in conserved region CR-IV, labeled with a fourth fluorophore. This probe included one degenerated nucleotide and four positions replaced by a locked nucleic acid (2).

Real-time PCR.

Real-time PCR using TaqMan probes was carried out in a 50-μl reaction mixture volume in a 0.1-ml microreaction tube using the Rotor-Gene 3000 instrument (Corbett Research, Sydney, Australia). The multiplex reaction mixture consisted of 1× PCR buffer, 3.5 mM MgCl2, each deoxynucleoside triphosphate at a concentration of 0.2 mM, 0.1 μM of the four primers and four probes listed in Table 2, 10 μl of template DNA, and 3 U of Taq DNA polymerase. Single PCRs contained the primer pair cand-CR1/cand-CR5 with probe alb-FAM or cand-ROX, gla-CR3/cand-CR5 with probe gla-JOE, and cand-CR1/krus-CR5 with probe krus-Cy5, with an optimized concentration of primer and probe of 0.1 μM. Thermal cycling conditions consisted of heating at 94°C for 10 min, which preceded a two-stage temperature profile of 15 s at 95°C and 60 s at 58°C for 55 cycles. Recording of the fluorescence at four different wavelengths at 58°C in the Rotor-Gene instrument took approximately 20 s. Setting the instrument to 40 s at 58°C resulted in a stage that actually lasted 60 s.

Sensitivity of the method.

Suspensions of C. albicans, C. glabrata, C. guilliermondii, and C. krusei were cultured overnight in brain heart infusion broth at 34°C. Cells were quantified in a Bürker chamber and by viable counts. The average numbers of cells from the two methods were calculated prior to storage of all cell suspensions at −20°C. For sensitivity testing of the multiplex PCR, 10,000 cells of the four species diluted in 1 ml phosphate-buffered saline were centrifuged, the buffer was removed, and the DNA was extracted as described above. Quadruplicates of four dilutions (50, 10, 2, and 0.4 theoretical copies of genomic DNA per reaction) of the extraction were then run in multiplex and single PCRs. This procedure was repeated four times. To test the sensitivity of fungal DNA extraction from blood, cells from C. albicans were added to blood from healthy human donors. Four milliliters of blood with 5 and 20 cells/ml was extracted and run repeatedly in the multiplex PCR.

RESULTS

RPR1 sequencing.

The RPR1 gene between regions CR-I and CR-V in Candida species was found to vary greatly in size and nucleotide composition. Compared with C. albicans, the sequence similarity ranged from 94% for C. dubliniensis to as low as 55% for C. krusei. However, five conserved regions could be identified, above all, CR-I, CR-IV, and CR-V (Fig. 1).

For all species except C. glabrata, an amplicon of 224 to 337 bp was produced by PCR with primers in the conserved regions CR-I and CR-V. To analyze possible sequence variation in the primer regions, additional sequence reactions using degenerated unspecific primers were performed in both directions. C. krusei was found to have a substitution compared to the other species at the beginning of the CR-V region in both the type strain and the clinical isolate. The other species were conserved in the CR-I and CR-V regions.

PCR with primers in regions CR-I and CR-V and C. glabrata DNA as a template did not produce any amplicon of the expected size. The product was instead over 1,000 bp and was at first thought to be unspecific. Despite the use of variable and degenerated primers in numerous sequencing reactions of PCR products from C. glabrata of 100 to 500 bp, no sequence included the conserved regions of RPR1. However, part of the gene sequence could be found by using specific biotinylated primers together with unspecific primers. Data from the recently published C. glabrata genome (6) led to the conclusion that the large amplicon was RPR1, and our partial sequences confirmed the previously published sequence.

Using sequence data from this study and additional information in the literature (8, 11, 23), secondary structures of C. albicans and C. glabrata RNase P RNAs were established (Fig. 1). Despite the large sequence and size difference, a conserved core that included the five conserved regions could be found. The sequence length difference was explained primarily by two large inserts in the C. glabrata molecule, which together comprise about 700 nucleotides (11). Homologs of all C. albicans loops can be found in the C. glabrata molecule. In contrast, besides the two large inserts, two additional loops, P7.1 and P7.2, were found in C. glabrata but not in C. albicans. These two loops are also present in many other yeast RNase P RNAs, e.g., C. krusei.

The secondary structure of the large insertions in C. glabrata RNase P RNA is not known. Using Mfold, version 3.2 (15, 28), a large loop of 474 nucleotides with few bulges was produced from the largest insertion (Fig. 1). However, the smaller insert did not produce any unambiguous secondary structure.

Specificity of the Candida probes.

The broad-range cand-ROX probe hybridized with DNA from culture collection strains and clinical isolates of C. albicans (seven isolates), C. dubliniensis (three isolates), C. famata (one isolate), C. guilliermondii (three isolates), C. parapsilosis (six isolates), and C. tropicalis (nine isolates) but, as expected, not with C. glabrata (nine isolates), C. krusei (five isolates), C. kefyr (two isolates), S. cerevisiae (one isolate), or Cryptococcus neoformans (one isolate). Two members of the Candida guilliermondii complex, C. fermentati and C. carpophila, recently altered to species status, also generated a signal with the broad-range probe. The species-specific probes hybridized only with the strains of their corresponding species. None of the probes produced a signal with human DNA. The RPR1 sequence of C. famata, available in the whole-genome sequence of Debaromyces hansenii in GenBank, was found to have a mismatch in the cand-ROX probe region. The signal from C. famata was, however, as strong as and with a similar slope compared to the other species. An amplicon was produced with S. cerevisiae visualized by gel electrophoreses (data not shown). For two C. lusitaniae isolates, curves with adequate cycle threshold (CT) values (∼35) but with low slopes were produced with the cand-ROX probe, indicating template-probe mismatches. When the GenBank C. lusitaniae RPR1 gene was compared with the cand-ROX probe, four mismatches were found.

Sensitivity and reproducibility.

For sensitivity testing of the diagnostic PCR, four separate cell preparations were made from four species, and quadruplicates of three dilutions were analyzed. Of 16 reactions for each species, all were positive with 50 DNA copies, 13 to 16 were positive with 10 copies, and 3 to 8 were positive with 2 copies (Table 3). The CT values for the three probes cand-ROX, alb-FAM, and krus-Cy5 varied between 32 and 37 for 50 copies and between 34 and 43 for 10 and 2 copies. The signals from probe gla-JOE had higher CT values, 38 to 42 for 50 copies and 40 to 46 for 10 and 2 copies. All curves had similar slopes. Signals were conclusively either positive or negative, despite the occasionally high CT values.

TABLE 3.

Analytical sensitivity and reproducibility of the diagnostic PCR assay

Species No. (%) of positive PCRsa
50 copies 10 copies 2 copies
C. albicans 16 (100) 13 (81) 5 (31)
C. glabrata 16 (100) 15 (94) 3 (19)
C. guilliermondii 16 (100) 14 (88) 4 (25)
C. krusei 16 (100) 16 (100) 8 (50)
a

Out of 16 samples.

The multiplex reaction including four primers and four TaqMan probes was compared with single runs with two primers and one probe for the four species C. albicans, C. glabrata, C. krusei, and C. guilliermondii. With a probability of 95%, there was no difference between the CT values in multiplex and single reactions (data not shown).

The sensitivity of the PCR was also tested with C. albicans cells inoculated into 4 ml of human blood. In 10 different extractions, 20 cells per ml of blood were inoculated, and 94% of the PCRs were positive with both the alb-FAM and the cand-ROX probes. For five cells per ml blood, 50% of the reactions were positive. The CT values were on average about three cycles higher than those for samples extracted without blood with the same number of cells.

Clinical samples.

Twenty fresh clinical whole-blood samples from nine patients were analyzed with the multiplex PCR. The samples were of fresh whole blood from which about 1 ml of plasma had been removed. Two PCRs with 10 μl of prepared DNA in each PCR were run. If the two reactions produced discrepant results, the analysis was repeated with two additional reactions, and if at least one reaction was positive again, the sample was considered to be positive. A total of six samples from four different patients were positive (Table 4) with the alb-FAM and cand-ROX probes, indicating the presence of C. albicans. These four patients were also positive for C. albicans by blood culture. Out of 14 sampling occasions with a PCR-negative result, blood cultures from the same day were negative in 7 cases, and no blood culture was taken in 6 cases. On the remaining sampling occasion, three culture bottles were taken, one of which was positive (Table 4). For all but two samples, Candida DNA was also extracted from 400 μl of plasma. Two of the PCR-positive whole-blood samples were also C. albicans positive from plasma. All other plasma samples were negative.

TABLE 4.

Comparison of PCR analysis and culture of blood samples from four patients with candidemia

Case Procedure Result on daya:
1 2 3 4 5 6 7 8 9 10 11 21
1 PCR +
Culture +, +, −b +, + + +, −, −
Antifungal therapy Casd
2 PCR + +
Culture + + +
Antifungal therapy Flue
3 PCR +c
Culture + +, + +, + +, −
Antifungal therapy Case
4 PCR +c +
Culture + + +
Antifungal therapy Flue
a

Cas, caspofungin; Flu, fluconazole.

b

In some cases, more than one culture bottle was taken on the same day. Each bottle is designated positive (+) or negative (−).

c

Positive in both whole-blood and plasma extractions.

d

Antifungal therapy began on day 2 and continued until day 21.

e

Antifungal therapy began on day 3 and continued until day 21.

A bronchoalveolar lavage sample from a 10th patient was divided into three fractions, spun down, and extracted in the same way as described above for Candida isolates. In PCR, the sample was C. albicans positive, but in culture, it was negative. However, fungal hyphae were detected by direct microscopy of a blancophor-stained specimen.

DISCUSSION

The RNase P RNA genes of several yeast species have been sequenced, but knowledge about the structure and function of the RNA molecule and its interaction with the protein subunits involved in the holoenzyme remains limited. In S. cerevisiae, the P3 loop has been shown to bind to the Pop1p subunit, and certain nucleotide positions in the loop have been suggested to be essential for this protein-binding domain (27). Our finding of a conserved C at position 38 (Fig. 1) in all examined Candida species except C. glabrata (data were not available for C. krusei) supports the essential role of this nucleotide position.

The extremely large RNase P RNA in C. glabrata is explained by two large inserts. The larger of these inserts can be folded into one large loop with few bulges. The smaller insert does not seem to form a single loop. Furthermore, loop eP15, shown in Fig. 1, has very loose base pairing. Possibly, loop eP15 is incorrect in Fig. 1 and is instead part of a multiloop secondary structure together with the smaller insert. Further studies are necessary to establish an unambiguous secondary structure for RNase P RNA in C. glabrata.

Of the tested species, our multiplex real-time PCR is specific for Candida species, as is demonstrated by the total absence of signal for the related species S. cerevisiae, Cryptococcus neoformans, and C. kefyr as well as with human DNA. The multiplex nature of the PCR comprises a built-in specificity control; by targeting C. glabrata and C. krusei DNA, no signal is expected from the broad-range probe even though amplification is confirmed by their respective species-specific probes. The high specificity of the PCR minimizes the risk of contamination from impure reagents or environmental contaminants such as air-circulating molds. This contrasts with broad-range probes targeting rRNA genes that have been shown to cross-react with other organisms (7, 14).

The sensitivity of the multiplex PCR is 2 to 10 genome copies, which, in addition to cell counts, is confirmed by the stochastic result. For sensitivity testing, the cells were quantified by both viable count and Bürker chamber, resulting in no more than a twofold difference. We believe that cell quantification, compared with DNA quantification, is a more reliable and realistic way to determine the sensitivity of a PCR assay. In several cases, previous reports of the sensitivity of PCR methods lacked information about the methods used for cell or DNA quantification (13, 18).

With the limited number of clinical specimens in this study, we demonstrate a level of sensitivity very similar to that of blood culture. Only one sample was negative by PCR on the same day as a positive culture bottle was taken. However, two additional culture bottles from the same sampling occasion were negative. For logistical reasons, sampling for culture and PCR could not always be performed on the same day, and in seven cases, no blood culture specimen was taken on the same day as the PCR sample. In all other cases, the two methods coincided. To monitor the difference in sensitivities between PCR and blood culture, a larger study group with a more thorough study of each patient will be needed. In the case of 17 of the clinical blood samples, DNA from 400 μl of plasma was extracted in addition to whole-blood extraction. Out of five PCR-positive samples with DNA from whole blood, only two were positive with DNA from plasma. All negative whole-blood samples were also negative for plasma. These findings indicate that 3 to 4 ml of whole blood is more sensitive than 400 μl of plasma. In other studies, detection of Candida from serum has been reported to be more sensitive than that from whole blood in some cases (1) but less so in others (7, 24). Further, and well-designed, studies are needed to establish the optimal specimen type. To obtain nucleic acid amplification tests with a sensitivity that is markedly higher than that for blood culture, there is a need for improvements in DNA/RNA extraction. This step is currently hampered by a limited blood volume and the impact of human background DNA.

Real-time PCR has advantages over conventional PCR in terms of sensitivity, handling, and reduced contamination problems. Furthermore, it can be used to quantify the amount of template DNA and has been used to measure fungal loads (13, 14). However, this assay does not aim to quantify Candida cells mainly for two reasons. First, loads below 100 gene copies in a PCR cannot be quantified for stochastic reasons, and the fungal load in blood is expected to be low. Second, there is often an intermittent release of fungal cells in blood, and the detected amount thus does not necessarily express the severity of the infection, which means that quantification would not be very informative.

Despite the many real-time PCR methods for Candida detection in blood, no broad-range Candida-specific TaqMan-based assay has been described previously. An assay developed, for example, for the Light-Cycler system may be difficult to transfer to a system based on another technology, and even for two instruments using the same technology, a method may be impossible to transfer (26). This complicates the standardization of molecular Candida detection, as different laboratories use different platforms. The need for interlaboratory reproduction and consensus of nucleic acid amplification tests has recently been highlighted (25).

The CT values from analyses of templates of low copy number were quite high, especially for C. glabrata, with values up to cycle 46. However, these signals had the same slope as signals from strongly positive samples, and there were no false-positive signals up to cycle 60. The template DNA from when Candida was extracted from blood gave signals with slightly increased CT values. This partial inhibition was caused by human DNA, as was demonstrated by adding human DNA to culture-extracted Candida DNA (data not shown). Although the CT value increased when extraction from blood was performed, it did not affect the strength of the signal.

It has been argued that PCR assays targeting multicopy genes are more sensitive (7), but data from a comparison with a real-time PCR method targeting rRNA tandem repeats indicate a similar level of sensitivity (data not shown). This can be explained by the fact that there are several factors, e.g., the amplification efficiency, that determine the performance of an assay.

In summary, we have determined the sequences of the RPR1 genes for several medically important Candida species and have shown that conserved regions can be used to develop a multiplex PCR assay using a single tube. The described method is specific for three species and detects five other medically important Candida species. It has a sensitivity similar to that of blood culture but permits a more rapid analysis.

Footnotes

Published ahead of print on 10 January 2007.

REFERENCES

  • 1.Bougnoux, M., C. Dupont, J. Mateo, P. Saulnier, V. Faivre, D. Payen, and M. Nicolas-Chanoine. 1999. Serum is more suitable than whole blood for diagnosis of systemic candidiasis by nested PCR. J. Clin. Microbiol. 37:925-930. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Braasch, D. A., and D. R. Corey. 2001. Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA. Chem. Biol. 8:1-7. [DOI] [PubMed] [Google Scholar]
  • 3.Bretagne, S., and J. M. Costa. 2005. Towards a molecular diagnosis of invasive aspergillosis and disseminated candidosis. FEMS Immunol. Med. Microbiol. 45:361-368. [DOI] [PubMed] [Google Scholar]
  • 4.Bu, R., R. K. Sathiapalan, M. M. Ibrahim, I. Al-Mohsen, E. Almodavar, M. I. Gutierrez, and K. Bhatia. 2005. Monochrome LightCycler PCR assay for detection and quantification of five common species of Candida and Aspergillus. J. Med. Microbiol. 54:243-248. [DOI] [PubMed] [Google Scholar]
  • 5.Chen, J. L., and N. R. Pace. 1997. Identification of the universally conserved core of ribonuclease P RNA. RNA 3:557-560. [PMC free article] [PubMed] [Google Scholar]
  • 6.Dujon, B., D. Sherman, G. Fischer, P. Durrens, S. Casaregola, I. Lafontaine, J. De Montigny, C. Marck, C. Neuveglise, E. Talla, N. Goffard, L. Frangeul, M. Aigle, V. Anthouard, A. Babour, V. Barbe, S. Barnay, S. Blanchin, J. M. Beckerich, E. Beyne, C. Bleykasten, A. Boisrame, J. Boyer, L. Cattolico, F. Confanioleri, A. De Daruvar, L. Despons, E. Fabre, C. Fairhead, H. Ferry-Dumazet, A. Groppi, F. Hantraye, C. Hennequin, N. Jauniaux, P. Joyet, R. Kachouri, A. Kerrest, R. Koszul, M. Lemaire, I. Lesur, L. Ma, H. Muller, J. M. Nicaud, M. Nikolski, S. Oztas, O. Ozier-Kalogeropoulos, S. Pellenz, S. Potier, G. F. Richard, M. L. Straub, A. Suleau, D. Swennen, F. Tekaia, M. Wesolowski-Louvel, E. Westhof, B. Wirth, M. Zeniou-Meyer, I. Zivanovic, M. Bolotin-Fukuhara, A. Thierry, C. Bouchier, B. Caudron, C. Scarpelli, C. Gaillardin, J. Weissenbach, P. Wincker, and J. L. Souciet. 2004. Genome evolution in yeasts. Nature 430:35-44. [DOI] [PubMed] [Google Scholar]
  • 7.Einsele, H., H. Hebart, G. Roller, J. Loffler, I. Rothenhofer, C. A. Muller, R. A. Bowden, J. van Burik, D. Engelhard, L. Kanz, and U. Schumacher. 1997. Detection and identification of fungal pathogens in blood by using molecular probes. J. Clin. Microbiol. 35:1353-1360. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Frank, D. N., C. Adamidi, M. A. Ehringer, C. Pitulle, and N. R. Pace. 2000. Phylogenetic-comparative analysis of the eukaryal ribonuclease P RNA. RNA 6:1895-1904. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Herrmann, B., B. Pettersson, K. D. Everett, N. E. Mikkelsen, and L. A. Kirsebom. 2000. Characterization of the rnpB gene and RNase P RNA in the order Chlamydiales. Int. J. Syst. Evol. Microbiol. 50(Pt. 1):149-158. [DOI] [PubMed] [Google Scholar]
  • 10.Innings, A., M. Krabbe, M. Ullberg, and B. Herrmann. 2005. Identification of 43 Streptococcus species by pyrosequencing analysis of the rnpB gene. J. Clin. Microbiol. 43:5983-5991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Kachouri, R., V. Stribinskis, Y. Zhu, K. S. Ramos, E. Westhof, and Y. Li. 2005. A surprisingly large RNase P RNA in Candida glabrata. RNA 11:1064-1072. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Löffler, J., H. Hebart, U. Schumacher, H. Reitze, and H. Einsele. 1997. Comparison of different methods for extraction of DNA of fungal pathogens from cultures and blood. J. Clin. Microbiol. 35:3311-3312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Maaroufi, Y., N. Ahariz, M. Husson, and F. Crokaert. 2004. Comparison of different methods of isolation of DNA of commonly encountered Candida species and its quantitation by using a real-time PCR-based assay. J. Clin. Microbiol. 42:3159-3163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Maaroufi, Y., C. Heymans, J. M. De Bruyne, V. Duchateau, H. Rodriguez-Villalobos, M. Aoun, and F. Crokaert. 2003. Rapid detection of Candida albicans in clinical blood samples by using a TaqMan-based PCR assay. J. Clin. Microbiol. 41:3293-3298. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Mathews, D. H., J. Sabina, M. Zuker, and D. H. Turner. 1999. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J. Mol. Biol. 288:911-940. [DOI] [PubMed] [Google Scholar]
  • 16.Nguyen, M. H., J. E. Peacock, Jr., A. J. Morris, D. C. Tanner, M. L. Nguyen, D. R. Snydman, M. M. Wagener, M. G. Rinaldi, and V. L. Yu. 1996. The changing face of candidemia: emergence of non-Candida albicans species and antifungal resistance. Am. J. Med. 100:617-623. [DOI] [PubMed] [Google Scholar]
  • 17.Pfaller, M. A., D. J. Diekema, M. G. Rinaldi, R. Barnes, B. Hu, A. V. Veselov, N. Tiraboschi, E. Nagy, D. L. Gibbs, and the Global Antifungal Surveillance Group. 2005. Results from the ARTEMIS DISK Global Antifungal Surveillance Study: a 6.5-year analysis of susceptibilities of Candida and other yeast species to fluconazole and voriconazole by standardized disk diffusion testing. J. Clin. Microbiol. 43:5848-5859. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Pryce, T. M., I. D. Kay, S. Palladino, and C. H. Heath. 2003. Real-time automated polymerase chain reaction (PCR) to detect Candida albicans and Aspergillus fumigatus DNA in whole blood from high-risk patients. Diagn. Microbiol. Infect. Dis. 47:487-496. [DOI] [PubMed] [Google Scholar]
  • 19.Rubin, C. J., M. Thollesson, L. A. Kirsebom, and B. Herrmann. 2005. Phylogenetic relationships and species differentiation of 39 Legionella species by sequence determination of the RNase P RNA gene rnpB. Int. J. Syst. Evol. Microbiol. 55:2039-2049. [DOI] [PubMed] [Google Scholar]
  • 20.Shin, J. H., F. S. Nolte, B. P. Holloway, and C. J. Morrison. 1999. Rapid identification of up to three Candida species in a single reaction tube by a 5′ exonuclease assay using fluorescent DNA probes. J. Clin. Microbiol. 37:165-170. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Sorensen, A. B., M. Duch, P. Jorgensen, and F. S. Pedersen. 1993. Amplification and sequence analysis of DNA flanking integrated proviruses by a simple two-step polymerase chain reaction method. J. Virol. 67:7118-7124. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Tapp, J., M. Thollesson, and B. Herrmann. 2003. Phylogenetic relationships and genotyping of the genus Streptococcus by sequence determination of the RNase P RNA gene, rnpB. Int. J. Syst. Evol. Microbiol. 53:1861-1871. [DOI] [PubMed] [Google Scholar]
  • 23.Tranguch, A. J., and D. R. Engelke. 1993. Comparative structural analysis of nuclear RNase P RNAs from yeast. J. Biol. Chem. 268:14045-14055. [PubMed] [Google Scholar]
  • 24.White, P. L., A. E. Archer, and R. A. Barnes. 2005. Comparison of non-culture-based methods for detection of systemic fungal infections, with an emphasis on invasive Candida infections. J. Clin. Microbiol. 43:2181-2187. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.White, P. L., R. Barton, M. Guiver, C. J. Linton, S. Wilson, M. Smith, B. L. Gomez, M. J. Carr, P. T. Kimmitt, S. Seaton, K. Rajakumar, T. Holyoake, C. C. Kibbler, E. Johnson, R. P. Hobson, B. Jones, and R. A. Barnes. 2006. A consensus on fungal polymerase chain reaction diagnosis? A United Kingdom-Ireland evaluation of polymerase chain reaction methods for detection of systemic fungal infections. J. Mol. Diagn. 8:376-384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.White, P. L., A. Shetty, and R. A. Barnes. 2003. Detection of seven Candida species using the Light-Cycler system. J. Med. Microbiol. 52:229-238. [DOI] [PubMed] [Google Scholar]
  • 27.Ziehler, W. A., J. Morris, F. H. Scott, C. Millikin, and D. R. Engelke. 2001. An essential protein-binding domain of nuclear RNase P RNA. RNA 7:565-575. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31:3406-3415. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES