Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2007 Dec 1.
Published in final edited form as: Acta Trop. 2006 Nov 28;100(3):205–212. doi: 10.1016/j.actatropica.2006.10.011

Genetic Structures of Geographically Distinct Plasmodium vivax Populations Assessed by PCR/RFLP Analysis of the Merozoite Surface Protein 3β Gene

Zhaoqing Yang 1,7, Jun Miao 7, Yaming Huang 2, Xinyi Li 7, Chaturong Putaporntip 3, Somchai Jongwutiwes 3, Qi Gao 4, Rachanee Udomsangpetch 5, Jetsumon Sattabongkot 6, Liwang Cui 7,*
PMCID: PMC1839953  NIHMSID: NIHMS18405  PMID: 17129568

Abstract

The recent resurgence of Plasmodium vivax malaria requires close epidemiological surveillance and monitoring of the circulating parasite populations. In this study, we developed a combination of polymerase chain reaction and restriction fragment length polymorphism (PCR/RFLP) method to investigate the genetic diversity of the P. vivax merozoite surface protein 3β (PvMSP3β) gene among four Asian parasite populations representing both tropical and temperate strains with dramatic divergent relapse patterns (N = 143). Using P. vivax field isolates from symptomatic patients, we have validated the feasibility of this protocol in distinguishing parasite genotypes. We have shown that PCR alone could detect three major size polymorphisms of the PvMSP3β gene, and restriction analysis detected a total of 12 alleles within these Asian samples. Samples from different geographical areas differed dramatically in their PvMSP3β allele composition and frequency, indicating that complex, yet different parasite genotypes were circulating in different endemic areas. This protocol allowed easy detections of multiple infections, which reached 20.5% in the samples from Thailand. It is interesting to note that samples from one temperate site in China collected during a recent outbreak of the disease also showed a high level of genetic diversity with multiple infections accounting for 5.6% of the samples. When combined with the PvMSP3α locus, this method provides better capability in distinguishing P. vivax genotypes and detecting mixed genotype infections.

Keywords: Plasmodium vivax, genotyping, merozoite surface protein 3β, mixed strain infection

1. Introduction

Of the four human malaria parasite species, Plasmodium vivax is the most widespread malaria globally, causing 70–80 million cases annually (Mendis et al., 2001). Outside Africa, it is a major public health problem and an important contributor to the global burden of morbidity. Recently, vivax malaria has re-emerged in many regions such as Korea, certain temperate provinces of China, and some former Soviet republics, where it had been largely eradicated during the global malaria control campaigns (Sleigh et al. 1998; Chai et al., 1999; Sabatinelli et al., 2000; Leclerc et al., 2004). In many regions of P. vivax and P. falciparum coexistence, P. vivax has become more prevalent (Sattabongkot et al., 2004; Zhou et al., 2005). As another serious concern, P. vivax has evolved resistance to antimalarial drugs. Although chloroquine (CQ) still constitutes the first-line therapy against vivax malaria, CQ resistance has been reported in both Asia and South America (Rieckman, 1989; Baird et al., 1991; Malar-Than et al., 1995; Phillips et al., 1996). In addition, resistance to the antifolate drug pyrimethamine is also widespread (de Pecoulas et al., 1998; Imwong et al., 2003). Therefore, global resurgence of vivax malaria and escalating drug-resistance demand more extensive research and control efforts.

Understanding population structures of the parasite is important for monitoring the spread of drug resistance and predicting the performance of vaccines under development in a particular parasite population (Cui et al., 2003a). Comparing with P. falciparum, the population structures of P. vivax are much less understood. With a global distribution ranging from tropical to temperate zones, different P. vivax isolates exhibit distinctive biological characteristics (e.g., relapse patterns, transmissibility to mosquitoes), which are often used to distinguish geographical strains and even subspecies (Li et al. 2001). Within a local population, parasite isolates also display extensive genetic diversity as demonstrated by genotyping using various polymorphic molecular markers. These include the circumsporozoite protein (CSP) (Rosenberg et al., 1989), the apical membrane antigen 1 (AMA1) (Figtree et al., 2000), the Duffy binding protein (DBP) (Xainli et al., 2000), the merozoite surface protein 1 (MSP1) (Putaporntip et al., 2002), and the merozoite surface protein 3α (MSP3α) genes (Bruce et al., 2000; Mueller et al., 2002; Cui et al., 2003b; Cole-Tobian et al., 2005). However, PvAMA1 and DBP have limited size polymorphism and allele differentiation depends primarily on sequencing (Figtree et al., 2000). PvCSP genotyping using polymerase chain reaction (PCR) and molecular hybridization only differentiates the parasites into the VK210, VK247 and the vivax-like types, which possess different repeat sequences in the central domain. In addition, a moderate level of size polymorphism in this region is observed in field isolates due to variation in the number of repeats. Though PvMSP1 has proven to be more discriminatory, most work relied on sequencing of the amplification products for allele identification (Putaportip et al., 2002; Zakeri et al., 2006b). Apparently, these methods have limitations for rapid genotyping large field populations. In this regard, a PCR/restriction fragment length polymorphism (RFLP) method for PvMSP3α gene has been validated for genotyping global parasite isolates (Bruce et al., 1999). To date, this marker, allowing detection of as many as 12–14 alleles in a parasite population, has been used widely in genotyping parasite isolates (Bruce et al., 2001; Muller et al., 2002; Cui et al., 2003b). Recently, Imwong et al. (2005) developed a genotyping method to determine size polymorphism in the central domain of PvCSP by PCR, and polymorphism in the pre- and post-repeat domains by PCR/RFLP. This method could differentiate the two repeat types and identify 23 allele types from 100 Thai isolates. A similar PCR/RFLP method has also been designed for PvMSP1 (Imwong et al., 2005). Subsequent identification of polymorphic microsatellite markers has added another set of genotyping markers that are useful for studying P. vivax populations (Imwong et al., 2006).

The P. falciparum MSP3 and P. vivax MSP3α, β and γ constitute a protein family with limited sequence identity but similar protein structure, with the central Ala-rich region forming an extensive coiled-coil structure (Galinski et al., 1999; 2001). Although PfMSP3 has limited sequence polymorphism (McColl et al., 1994; McColl and Anders, 1997; Huber et al., 1997), PvMSP3α and β genes are highly polymorphic (Rayner et al., 2002, 2004; Mascorro et al., 2005, Ord et al., 2005). Molecular evolution studies suggest that extensive polymorphism of PvMSP3α is probably generated by intragenic recombinations and maintained by balancing selection (Rayner et al., 2002; Mascorro et al., 2005; Ord et al., 2005). Likewise, PvMSP3β sequences from P. vivax global isolates are also radically divergent with the majority bearing large insertion/deletion mutations in the central Ala-rich region (Rayner et al., 2004). In this report, we have employed the polymorphic nature of PvMSP3β gene and developed a PCR/RFLP method for genotyping P. vivax isolates, which could distinguish 12 alleles within three Asian parasite populations. Combination of this locus with the PvMSP3α gene enables greater capacity in identifying parasite haplotypes and detecting mixed strain infections.

2. Materials and methods

2.1. Sample collection

Parasites were obtained from symptomatic patients attending hospitals or malaria clinics in four geographical regions of Asia. Forty-four finger-prick blood samples were collected from Mae Sot, Thailand in 2000–2001 during an early study (Cui et al., 2003b). These samples were used to assess the genetic diversity of the MSP3α gene. Three groups of samples were collected in China, including 54 samples from Bengbu city, Anhui Province in 2004; 31 samples from Hongshuihe Town, Luodian County, Guizhou Province, in 2005; and 14 samples from residents of Guangxi Province in 2004. Among the 14 Guangxi samples, six were local infections, and the rest were from Guangxi residents, who had contracted malaria while traveling in other malarious regions in China. Ethical clearance was obtained from the Ethical Review Committee of the Armed Forces Institute of Medical Sciences, Thailand, and provincial ethical review committees in China.

2.2. DNA purification

Parasite DNA was extracted from dried blood filters (~100 μl of blood) using a QIAamp DNA Mini kit (Qiagen, Germany) following the manufacturer’s instruction and DNA was eluted in 100 μl of water.

2.3. PCR of PvMSP3β genes

Based on published PvMSP3β sequences (Galinski et al., 2001; Rayner et al., 2004) and those obtained from 58 Thai isolates (Cui, unpublished), we designed primers from the conserved sequences to amplify the 5′ region of the gene containing most of the insertions/deletions. Primary PCR of PvMSP3β was performed in 20 μl using 3 μl of DNA using primers F1 (5′ GGTATTCTTCGCAACACTC 3′) and R1 (5′ GCTTCTGATGTTATTTCCAG 3′). Nested reactions were done in 20 μl with primers F2 (5′ CGAGGGGCGAAATTGTAAACC 3′) and R2 (5′ GCTGCTTCTTTTGCAAAGG 3′) using 1 μl of the primary PCR product as the template. PCR was performed with advantage Taq (Clontech, CA) using the following cycling conditions: 94°C for 20 sec, 54°C for 30 sec, 68°C for 2.5 min, 35 cycles. PCR products (2–3 μl) were separated on 0.7% agarose gel, stained with ethidium bromide, visualized under UV illumination, and documented using a Kodak digital system.

2.4. RFLP analysis of PvMSP3β PCR products

Based on in silico analysis of aligned PvMSP3β sequences, we selected Pst I enzyme, which could differentiate the parasites into at least 5 different types. Typically, 3–5 μl of the PCR products were digested with 5 units of Pst I in 10–15 μl for >3 hr. The DNA fragments were resolved on 1.5% agarose gels and the restriction patterns were recorded.

2.5. Statistical analysis

Chi square test was used to compare the frequencies of individual alleles among the sample sets using Minitab Software 13.0 (MINITAB Inc., PA). The test was done for all alleles at the three sites both simultaneously and in pair. Due to their diverse origins, the Guangxi samples were excluded from statistical analysis.

3. Results

3.1. Size polymorphism of PvMSP3β and RFLP analysis

Comparing the 16 published PvMSP3β sequences (Galinski et al., 2001; Rayner et al., 2004) and those obtained from 58 Thai P. vivax isolates, we designed conserved primers for nested PCR amplifications of the 5′ region of this gene, which corresponds to nucleotide positions 81-1515 of the Belem strain (Fig. 1). With these primers, we were able to amplify the PvMSP3β fragments from all 44 Thai and 98/99 Chinese P. vivax samples, suggesting that the protocol is suitable for amplifying PvMSP3β gene at these study sites. The only failed sample may be due to low parasite density, since we did not obtain a PCR product using nested primers for the PvMSP3α gene (Cui et al., 2003b). The PvMSP3β PCR products clearly showed size polymorphism with three allele sizes of 1.7–2.2, 1.4–1.5, and ~0.65 kb, which were categorized here as type A, B, and C, respectively (Fig. 2). Type B is in agreement with the reference Belem strain, while type A corresponds to the sequences with different insertions in the central Ala-rich domain of the gene (Rayner et al., 2004). These are the predominant types, accounting for >98% of Asian P. vivax isolates in this study. The minor C-type has a large deletion (~780 bp) in the central Ala-rich region, which was not found in the earlier sequencing survey of global P. vivax isolates (Rayner et al., 2004). Among the samples analyzed, only two type-C isolates were found in the Thai samples.

Fig. 1.

Fig. 1

Schematic drawing of the P. vivax MSP3β gene of the Belem strain. The outer (F1 and R1) and inner (F2 and R2) primers are indicated with the numbers referring to their positions (in base pairs) within the Belem sequence. Filled, open, and hatched boxes indicate conserved, less conserved and highly variable Ala-rich central domain of the gene, respectively.

Fig. 2.

Fig. 2

PCR amplifications of PvMSP3β gene showing three major size polymorphisms. Numbers indicate the malaria cases. Samples containing mixed-genotype infections are marked with asterisks.

Restriction analysis of the PCR products by Pst I showed that the A and B types could be divided into five A alleles and six B alleles, whereas the minor C-type lacked a Pst I site (Fig. 3A). These alleles probably represented the majority of P. vivax genotypes existing in the vivax-endemic areas of China, since RFLP typing 14 additional samples from five Chinese provinces did not identify novel alleles. Altogether, a combination of PCR with RFLP distinguished 12 alleles from the Asian field isolates, indicating that this protocol can be used for differentiating P. vivax isolates in epidemiological studies.

Fig. 3.

Fig. 3

A. RFLP patterns of the PvMSP3β PCR products digested with Pst I showing the 12 alleles detected in the Thai and Chinese P. vivax samples studied. M – DNA markers in bp. B. An example of PCR/RFLP detection of mixed-genotype infection. Digestion of PCR product from sample 465 revealed the presence of two allele types B1 and B2.

3.2. Geographical variations in allele distribution

Analysis of P. vivax isolates from symptomatic patients from three geographical regions in Asia revealed that the population structure of P. vivax varied greatly. In western Thailand, B type is more abundant (60.4%) than other types, whereas in the Chinese Bengbu and Guangxi samples, both A and B types were similarly prevalent (Table 1). In Hongshuihe town of Guizhou province of China, only the A type was detected in P. vivax parasites isolated in 2005. In addition, RFLP analysis also revealed different allele compositions at each site. Ten (four A, five B, and 1 C), eight (five A and three B), and three (A) alleles could be distinguished from the Thai, Chinese Bengbu, and Hongshuihe P. vivax isolates, respectively. Among the 14 Guangxi samples of various origins, three alleles were detected: 2, 5, and 7 isolates harbored allele A2, A3, and B1, respectively. Two alleles were present in the Chinese samples but absent in the Thai samples, whereas the Thai samples had four unique alleles. Besides variation in allele type composition, the frequencies of individual alleles also differed significantly among the three parasite populations (χ2=116, df=22, P≤0.001). In the Thai samples, A5, B1, B2 and B4 were the most abundant alleles, which accounted for 66% of all isolates. In the Chinese Bengbu P. vivax samples, the frequency of four alleles (A2, A5, B1 and B2) reached 80.8%. In contrast, the Hongshuihe P. vivax population had a predominating A1 allele with a frequency of 66.7%. Interestingly, despite this difference of individual allele types, the Thai and Chinese Bengbu P. vivax populations shared three major alleles (A5, B1 and B2) (Table 1). The frequencies of these three alleles were not significantly different between the Thai and Chinese Bengbu samples (χ2=5.142, df=2, P=0.076). These results indicated that the PCR/RFLP method for PvMSP3β could be used to differentiate spatially-separated parasite populations.

Table 1.

PvMSP3β RFLP allele types and their distribution frequencies in three Asian P. vivax populations

Alleles Allele frequencies (%) in populations*
Mae Sod, Thailand (N=44) Bengbu, Anhui (N=54) Hongshuihe, Guizhou (N=31)
A1 7.5 2.1 66.7
A2 0 14.9 26.7
A3 9.4 4.3 6.7
A4 1.9 6.4 0
A5 17.0 23.4 0
B1 13.2 31.9 0
B2 20.8 10.6 0
B3 0 6.4 0
B4 15.1 0 0
B5 5.7 0 0
B6 5.7 0 0
C 3.8 0 0
*

χ2 analysis detected significant differences among the three samples at individual alleles (χ2=116, df=22, P≤0.001).

3.3. Mixed strain infections

Size polymorphism associated with the PvMSP3β PCR products allowed easy detection of mixed genotype infections. Mixed infections were assigned when a single sample resulted in more than one PCR product of different sizes (Fig. 2) or when the summed size of the restriction fragments of a singe PCR band exceeded the size of the uncut PCR band (Fig. 3B). PCR alone detected mixed infections of A and B types in 15.9% of the Thai samples, and 5.6% of the Chinese Bengbu samples. RFLP analysis detected two additional mixed type B infections (e.g., sample 465 in Fig. 3B) in the Thai population, giving a final mixed infection of 20.5%.

4. Discussion

Polymorphic molecular markers that differ in size and restriction patterns have been employed to evaluate genetic diversity and distinguish parasite isolates in epidemiological studies of malaria parasites. In addition, drug efficacy studies for P. vivax often rely on in vivo trials, which require markers for differentiating recrudescences (treatment failures) from re-infections (successful treatments). To date, PCR/RFLP methods to distinguish P. vivax isolates are available for genotyping the highly polymorphic genes such as PvMSP3α, PvCSP and PvMSP1 genes (Bruce et al., 1999; Imwong et al., 2005). In this report, we designed a similar PCR/RFLP method for genotyping PvMSP3β gene. The PvMSP3β gene was shown to have three major size types in tropical and temperate parasite strains from Asia, comparing with six size polymorphisms found in global samples (Rayner et al., 2004). This protocol, enabling us to distinguish 12 PvMSP3β alleles in 142 Asian samples, has a similar resolving power to that of the PvMSP3α gene (Cui et al., 2003b). For example, PCR/RFLP method could differentiate the Thai samples into 13 and 10 alleles at the PvMSP3α and 3β loci, respectively (Cui et al., 2003b). This study revealed that the three geographically distinct P. vivax sample sets differed in PvMSP3β allele composition and frequency, suggesting that this method is suitable for genotyping P. vivax parasites in these areas.

Genetic diversity of the malaria parasites is associated with the levels of endemicity and transmission intensity (Babiker et al., 1997; Anderson et al., 2000). In hyperendemic areas such as Papua New Guinea, P. vivax is highly diverse and multiplicity of infections (MOI, >1.4) is high (Kolakovich et al., 1996; Bruce et al., 2000). However, in hypoendemic areas such as Thailand, P. vivax also appear to have complex genetic structures (Cui et al., 2003b; Zakeri et al., 2003; Leclerc et al., 2004; Imwong et al., 2005). We have shown high levels of genetic diversity and mixed genotype infections (MOI, 1.2–1.3) of the P. vivax population in western Thailand by PCR/RFLP analysis of PvMSP3α and β loci (Cui et al., 2003b), and by direct sequencing of PvMSP3α from 17 isolates (Mascorro et al., 2005). In the present study, the Chinese P. vivax samples representing strains from a temperate zone, where malaria is seasonal and experiences a long break during the winter, also displayed considerable genetic diversity at the PvMSP3β locus. Although it is not clear how genetic diversity of P. vivax in these temperate sites is maintained, it may be associated with increased transmission intensities during the recent upsurge of vivax malaria in a large geographical area of China that covers five northern provinces (Sheng et al., 2003). In other hypoendemic regions of the world where temperate strains of P. vivax parasite persist, the relatively high levels of diversity were speculated to be partially due to increased travel, resulting in the introductions of diverse parasite strains from neighboring endemic countries (Zakeri et al., 2003; Leclerc et al., 2004).

We have noticed a dramatic difference in PvMSP3β allele composition and frequency between the Bengbu samples (eight alleles) and the Hongshuihe samples (three alleles). Although sample sizes may be responsible for this difference, dissimilar epidemiological settings at these two sites may be a more plausible explanation for the divergent parasite population structures. The Bengbu samples were collected from a much larger area in eastern China, where P. vivax had largely been eradicated, but reappeared and became increasingly prevalent for the past ten years (Sleigh et al., 1998; Xu et al., 2003, 2006). In contrast, Hongshuihe town is located in a remote area of Guizhou province, where malaria has persisted at low endimicity. The mountainous environments might have helped isolating this area from other large malarious regions in China. Our analysis indicated that parasite population in this area was reminiscent of clonal infections with lower genetic diversity, which resembles that of recently resurgent or introduced P. vivax cases in Korea and Northern Iran (Lim et al., 2000; Han et al., 2004; Zakeri et al., 2006b). Therefore, more detailed studies are needed to understand the population structures of P. vivax in large temperate zones.

Other than the influence of transmission intensity on allele diversity, the different genetic structures of three P. vivax populations observed in this study may also be the result of additional factors. With large geographical separation, the Thai and Chinese samples represent tropical and temperate P. vivax strains, which differ radically in terms of relapse patterns. While the tropical strains of the parasite relapse in about a month after the first episode, the temperate strains in China have a long incubation period that often exceeds eight months (Garnham, 1988). Moreover, these endemic areas have different mosquito vector species. In western Thailand, Anopheles dirus, An. minimus, and An. maculatus are the major malaria vectors. In comparison, in Bengbu area of Anhui province, China, An. sinensis and An. anthropophagus are the main vectors and the latter has become more abundant in many districts (Kan et al., 1999). It is noteworthy that An. anthropophagus is highly anthropophilic with a vectorial capacity ~20 times higher than that of An. sinensis (Xu et al., 2006). In Hongshuihe town of Guizhou, An. minimus is the predominant vector species (Xu et al., 2000). Whether these mosquito species vary in transmission efficiency for certain P. vivax genotypes remains to be determined (Rodriguez et al., 2000).

Large epidemiological and in vivo drug efficacy studies require highly polymorphic markers for distinguishing parasite genotypes. These markers are often combined to provide higher resolving power. For instance, MSP1, MSP2 and GLURP are often used in combination to genotype P. falciparum isolates (Meyer et al., 2002). Multiple microsatellites are also used for such purposes (Anderson et al., 2000; Imwong et al., 2006). Our analysis of parasite diversity at the PvMSP3β locus detected multiple genotypes and mixed-genotype infections in several P. vivax endemic regions. The levels of mixed-genotype infections were correlated with the levels of endemicity. Genotyping the Thai samples at PvMSP3β detected 20.5% mixed infections, whereas combination with genotyping PvMSP3α increased the level to 29.5% (Cui et al., 2003b). Similarly, the combination of the PvCSP and PvMSP1 markers allowed the detection of 26% of Thai samples with mixed-genotype infections (Imwong et al., 2005). While this is common for tropical malarious regions, our finding of 5.6% mixed-strain infections in the Bengbu sample set is the first record for a temperate zone, which may serve as an indicator of increased prevalence of the disease in this area. Mixed-strain infections favor genetic recombination in vectors, which in turn contributes to higher genetic diversity of the parasite population. Relapses of P. vivax malaria undoubtedly increase mixed-genotype infections, recombination, and genetic diversity of the parasite in hypoendemic areas. The lack of mixed-genotype infections in the Hongshuihe samples could be due to low endemicity in this area and/or the inability of the genotyping method to differentiate closely related clones. This resembles the scenarios of the resurgent or introduced P. vivax malaria in Korea and Iran, where mixed infections were very low (Lim et al., 2000; Han et al., 2004; Zakeri et al., 2006b). In conclusion, we have shown that the PCR/RFLP protocol for PvMSP3β gene could be used as a convenient way to differentiate P. vivax isolates in different geographical regions. The polymorphic nature of PvMSPβ should also make it a useful marker for distinguishing relapses (and recrudescences) from new infections.

Acknowledgments

We want to thank staff at the Malaria Clinics and malaria laboratories in different hospitals for assistance in sample collection, and patients for participating in this study. This work was supported by a grant (1D43 TW000657-02) from the Fogarty International Center to LC.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Anderson TJC, Haubold B, Williams JT, Estrada-Franco JG, Richardson L, Mollinedo R, Bocharie M, Mokili J, Mharakurwa S, French N, Whitworth J, Velez ID, Brockman AH, Nosten F, Ferreira MU, Day K. Microsatellite markers reveal a spectrum of population structures in the malaria parasite Plasmodium falciparum. Mol Biol Evol. 2000;17:1467–1482. doi: 10.1093/oxfordjournals.molbev.a026247. [DOI] [PubMed] [Google Scholar]
  2. Babiker HA, Lines J, Hill WG, Walliker D. Population structure of Plasmodium falciparum in villages with different malaria endemicity in east Africa. Am J Trop Med Hyg. 1997;56:141–147. doi: 10.4269/ajtmh.1997.56.141. [DOI] [PubMed] [Google Scholar]
  3. Baird JK, Basri H, Purnomo Bangs MJ, Subianto B, Patchen LC, Hoffman SL. Resistance to chloroquine by Plasmodium vivax in Irian Jaya, Indonesia. Am J Trop Med Hyg. 1991;44:547–552. doi: 10.4269/ajtmh.1991.44.547. [DOI] [PubMed] [Google Scholar]
  4. Bruce MC, Galinski MR, Barnwell JW, Donnelly CA, Walmsley M, Alpers MP, Walliker D, Day K. Genetic diversity and dynamics of Plasmodium falciparum and P. vivax populations in multiply infected children with asymptomatic malaria infections in Papua New Guinea. Parasitology. 2000;121:257–272. doi: 10.1017/s0031182099006356. [DOI] [PubMed] [Google Scholar]
  5. Bruce MC, Galinski MR, Barnwell JW, Snounou G, Day K. Polymorphism at the merozoite surface protein-3α locus of Plasmodium vivax: global and local diversity. Am J Trop Med Hyg. 1999;61:518–525. doi: 10.4269/ajtmh.1999.61.518. [DOI] [PubMed] [Google Scholar]
  6. Chai JY. Re-emerging Plasmodium vivax malaria in the Republic of Korea. Korean J Parasitol. 1999;37:129–143. doi: 10.3347/kjp.1999.37.3.129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Cui L, Escalante AA, Imwong M, Snounou G. The genetic diversity of Plasmodium vivax populations. Trends Parasitol. 2003a;19:220–226. doi: 10.1016/s1471-4922(03)00085-0. [DOI] [PubMed] [Google Scholar]
  8. Cui L, Mascorro CN, Fan Q, Rzomp KA, Khuntirat B, Zhou G, Chen H, Yan G, Sattabongkot J. Genetic diversity and multiple infections of Plasmodium vivax malaria in Western Thailand. Am J Trop Med Hyg. 2003b;68:613–619. doi: 10.4269/ajtmh.2003.68.613. [DOI] [PubMed] [Google Scholar]
  9. de Pecoulas PE, Tahar R, Ouatas T, Mazabraud A, Basco LK. Sequence variations in the Plasmodium vivax dihydrofolate reductase-thymidylate synthase gene and their relationship with pyrimethamine resistance. Mol Biochem Parasitol. 1998;92:265–273. doi: 10.1016/s0166-6851(97)00247-8. [DOI] [PubMed] [Google Scholar]
  10. Figtree M, Pasay CJ, Slade R, Cheng Q, Cloonan N, Walker J, Saul A. Plasmodium vivax synonymous substitution frequencies, evolution and population structure deduced from diversity in AMA 1 and MSP 1 genes. Mol Biochem Parasitol. 2000;108:53–66. doi: 10.1016/s0166-6851(00)00204-8. [DOI] [PubMed] [Google Scholar]
  11. Galinski MR, Corredor-Medina C, Povoa M, Crosby J, Ingravallo P, Barnwell JW. Plasmodium vivax merozoite surface protein-3 contains coiled-coil motifs in an alanine-rich central domain. Mol Biochem Parasitol. 1999;101:131–147. doi: 10.1016/s0166-6851(99)00063-8. [DOI] [PubMed] [Google Scholar]
  12. Galinski MR, Ingravallo P, Corredor-Medina C, Al-Khedery B, Povoa M, Barnwell JW. Plasmodium vivax merozoite surface protein-3β and -3γ share structural similarities with P. vivax merozoite surface protein-3α and define a new gene family. Mol Biochem Parasitol. 2001;115:41–53. doi: 10.1016/s0166-6851(01)00267-5. [DOI] [PubMed] [Google Scholar]
  13. Garnham PCC. Malaria parasites of man: life-cycles and morphology. In: Wernsdorfer WH, Sir McGregor I, editors. Malaria: Principles and Practice of Malariology. Vol. 1. Churchill Livingstone; London: 1988. pp. 61–96. [Google Scholar]
  14. Han ET, Song TE, Park JH, Shin EH, Guk SM, Kim TY, Chai JY. Allelic dimorphism in the merozoite surface protein-3α in Korean isolates of Plasmodium vivax. Am J Trop Med Hyg. 2004;71:745–749. [PubMed] [Google Scholar]
  15. Huber W, Felger I, Matile H, Lipps HJ, Steiger S, Beck HP. Limited sequence polymorphism in the Plasmodium falciparum merozoite surface protein 3. Mol Biochem Parasitol. 1997;87:231–234. doi: 10.1016/s0166-6851(97)00067-4. [DOI] [PubMed] [Google Scholar]
  16. Imwong M, Pukrittayakamee S, Gruner AC, Renia L, Letourneur F, Looareesuwan S, White NJ, Snounou G. Practical PCR genotyping protocols for Plasmodium vivax using Pvcs and Pvmsp1. Malaria J. 2005;4:20. doi: 10.1186/1475-2875-4-20. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Imwong M, Pukrittayakamee S, Renia L, Letourneur F, Charlieu JP, Leartsakulpanich U, Looareesuwan S, White NJ, Snounou G. Novel point mutations in the dihydrofolate reductase gene of Plasmodium vivax: evidence for sequential selection by drug pressure. Antimicrob Agents Chemother. 2003;47:1514–1521. doi: 10.1128/AAC.47.5.1514-1521.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Imwong M, Sudimack D, Pukrittayakamee S, Osorio L, Carlton JM, Day NP, White NJ, Anderson TJ. Microsatellite variation, repeat array length and population history of Plasmodium vivax. Mol Biol Evol. 2006;23:1016–1018. doi: 10.1093/molbev/msj116. [DOI] [PubMed] [Google Scholar]
  19. Kan SP, Shen YZ, Zou Z, Xu FN. Studies on malaria epidemic characteristics and countermeasures in Anhui Province. Chin J Parasitic Dis Control. 1999;12:97–99. [Google Scholar]
  20. Leclerc MC, Menegon M, Cligny A, Noyer JL, Mammadov S, Aliyev N, Gasimov E, Majori G, Severini C. Genetic diversity of Plasmodium vivax isolates from Azerbaijan. Malaria J. 2004;3:40. doi: 10.1186/1475-2875-3-40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Li J, Collins WE, Wirtz RA, Rathore D, Lal A, McCutchan TF. Geographic subdivision of the range of the malaria parasite Plasmodium vivax. Emerg Infect Dis. 2001;7:35–42. doi: 10.3201/eid0701.010105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Lim CS, Kim SH, Kwon SI, Song JW, Song KJ, Lee KN. Analysis of Plasmodium vivax merozoite surface protein-1 gene sequences from resurgent Korean isolates. Am J Trop Med Hyg. 2000;62:261–265. doi: 10.4269/ajtmh.2000.62.261. [DOI] [PubMed] [Google Scholar]
  23. Marlar-Than Myat-Phone-Kyaw, Aye-Yu-Soe Khaing-Khaing-Gyi, Ma-Sabai Myint-Oo. Development of resistance to chloroquine by Plasmodium vivax in Myanmar. Trans R Soc Trop Med Hyg. 1995;89:307–308. doi: 10.1016/0035-9203(95)90556-1. [DOI] [PubMed] [Google Scholar]
  24. Mascorro CN, Zhao K, Khuntirat B, Sattabongkot J, Yan G, Escalante AA, Cui L. Molecular evolution and intragenic recombination of the merozoite surface protein MSP-3α from the malaria parasite Plasmodium vivax in Thailand. Parasitology. 2005;131:25–35. doi: 10.1017/s0031182005007547. [DOI] [PubMed] [Google Scholar]
  25. McColl DJ, Anders RF. Conservation of structural motifs and antigenic diversity in the Plasmodium falciparum merozoite surface protein-3 (MSP-3) Mol Biochem Parasitol. 1997;90:21–31. doi: 10.1016/s0166-6851(97)00130-8. [DOI] [PubMed] [Google Scholar]
  26. McColl DJ, Silva A, Foley M, Kun JFJ, Favaloro JM, Thompson JK, Marshall VM, Coppel RL, Kemp DJ, Anders RF. Molecular variation in a novel polymorphic antigen associated with Plasmodium falciparum merozoites. Mol Biochem Parasitol. 1994;68:53–67. doi: 10.1016/0166-6851(94)00149-9. [DOI] [PubMed] [Google Scholar]
  27. Mendis K, Sina BJ, Marchesini P, Carter R. The neglected burden of Plasmodium vivax malaria. Am J Trop Med Hyg. 2001;64:S97–106. doi: 10.4269/ajtmh.2001.64.97. [DOI] [PubMed] [Google Scholar]
  28. Meyer CG, May J, Arez AP, Gil JP, do Rosario V. Genetic diversity of Plasmodium falciparum: asexual stages. Trop Med Int Health. 2002;7:395–408. doi: 10.1046/j.1365-3156.2002.00875.x. [DOI] [PubMed] [Google Scholar]
  29. Mueller I, Kaiok J, Reeder JC, Cortes A. The population structure of Plasmodium falciparum and Plasmodium vivax during an epidemic of malaria in the Eastern Highlands of Papua New Guinea. Am J Trop Med Hyg. 2002;67:459–464. doi: 10.4269/ajtmh.2002.67.459. [DOI] [PubMed] [Google Scholar]
  30. Ord R, Polley S, Tami A, Sutherland CJ. High sequence diversity and evidence of balancing selection in the Pvmsp3α gene of Plasmodium vivax in the Venezuelan Amazon. Mol Biochem Parasitol. 2005;144:86–93. doi: 10.1016/j.molbiopara.2005.08.005. [DOI] [PubMed] [Google Scholar]
  31. Phillips EJ, Keystone JS, Kain KC. Failure of combined chloroquine and high-dose primaquine therapy for Plasmodium vivax malaria acquired in Guyana, South America. Clin Infect Dis. 1996;23:1171–1173. doi: 10.1093/clinids/23.5.1171. [DOI] [PubMed] [Google Scholar]
  32. Putaporntip C, Jongwutiwes S, Sakihama N, Ferreira MU, Kho WG, Kaneko A, Kanbara H, Hattori T, Tanabe K. Mosaic organization and heterogeneity in frequency of allelic recombination of the Plasmodium vivax merozoite surface protein-1 locus. Proc Natl Acad Sci USA. 2002;99:16348–16353. doi: 10.1073/pnas.252348999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Rayner JC, Corredor V, Feldman D, Ingravallo P, Iderabdullah F, Galinski MR, Barnwell JW. Extensive polymorphism in the Plasmodium vivax merozoite surface coat protein MSP-3α is limited to specific domains. Parasitology. 2002;125:393–405. doi: 10.1017/s0031182002002317. [DOI] [PubMed] [Google Scholar]
  34. Rayner JC, Huber CS, Feldman D, Ingravallo P, Galinski MR, Barnwell JW. Plasmodium vivax merozoite surface protein-3β is radically polymorphic through mutation and large insertions and deletions. Infect Gen Evol. 2004;4:309–319. doi: 10.1016/j.meegid.2004.03.003. [DOI] [PubMed] [Google Scholar]
  35. Rickmann KH. Plasmodium vivax resistance to chloroquine? Lancet. 1989;2:1183–1184. doi: 10.1016/s0140-6736(89)91792-3. [DOI] [PubMed] [Google Scholar]
  36. Rodriguez MH, Gonzalez-Ceron L, Hernandez JE, Nettel JA, Villarreal C, Kain KC, Wirtz RA. Different prevalence of Plasmodium vivax phenotypes CK210 and VK247 associated with the distribution of Anopheles albimanus and Anopheles pseudopunctipennis in Mexico. Am J Trop Med Hyg. 2000;62:122–127. doi: 10.4269/ajtmh.2000.62.122. [DOI] [PubMed] [Google Scholar]
  37. Rosenberg R, Wirtz RA, Lanar DE, Sattabongkot J, Hall T, Waters AP, Prasittisuk C. Circumsporozoite protein heterogeneity in the human malaria parasite Plasmodium vivax. Science. 1989;245:973–976. doi: 10.1126/science.2672336. [DOI] [PubMed] [Google Scholar]
  38. Sabatinelli G, Aliev S, Ejov M, Verbitsky V. The malaria epidemiological situation in Tajikistan. Parassitologia. 2000;42 (suppl 1):I48. [Google Scholar]
  39. Sattabongkot J, Tsuboi T, Zollner GE, Sirichaisinthop J, Cui L. Plasmodium vivax transmission: chances for control? Trends Parasitol. 2004;20:192–198. doi: 10.1016/j.pt.2004.02.001. [DOI] [PubMed] [Google Scholar]
  40. Sheng HF, Zhou SS, Gu ZC, Zheng X. Malaria situation in the People’s Republic of China in 2002. Chin J Parasitol Parasit Dis. 2003;21:193–196. [PubMed] [Google Scholar]
  41. Sleigh AC, Liu XL, Jackson S, Li P, Shang LY. Resurgence of vivax malaria in Henan Province, China. Bull World Health Organ. 1998;76:265–270. [PMC free article] [PubMed] [Google Scholar]
  42. Xainli J, Adams JH, King CL. The erythrocyte binding motif of Plasmodium vivax Duffy binding protein is highly polymorphic and functionally conserved in isolates from Papua New Guinea. Mol Biochem Parasitol. 2000;111:153–160. doi: 10.1016/s0166-6851(00)00315-7. [DOI] [PubMed] [Google Scholar]
  43. Xu BL, Su YP, Shang LY, Zhang HW. Malaria control in Henan Province, People’s Republic of China. Am J Trop Med Hyg. 2006;74:564–567. [PubMed] [Google Scholar]
  44. Xu FN, Shen YZ, Jia SC, Zou Z. Feature analysis of local malaria re-rise in Plasmodium vivax endemic area in Anhui Province. Chin J Parasitic Dis Control. 2003;16:19–21. [Google Scholar]
  45. Xu JJ, Zhou GR, Yang F, Wang XL. Study on malaria control measures and surveillance in the different vector areas in Guizhou. Guizhou Med J. 2000;24:185–187. [Google Scholar]
  46. Zakeri S, Djadid ND, Zeinali S. Sequence heterogeneity of the merozoite surface protein-1 gene (MSP-1) of Plasmodium vivax wild isolates in southeastern Iran. Acta Trop. 2003;88:91–97. doi: 10.1016/s0001-706x(03)00192-x. [DOI] [PubMed] [Google Scholar]
  47. Zakeri S, Mehrizi AA, Djadid ND, Snounou G. Circumsporozoite protein gene diversity among temperate and tropical Plasmodium vivax isolates in Iran. Trop Med Int Health. 2006a;11:729–737. doi: 10.1111/j.1365-3156.2006.01613.x. [DOI] [PubMed] [Google Scholar]
  48. Zakeri S, Mehrizi AA, Mamaghani S, Noorizadeh S, Snounou G, Djadid ND. Population structure analysis of Plasmodium vivax in areas of Iran with different malaria endemicity. Am J Trop Med Hyg. 2006b;74:394–400. [PubMed] [Google Scholar]
  49. Zhou G, Sirichaisinthop J, Sattabongkot J, Jones J, Bjornstad ON, Yan G, Cui L. Spatio-temporal distribution of Plasmodium falciparum and P. vivax malaria in Thailand. Am J Trop Med Hyg. 2005;72:256–262. [PubMed] [Google Scholar]

RESOURCES