Abstract
Prostate cancer is the second leading cause of cancer-related deaths in the United States. However, the underlying molecular events for prostate cancer development are not clear. In this study, we applied the recently developed technology known as differential subtraction chain (DSC) to identify a novel gene whose expression is inactivated in high grade prostate cancer. This gene, designated as SAPC, is expressed in normal prostate acinar cells. Its expression is dramatically down-regulated in high grade prostate cancers (4/4) but is unaltered in low grade prostate cancers. It encodes a 7.7-kd protein. Its sequence shares some homology with the cysteine-rich domain of 2–5A-dependent RNase L, which is a critical component of the interferon-induced apoptosis cascade. The selective inactivation in the more aggressive prostate cancers holds promise for SAPC as a potential prognostic marker for high grade prostate cancer.
Prostate cancer is one of the most frequently diagnosed malignancies in American men. Approximately 40,000 people die from this disease annually. 1 Despite the recent advances in our understanding of the environmental, hormonal, and nutritional etiologies of prostate cancer, much remains to be learned about the pathogenesis of prostate cancer.
The prostate gland is an organ with a unique predilection for abnormal growth along with advancing age. Although the incidence of prostate cancer is frequent, occurring in almost one-third of men over age 45, 2,3 the proportion of cases reaching the stages with clinical symptoms varies widely among different areas of the world. 4,5 There is strong evidence for both genetic and environmental factors in prostate cancer development. 2 However, it is not clear what molecular events are responsible for the progression of prostate cancer from a relatively indolent disease to one that could be life-threatening.
Recently we developed a new technology, termed differential subtraction chain (DSC), that detects the differences of genomic DNA or mRNA expression between two types of tissues. 6 In comparison with differential display, DSC has the advantage of evaluating all species of mRNA in a single trial. With this technique, there is no need to handle radio-isotope, run sequencing gels, or excise manual gels for DNA fragment isolation. We applied this technology to prostate cancer and have identified expression sequences whose expressions were down-regulated in prostate cancer. One of these genes, designated SAPC (suppressed in aggressive prostate cancer), was found to have its expression limited to the epithelium of the normal prostate gland, but inactivated in prostate cancer with high Gleason score at advanced clinical stages.
Materials and Methods
Full Length cDNA Synthesis
Fresh surgical specimen of prostate cancer tissue was macrodissected to procure a tumor nodule and was confirmed to be free of normal prostate glandular tissue by examining multiple levels of frozen sections. Epithelial cells were separated from stromal cells by Percoll gradient centrifugation. Total RNA was extracted from epithelial cells with the Trizol method (Gibco-BRL, Rockville, MD). The extraction procedure was performed according to manufacturer’s recommendation. Oligo-d(T) (TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTV) and a switching primer BgIIIaG (AGGCAACTGTGCTATCCGAGGGAAGGG) were used in the first strand cDNA synthesis with 1 μg of total RNA and Superscript II (Gibco-BRL). For cDNA synthesis of normal prostate tissue, a pool of total RNA from prostate tissue of 8 normal organ donors was used. This was followed by polymerase chain reaction (PCR) of 94°C for 1 minute, then 94°C for 30 seconds, 56°C for 1 minute, and 72°C for 4 minutes for 26 to 30 cycles to amplify the full length cDNA fragments.
cDNA Amplicon Generation
One microgram of cDNA from tumor or normal prostate tissue was digested with 10 units of DpnII at 37°C for 6 hours. The digestion mixture was purified by QIAquick PCR purification kit (Qiagen, Valencia, CA), and ligated with adapter sequences BamIa/Ib (for normal prostate) (BamIa, ATGAAGTGCACCCTACGATTCGAG, BamIb, pGATCCTCGAATCGTAGTGGGCACT) and BamIIa/IIb (for tumor prostate) (BamIIa, ATGAGACATGTTTCGTAGCCTAGG, BamIIb, pGATCCCTAGG CTACG AAACATGTC) by T4 DNA ligase (New England Biolabs, Beverly, MA) at 25°C for 6 to 16 hours. The ligation mixture was purified and amplified by PCR (94°C for 1 minute, then 94°C for 30 seconds and 68°C for 3 minutes for 30 cycles).
cDNA DSC
Five hundred nanograms of normal prostate cDNA amplicons were mixed with 10 μg of prostate cancer cDNA amplicons, which had been digested with DpnII to remove the attached adapter sequences, in a total volume of 8 μl. The mixture was then heated to 98°C for 3 minutes, and 2 μl of 5 mol/L NaCl were added to the reaction to give the final concentration of 1 mol/L while maintaining the temperature at 98°C. The mixture was then incubated at 98°C for an additional 2 minutes and hybridized at 67°C for 20 hours. The hybridization mixture was purified by sodium acetate/ethanol precipitation. The pellet was then washed with 70% ethanol. The dry pellet of the hybridization mixture was reconstituted in 50 μl of 1× Mung bean nuclease buffer and digested with 10 units of Mung bean nuclease at 30°C for 30 minutes. The digestion products were treated with 0.5 μl of 10% sodium dodecyl sulfate (SDS) and purified with ethanol precipitation. The DNA was resuspended in 9 μl of 3× EE (3 mmol/L EDTA, 3mmol/L EPPS, pH 8.0) buffer. One microliter was removed for PCR (quality control). The remainder of the sample was reheated to 98°C for rehybridization. This procedure was repeated twice.
DSC Product Cloning, Colony Screening, and Sequencing
Round 3 DSC products were amplified by PCR (94°C for 1 minute, then 35 cycles of 94°C for 30 seconds, 68°C for 3 minutes). The amplified products were visualized by agarose gel electrophoresis. An aliquot of the amplified products was ligated with TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and transfected into Escherichia coli. Fifteen colonies were randomly picked and grown overnight in LB broth with 100 μg/ml of ampicillin. Aliquots of the bacterial culture were spotted onto colony screen filter and hybridized with amplicons generated from normal or tumor prostate tissues. To identify which DSC fragment was not present in the tumor specimen, only those colonies without hybridization signal for tumor amplicons but positive for normal amplicons were selected. DNA was extracted from the selected colonies and sequenced using M13 forward and reverse primers.
Obtaining Full Length cDNA
Rapid amplification of cDNA end (RACE) was used. 5′ and 3′ ends of SAPC, a gene fragment identified in the previous procedure, were amplified with pairs of gene-specific primers and adapter/primers (gene-specific sense primer/AP1, gene-specific anti-sense primer/AP2) in PCR (94°C for 1 minute, then 35 cycles of 94°C for 30 seconds, 68°C for 4 minutes.) from Marathon cDNA library of normal prostate tissue (Clontech, Palo Alto, CA). The RACE products were visualized by agarose electrophoresis. An aliquot of the RACE products was ligated to TOPO TA cloning vector. Two hundred colonies were randomly picked and cultured in Luria-Bertani broth. The overnight cultures were spotted on genescreen filter and hybridized with 32P-labeled SAPC DNA fragments. DNA was extracted from colonies that showed positive reactions and sequenced.
In Situ RNA Hybridization
5′ end rhodamine-labeled 24-mer oligonucleotides corresponding to anti-sense or sense sequence (control) of SAPC were incubated with pronase digested, prehybridized, 3-μm-thin sections of prostate tissue from polyester-embedded tissue blocks at 37°C for 12 hours in hybridization solution. The slides were then washed twice with 2× standard saline citrate for 15 minutes, and then twice with 1× standard saline citrate for 15 minutes. 7
In Vitro Transcription and Translation
A 1.5-kb PCR product of SAPC was ligated to pCR2 vector. One microgram of the purified DNA from the selected colonies was used in a TNT Couple Wheat Germ Extract system (Promega, Madison, WI) for in vitro transcription and translation assay. The procedure was performed according to the manufacturer’s instruction.
Results
To identify gene expression inactivation in prostate cancer, prostate cancer cell cDNA amplicons were used as drivers in a DSC reaction to subtract the counterparts from a pool of normal prostates. After 3 rounds of DSC as shown in Figure 1A, a ▶ distinct banding pattern was obtained. These DSC products were subcloned into TOPO TA cloning vector. Fifteen colonies were randomly picked and hybridized with amplicons from tumors and normal prostate tissues. The DNA inserts from those colonies that gave positive signals in hybridization with amplicons from normal cells but negative from cancer cells were interpreted as specific for normal prostate; thus, expression was inactivated in prostate cancer. From those colonies that contain inserts specific for normal prostate tissues, the DNA fragments were extracted and sequenced. Most of the DSC cDNA fragments obtained through this procedure represent previously unknown sequences. Three of the 15 colonies were determined to contain the same sequence. This sequence, designated SAPC, was used as a probe to hybridize with total RNA from normal and tumor samples that were used to produce cDNA amplicons. As shown in Figure 1D, a ▶ band corresponding to a 1.6-kb mRNA is identified in the normal prostate tissue in a Northern blot analyses. To further confirm the specificity of this DNA fragment, PCR was performed on amplicons generated from prostate cancer or normal prostate tissues. No PCR product was amplified from the tumor sample. In contrast, a 120-bp DNA fragment was identified in the normal prostate tissue (Figure 1B) ▶ . Similar results were also obtained in RT-PCR (Figure 1C) ▶ , confirming the inactivation of expression of this cDNA fragment in prostate cancer.
Figure 1.
Identification of SAPC through differential subtraction chain. A: Agarose electrophoresis of PCR amplified DSC products after rounds 0 (lane 1), 1 (lane 2), 2 (lane 3), and 3 (lane 4). B: PCR on cDNA amplicons generated from normal prostate tissues (lane 1) and prostate cancer (lane 2) with primers specific for SAPC. The primer sequences are AAAACTCTGGATTGCCGACTCTGC and CCATTAGGCAAGTCAAAGCATTTC. C: RT-PCR on total RNA isolated from normal prostate and prostate cancer using primers specific for SAPC as of B. Primers specific for ubiquitin were used as control. The primer sequences are GACGCAAACATGCAGATCTTTGTG and AATGAAAGGGACACTTTATTGAGG. D: Northern blot analysis of SAPC expression on total RNA isolated from normal prostate tissues (lanes 1 and 3) and prostate cancer (lanes 2 and 4). Random primed 32P labeled SAPC fragment was used as a probe.
A survey study was performed to investigate whether inactivation of this cDNA fragment also occurs in other prostate cancer cases. A panel of 16 prostate cancer cases of various clinical stages and Gleason scores was tested by reverse transcriptase (RT) PCR to examine the expression status of SAPC (Table 1) ▶ . As shown in Figure 2, 3 ▶ ▶ of 16 prostate cancer cases from frozen tissues had the inactivation of expression of this gene. Interestingly, the clinical stage, Gleason score and seminal vesical involvement of two of these prostate cancer cases were similar to the case where SAPC was originally identified, whereas the third case presented with a distant metastasis. All four cases where SAPC expression was inactivated shared the features of higher Gleason scores, 8,9 extensive seminal vesicle involvement and multiple foci of capsular penetration. In three cases, there were metastases of prostate cancer. These features generally characterized more aggressive prostate cancer. In contrast, the 13 other cases of prostate cancer that were positive for SAPC expression were characterized with lower Gleason score, 5-7 no seminal vesicle involvement, negative lymph node metastasis, and few with capsular penetration.
Table 1.
Expression of SAPC in Various Stages and Grades of Prostatic Adenocarcinoma
| Case no. | Gleason score* | Capsular invasion | Seminal vesicle invasion | Metastasis status | Clinical stage | SAPC/UB ratio |
|---|---|---|---|---|---|---|
| 1 | 4 + 5 = 9 | Multifocal | Extensive | Lymph nodes | T3b | 0.02 |
| 2 | 3 + 3 = 6 | – | – | – | T1c | 0.72 |
| 3 | 3 + 4 = 7 | – | – | – | T1c | 0.65 |
| 4 | 3 + 4 = 7 | – | – | – | T2b | 0.58 |
| 5 | 3 + 4 = 7 | Focal | – | – | T3a | 1.09 |
| 6 | 3 + 4 = 7 | Multifocal | – | – | T3a | 1.32 |
| 7 | 4 + 4 = 8 | N/A | N/A | Liver | T4 | 0.02 |
| 8 | 3 + 3 = 6 | Focal | – | – | T3a | 0.56 |
| 9 | 3 + 3 = 6 | – | – | – | T1c | 0.49 |
| 10 | 3 + 2 = 5 | – | – | – | T2a | 0.61 |
| 11 | 3 + 3 = 6 | – | – | – | T1c | 0.69 |
| 12† | 2 + 5 = 7 | Focal | – | – | T3a | 0.58 |
| 13 | 3 + 4 = 7 | Multifocal | – | – | T3a | 0.68 |
| 14 | 3 + 3 = 6 | Focal | – | – | T3a | 0.59 |
| 15 | 3 + 4 = 7 | – | – | – | T3a | 0.52 |
| 16 | 5 + 3 = 8 | Focal | Extensive | SLL | T3b | 0.05 |
| 17‡ | 4 + 4 = 8 | Multifocal | Extensive | Lymph nodes | T3b | 0.01 |
*Cells from dominant pattern account for over 70% of the microdissected samples or otherwise specified.
†Gleason 2 accounts for 95% of the sample.
‡The case where DSC was performed.
SLL, small lymphocytic lymphoma; SAPC/UB ratio, SAPC/ubiquitin expression ratio; N/A, prostatectomy is not applicable.
Figure 2.

Expression of SAPC in prostate cancer. A: Agarose electrophoresis of RT-PCR products generated from 1 μg total RNA obtained from microdissected prostate cancer cells (middle panel) and paired normal prostate tissues (upper panel) with primers specific for SAPC. Sixteen cases of prostate cancer were shown from case #1 (lane 1) through #16 (lane 15). Lower panel represents RT-PCR products of ubiquitin from the same tumor RNA samples of the middle panel. PCR was performed under the following condition: 94°C for 1 minute, then 26 cycles of 94°C for 30 seconds and 68°C for 3 minutes. B: Hematoxylin and eosin (H&E) stains and RNA in situ hybridization with SAPC on normal prostate tissue. H&E stain (upper) and RNA in situ hybridization of SAPC (lower) on normal prostate tissue. C: H&E stain (upper) and RNA in situ hybridization with SAPC (lower) on an intermediate grade prostate cancer with a Gleason score of 3 + 3 = 6. D: H&E stains and RNA in situ hybridization with SAPC on a high grade prostate cancer with a Gleason score of 4 + 4 = 8.
Figure 3.

Expression of SAPC in 24 different types of human organs. RT-PCR products of SAPC were produced from total RNA of 24 organ tissues with primers specific for SAPC. The specific organs are indicated under each lane. PCR was performed for 35 cycles. Positive controls with primers specific for actin were performed (data not shown).
To identify cells or structure within the prostate glands that are expressing SAPC, in situ hybridization with oligonucleotides corresponding to SAPC coding region as probes was performed on normal prostate tissue. As shown in Figure 2B ▶ , the expression of SAPC mRNA was restricted to prostate acinar cells, with the strongest expression occurring at the top layer of the epithelium. In contrast, the expression of SAPC was strongly suppressed in a high grade prostate cancer (Gleason score 4 + 4 = 8; Figure 2D ▶ ), whereas the expression of SAPC was essentially unchanged in an intermediate grade prostate cancer (Figure 2C) ▶ . To investigate whether the expression of SAPC is specific for prostate tissue, RT-PCR was performed on the tissues of 24 different human organs. As demonstrated in Figure 3 ▶ , in addition to prostate, the expression of SAPC was also identified in placenta, kidney, lung, adrenal gland, spleen, and heart.
To obtain the full length SAPC cDNA from normal prostate tissue, RACE with gene-specific primers derived from SAPC sequences was performed. A 1.6-kb cDNA fragment was obtained. As shown in Figure 4A ▶ , this DNA fragment contains an open reading frame that encodes a 64-amino acid protein. A homology search of this protein indicates that it shares weak (60% positive) homology with the cysteine-rich domain of 2–5A-dependent RNase L (Figure 4B) ▶ . To determine the orientation of SAPC cDNA and to rule out the potential artifacts generated during the library construction process, reverse transcriptions were performed using primers corresponding to the putative sense and anti-sense orientation of SAPC, respectively. Subsequently, PCRs were performed to detect the presence of reverse transcription products. As shown in Figure 4C ▶ , RT-PCR with the primer of the putative anti-sense direction (lane 2) generated a SAPC PCR product, whereas the sense primer (lane 1) did not. This confirms the orientation of SAPC mRNA, where the 64-amino acid open reading frame is located. To test whether this open reading frame is indeed functioning, in vitro transcription and translation with a plasmid containing the full length cDNA of SAPC were performed. A 7.7-kd protein was identified in a SDS-PAGE (Figure 4D) ▶ , consistent with the predicted molecular weight of the SAPC gene product.
Figure 4.

Open reading frame of SAPC and its homology with 2–5A-dependent RNase L. A: Nucleotide sequence and the correspondent amino acid sequence of SAPC. B: Amino acid sequence homology of SAPC with cysteine-rich domain of 2–5A-dependent RNase L. C: Identifying the orientation of SAPC cDNA. One microgram of total RNA from normal prostate tissues was reverse transcribed with a primer (CCATTAGGCAAGTCAAAGCATTTC, lane 1) corresponding to the putative sense orientation of SAPC DNA fragment and a primer (AAAACTCTGGATTGCCGACTCTGC, lane 2) corresponding to the putative anti-sense, respectively. The SAPC DNA was subsequently amplified with primers corresponding to the downstream SAPC DNA (GCATTTCTCTAGAACTGCCTGAGGGCAG/GATTGCCGACTCTGCACATCCTGGTTCC). D: In vitro transcription and in vitro translation of SAPC gene product. Vectors pCR2.1 containing full length SAPC cDNA fragment (lane 2) or containing no insert (lane 1) were in vitro transcribed and translated with S35-methionine. The translation products were separated with SDS-PAGE.
Discussion
Currently, histological classification of prostate cancer, specifically Gleason grading and pathological staging, is the mainstay of prognostic assessment once a cancer is verified by tissue sampling. However, to produce an accurate Gleason score and staging, extensive tissue sampling is required. This may limit the usefulness of histological classification when the amount of diagnostic tissue is small, such as when needle core biopsy samples are used. Molecular markers with prognostic significance may be of great value in assessing the invasiveness of a tumor. Suppression of SAPC expression in cancer cells correlates well (4/4) with the metastatic and aggressive behavior of prostate cancers. Examining the expression of SAPC in prostate cancer tissues may help to predict the stages of the disease. It will be of interest to see whether change in expression status of SAPC occurs in the early stages of aggressive prostate cancers.
Although the functional role of SAPC has not been established, there are some probabilities that SAPC may interact with 2–5A-dependent RNase L in vivo. First, SAPC is expressed mostly in terminally differentiated cells, as evidenced by the most intense staining in the top layer of epithelial cells of prostate glands. Its expression is dramatically decreased when cells are stimulated with serum growth factors (data not shown). Second, SAPC contains weak but distinctive homology with the cysteine-rich region of 2–5A-dependent RNase L, which is thought to be essential for dimerization and for protein-protein interaction. 8 It has been shown that expression and activation of 2–5A-dependent RNase L is required for cells undergoing apoptosis and differentiation. 9-11 Decreased expression of 2–5A-dependent RNase L is found in proliferating cells. 12 The regulation of cell cycle by 2–5A-dependent RNase L is thought to occur through regulating the overall level of RNA. 13 It is tempting to hypothesize that SAPC regulates the cell cycle through its interaction with 2–5A-dependent RNase L. However, the direct evidence of physical interaction between SAPC and 2–5A-dependent RNase L, and the effect of SAPC on RNA level must await the ongoing complex formation study between SAPC and 2–5A-dependent RNase L and the SAPC functional study.
The significance of suppression of SAPC expression is not clear. However, in view of the fact that most of its expression inactivation occurs exclusively in high Gleason score prostate cancer, it is reasonable to postulate that the suppression of SAPC expression represents a distinctive genetic event in the prostate cancer development that underlies a more aggressive behavior. Expression of SAPC is restricted to several organs. In situ hybridization suggests that its expression is present in prostate acinar cells, in certain area of proximal tubules of the kidney and the lobules of the breast (data not shown). The predominant expression of SAPC in mature and differentiated epithelium is consistent with the hypothesis that expression of SAPC is associated with terminal cell differentiation and possibly programmed cell death. A correlation between SAPC expression, differentiation, and/or apoptosis will help to address the hypothesis.
In conclusion, using DSC methodology, we have identified a novel gene whose expression is frequently inactivated in high grade prostate carcinoma and may represent an important component in cell differentiation and apoptosis. It is possible that suppression of SAPC expression in prostate cancer can be used as a prognostic factor to evaluate the potential behavior of a prostate cancer.
Acknowledgments
We thank Judy Stoner for technical support and Tracie Wagner and Petrina DeFlavia for providing prostate tissue.
Footnotes
Address reprint requests to Jian-Hua Luo, Department of Pathology, University of Pittsburgh School of Medicine, Scaife Hall A-725, 3550 Terrace Street, Pittsburgh, PA 15260. E-mail: luojh+@pitt.edu.
Supported by a grant (CRTG-00-139-01-CCE) from the American Cancer Society to J.-H. L.
References
- 1.Landis SH, Murray T, Bolden S, Wingo PA: Cancer statistics, CA. Cancer J Clin 1999, 49:8-31 [DOI] [PubMed] [Google Scholar]
- 2.Issacs JT: Molecular markers for prostate cancer metastasis. Am J Pathol 1997, 150:1511-1521 [PMC free article] [PubMed] [Google Scholar]
- 3.Dohm G: Classification and grading of prostatic carcinoma: recent results. Cancer Res 1977, 60:14-18 [DOI] [PubMed] [Google Scholar]
- 4.Yatani R, Chigusa I, Akazaki K, Stemmerman G, Welsh R, Correa P: Geographic pathology of latent prostatic carcinoma. Int J Cancer 1982, 29:611-616 [DOI] [PubMed] [Google Scholar]
- 5.Breslow N, Chan G, Dhom G, Drury R, Franks L, Gellei B, Lee Y, Lundberg S, Sparke B, Sternby N, Tulinius H: Latent carcinoma of the prostate at autopsy in seven areas. Int J Cancer 1977, 20:680-688 [DOI] [PubMed] [Google Scholar]
- 6.Luo JH, Puc JA, Slosberg ED, Yao Y, Bruce JN, Wright TC, Becich MJ, Parsons R: Differential subtraction chain, a method for identifying differences in genomic DNA and mRNA. Nucleic Acids Res 1999, 27:24e, i-viii [DOI] [PMC free article] [PubMed]
- 7.Wang FL, Wang Y, Wong WK, Liu Y, Addivinola FJ, Liang P, Chen LB, Kantoff PW, Pardee AB: Two differentially expressed genes in normal prostate tissue and in carcinoma. Cancer Res 1996, 56:3634-3637 [PubMed] [Google Scholar]
- 8.Zhou A, Hassel BA, Silverman RH: Expression cloning of 2–5A-dependent RNase: a uniquely regulated mediator of interferon action. Cell 1993, 72:753-765 [DOI] [PubMed] [Google Scholar]
- 9.Castelli J, Wood KA, Youle RJ: The 2–5A system in viral infection and apoptosis. Biomed Pharmacother 1998, 52:386-390 [DOI] [PubMed] [Google Scholar]
- 10.Hovanessian AG, Wood JN: Anticellular and antiviral effects of pppA(2′p5′A)n. Virology 1980, 101:81-90 [DOI] [PubMed] [Google Scholar]
- 11.Zhou A, Paranjape J, Brown TL, Nie H, Naik S, Dong B, Chang A, Trapp B, Fairchild R, Colmenares C, Silverman RH: Interferon action and apoptosis are defective in mice devoid of 2′,5′-oligoadenylate-dependent RNase L. EMBO J 1997, 16:6355-6363 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Rysiecki G, Gewert DR, Williams RRG: Constitutive expression of a 2′,5′-oligoadenylate synthetase cDNA results in increased antiviral activity and growth suppression. J Interferon Res 1989, 9:649-657 [DOI] [PubMed] [Google Scholar]
- 13.Stark G, Dower WJ, Schimke RT, Brown RE, Kerr IM: 2–5A synthetase: assay, distribution and variation with growth or hormone status. Nature 1979, 278:471-473 [DOI] [PubMed] [Google Scholar]

