Genetics and Expression of the Carbapenem-Hydrolyzing Oxacillinase Gene bla_OXA-23 in Acinetobacter baumannii

Abstract

The genetic structures surrounding the plasmid-carried bla_OXA-23 oxacillinase gene, encoding resistance to carbapenems, were studied in Acinetobacter baumannii. ISAba1 and the novel element ISAba4 were detected upstream of the bla_OXA-23 gene, providing promoter sequences for its expression. These insertion elements were likely involved in transposition processes at the origin of acquisition of this β-lactamase gene.

Acinetobacter baumannii is a typical opportunistic pathogen, often involved in nosocomial outbreaks, for which resistance to carbapenems is increasingly reported (23) and may be linked to the production of Ambler class B metallo-β-lactamases (30) but also to the production of carbapenem-hydrolyzing class D β-lactamases (CHDLs) (18, 31). Although integrons are associated with many metallo-β-lactamase or oxacillinase genes, they are likely not the genetic vehicles for acquisition of CHDL genes since these genes are not in the form of gene cassettes (10, 22, 23). Three main acquired CHDL gene clusters have been described for A. baumannii, namely, the bla_OXA-23-, bla_OXA-24-, and bla_OXA-58-like genes, whereas the bla_OXA-51 gene cluster is naturally occurring and chromosomally located in A. baumannii (5, 6, 11, 16, 23, 29). The bla_OXA-23 gene has been identified worldwide in A. baumannii (4, 8, 9, 13, 15, 27) and in Proteus mirabilis in France (3). Whereas the bla_OXA-24-like genes have been identified as chromosomally encoded, the bla_OXA-23 and bla_OXA-58 genes are mostly found on plasmids (23). The acquisition of bla_OXA-58 in an A. baumannii isolate from France has been associated with a homologous recombination process (21, 22).

ISAba1 has been found upstream of bla_OXA-58, bla_OXA-51-like, and bla_ampC genes in A. baumannii and is involved in their expression (7, 12, 23, 26, 28). ISAba1 belongs to the IS4 family of insertion sequences, possesses two 16-bp imperfect inverted repeats (IRs), and generates a 9-bp target site duplication upon transposition. Its transposase is made of two open reading frames, encoding 189 and 178 amino acids, leading to a functional protein when a frameshift occurs during the translation process (12).

The aim of this study was to analyze the genetics of acquisition and expression of the bla_OXA-23 gene in unrelated A. baumannii isolates recovered from different countries (Table 1). Genes coding for CHDLs were searched for by PCR, using primers specific for the bla_OXA-23-like, bla_OXA-24-like, and bla_OXA-58 genes (15). Two bla_OXA-23-positive A. baumannii isolates (Ab13 and Ab14) resistant to all β-lactams, including carbapenems, were studied in detail (Table 1). Genetic structures surrounding the bla_OXA-23 gene in A. baumannii Ab13 and Ab14 were cloned by restricting total DNA by BamHI or SacI, ligating it into BamHI- or SacI-restricted plasmid pBK-CMV, and transforming the recombinant plasmids into Escherichia coli DH10B, as described previously (11). Recombinant plasmids were selected on Trypticase soy agar plates containing amoxicillin (50 μg/ml) and kanamycin (30 μg/ml). The cloned DNA fragments of several recombinant plasmids (pAB13B, pAB13S, and pAB14B) were sequenced and analyzed as described previously (21).

TABLE 1.

Characteristics of bla_OXA-23-positive Acinetobacter baumannii clinical isolates

Strain	Date of isolation (mo/yr)	Location	MIC of imipenem (μg/ml)a	Transposonb	Reference
Ab13	06/2004	Bicêtre, France	32	Tn2006	This study
TN585	08/2004	Bicêtre, France	32	Tn2006	This study
DOS	05/2004	Paris, France	32	Tn2007	This study
TN273	12/2003	Paris, France	16	Tn2006	This study
TN508	03/2004	Papeete, Tahiti	64	Tn2006	17
TN712	03/2005	Papeete, Tahiti	64	Tn2006	17
TN479	04/2004	Tarbes, France	32	Tn2006	This study
Ab14	12/2004	Algeria	16	Tn2007	This study
TN802	02/2004	Noumea, New Caledonia	>64	Tn2006	This study
TN850	06/2006	Ankara, Turkey	32	Tn2006	This study
TN761	05/2005	Vietnam	32	Tn2006	This study
TN614	11/2004	Libya	64	Tn2006	This study
RF10	11/2003	Romania	32	Tn2006	15

^aMICs of meropenem were very similar to those of imipenem.

^bAs presented in Fig. 1.

Recombinant plasmids pAB13B and pAB13S, obtained from A. baumannii Ab13, revealed that bla_OXA-23 was bracketed by two copies of an identical ISAba1 element that were in opposite orientations (Fig. 1). Detailed DNA sequence analysis revealed a 9-bp target site duplication at the inverted repeat right (IRR) extremities of the two ISAba1 elements, suggesting that both copies formed a putative composite transposon, Tn2006, likely at the origin of bla_OXA-23 acquisition (Fig. 1). The Tn2006 insertion occurred inside a gene encoding a putative sulfonamide resistance protein sharing 89% amino acid identity with a protein identified in A. baumannii AYE (accession no. CAJ31116). Sequencing of the internal sequence of that transposon revealed a 2,445-bp sequence containing, in addition to the bla_OXA-23 gene, two other genes, encoding part of a putative AAA ATPase (83% amino acid identity with that of Acinetobacter baylyi ADP-1 [2] [accession no. YP_046025] but lacking the first 70 N-terminal amino acids) and part of a putative DEAD helicase sharing 69% identity with that of Ralstonia solanacearum but lacking its 493-amino-acid C-terminal extremity (accession no. ZP_00943964) (Fig. 1). These two proteins were truncated at the exact same position, suggesting that a recombination event had occurred. Even though ISAba1 has been shown to be very prevalent in A. baumannii and might be “customized” for that species (25), this is the first description of an ISAba1-based putative composite transposon.

FIG. 1.

Schematic maps of inserts of recombinant plasmids harboring the bla_OXA-23 gene. (A) Two recombinant plasmids obtained from isolate Ab13. (B) Recombinant plasmid obtained from isolate Ab14. BamHI and SacI restriction sites are indicated, as well as the corresponding recombinant plasmids obtained (pAB13B, pAB13S, and pAB14B). The boundaries of Tn2006 and Tn2007 are indicated, together with the target site duplications likely generated by the transposition events (bold and underlined). The sequences that are identical between Tn2006 and Tn2007 are bracketed by two diagonal, parallel lines. Primer positions are indicated, and their sequences are available in Table 2. orf, orf1, and orf3, genes of unknown function; sulf, sulfonamide resistance gene; ATPase, gene encoding the putative AAA ATPase; DEAD, gene encoding the putative DEAD helicase; and mob, gene encoding the putative MobB mobilization protein.

Sequencing of the recombinant plasmid pAB14B obtained from isolate Ab14 identified a novel ISAba4 element upstream of the bla_OXA-23 gene. ISAba4 belongs to the IS982 family, is 975 bp long, possesses two 18-bp IRs, and encodes a 292-amino-acid putative transposase. No target site duplication was observed on either end of ISAba4. PCR mapping with different sets of primers did not detect any extra copy of ISAba4 downstream of the bla_OXA-23 gene. Detailed analysis of sequences located downstream of the bla_OXA-23 gene identified a 1,497-bp sequence that was identical to that identified in Tn2006, with the same gene encoding a putative AAA ATPase. This gene was truncated at its 5′ extremity, leading to a protein lacking the first 108 N-terminal amino acids. Detailed analysis of the site of truncation identified a 7-bp sequence with an A+T-rich content (TAATATA) that was also identified at the extremity of the IRR of ISAba4 (Fig. 1). This feature was very likely the signature of a transposition process mediated by ISAba4 that occurred at the origin of acquisition of the bla_OXA-23 gene. This potential transposon, termed Tn2007, was 2,471 bp long and included ISAba4 and bla_OXA-23. The ISAba4-mediated mobilization process likely corresponded to a one-ended transposition mechanism, in contrast to what has been observed with ISEcp1, which during its mobilization process uses a wide range of DNA sequences as IRRs, which are, however, not absolutely random (19, 20). In this case, the sequence identified at the right end of Tn2007 did not exhibit homology with the IRs of ISAba4. Alternatively, it could be hypothesized that a second copy of ISAba4 in a likely ISAba4-made composite transposon might have been lost by excision. At the left extremity of Tn2007, an open reading frame (ORF) (Fig. 1B, orf1) encoding 62 N-terminal amino acids sharing 68% amino acid identity with a plasmid maintenance killer protein of Photorabdus luminescens (accession no. NP_928205) was identified. At the right extremity of Tn2007, an ORF was identified that encoded 309 amino acids that shared 51% amino acid identity with a MobA/MobL mobilization protein found on the pP plasmid of Salmonella enterica serovar Enteritidis (accession no. NP_604396).

Using 5′ rapid amplification of cDNA ends-PCR (22), the sites of initiation of transcription of the bla_OXA-23 gene were mapped in both A. baumannii isolates Ab13 and Ab14, possessing ISAba1 and ISAba4, respectively, upstream of bla_OXA-23. In Ab13, the ISAba1 element was located 25 bp upstream of bla_OXA-23, and the +1 transcription start was identified 60 bp upstream of the start codon of the bla_OXA-23 gene, located inside the ISAba1 element. The corresponding promoter, made of a −35 sequence (TTAGAA) and separated by 16 bp from the −10 sequence (TTATTT), was identical to that identified previously in ISAba1, located at the origin of overexpression of the naturally occurring bla_ampC and bla_OXA-51-like genes in A. baumannii (7, 12) (Fig. 2). The ISAba4 element was located 25 bp upstream of bla_OXA-23 in Ab14, and the +1 transcription start was located 31 bp upstream of the start codon of the bla_OXA-23 gene, just inside the left IRs of ISAba4. The −35 sequence (TAACTA) and a −10 sequence (TTTCTT) separated by 17 bp acted as promoter sequences (Fig. 2).

FIG. 2.

Promoter structures for expression of the bla_OXA-23 genes of A. baumannii Ab13 (A) and Ab14 (B). The +1 initiation sites of transcription are shown in bold and underlined, and the promoter sequences are boxed. The ATG start codon of the bla_OXA-23 gene is shown in bold. The left IRs (IRL) of the ISAba1 and ISAba4 elements are shaded.

Subsequent PCR mapping was performed to evaluate the presence of these transposons in 11 bla_OXA-23-positive A. baumannii isolates, using the primers detailed in Table 2. Pulsed-field gel electrophoresis analysis revealed that the 12 isolates studied were unrelated (data not shown). In these isolates, the bla_OXA-23 gene was plasmid borne, according to the results of the Kieser technique (14) and of hybridization experiments (data not shown). Tn2006-like elements were identified in 10 of 12 isolates, whereas the 2 others harbored the Tn2007 structure.

TABLE 2.

Oligonucleotide primers used in this study

Name	Nucleotide sequence (5′→3′)	Location	No. in Fig. 1
OXA-23A	GGAATTCCATGAATAAATATTTTACTTGC	blaOXA-23	2
OXA-23B	CGGGATCCCGTTAAATAATATTCAGGTC	blaOXA-23, reverse primer	1
ISAba1A	GTGCTTTGCGCTCATCATGC	tnpA of ISAba1	3
ISAba1B	CATGTAAACCAATGCTCACC	tnpA of ISAba1, reverse primer	4
ISAba1-ext	AAGCACTTGATGGGCAAGGC	tnpA of ISAba1, external primer	5
ISAba4A	ATTTGAACCCATCTATTGGC	tnpA of ISAba4	7
ISAba4B	ACTCTCATATTTTTTCTTGG	tnpA of ISAba4, reverse primer	6

ISAba1, which enhances the expression of several unrelated resistance genes, seems to be quite an important factor of genetic plasticity in A. baumannii (25). The large distribution and high copy number of ISAba1 may facilitate the creation of composite transposons (24). On the other hand, a single copy of ISAba4 might mobilize sequences located at its right-end extremity in what is considered a one-ended transposition process (1). Further in vitro experiments are now required to establish under which conditions and at what frequency these transposition mechanisms occur. Interestingly, we have identified sequences located just downstream of the bla_OXA-23 gene possessing significant homology with those of A. baylyi. Together with the fact that ISAba1 could be considered widespread in the Acinetobacter genus, this could suggest that bla_OXA-23 originated from an Acinetobacter-like species. It could also be hypothesized that the Tn2006 putative composite transposon might have been formed in A. baumannii after a previous acquisition process not related to ISAba1.

Nucleotide sequence accession numbers.

The nucleotide sequences of the insertion elements reported in this paper have been submitted to the IS Finder website (http://www-is.biotoul.fr). The entire sequences identified and described in this study have been assigned accession no. EF127491, for Tn2006, and EF059914, for Tn2007.