Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2007 Feb 5;51(4):1487–1490. doi: 10.1128/AAC.01374-06

Molecular Epidemiology of Macrolide and Tetracycline Resistances in Commensal Gemella sp. Isolates▿

Paula Cerdá Zolezzi 1, Pilar Goñi Cepero 1, Joaquim Ruiz 2, Leticia Millán Laplana 1, Carmen Rubio Calvo 1,3, Rafael Gómez-Lus 1,*
PMCID: PMC1855484  PMID: 17283201

Abstract

The epidemiologic relatedness of 29 erythromycin-resistant Gemella sp. strains from normal flora, characterized previously, were evaluated by pulsed-field gel electrophoresis (PFGE). Three isolates carried the tet(O) gene and the tet(M) gene. The msr(A) gene was found in two Gemella morbillorum strains in combination with the erm(B) or mef(E) gene. The sequences of the mef(A/E), erm(B), and msr(A) genes showed a high similarity to the corresponding sequences of other gram-positive cocci. All the strains harboring the mef(A/E) gene and the msr(D) gene possessed open reading frame 3 (ORF3)/ORF6. The 16 G. morbillorum isolates represented 15 distinct DNA profiles. Four clusters were identified (≥80% genetic relatedness). The 12 Gemella haemolysans strains belonged to different PFGE types. The clonal diversity found suggests that horizontal transfer may be the main route through which erythromycin resistance is acquired.


Gemella morbillorum and Gemella haemolysans are commensal bacteria of the human upper respiratory tract. However, as opportunistic pathogens, gemellae are able to cause severe localized and generalized infections (7).

Little is known about the diversity and distribution of resistance genes in commensal bacteria, specially in Gemella spp., although they could play an important role as reservoirs of antibiotic resistance genes.

Previously, we have reported phenotypic and genotypic characterization of erythromycin resistance in Gemella spp. from normal flora. The presence of other resistance determinants, such as the tet(M) gene, that are often present on the same mobile genetic element were also determined (2). Although a considerable number of strains had the same phenotypic and genotypic resistance profile, information on relatedness at the genetic level was lacking. Therefore, the aim of the present work was to contribute to the knowledge of the role of commensal bacteria in the spread of antimicrobial resistance. In order to achieve this objective, the genetic similarities between erythromycin-resistant Gemella spp. from normal flora were determined by using the pulsed-field electrophoresis (PFGE) technique. The presence of other resistance genes not previously investigated was also examined.

MATERIALS AND METHODS

Bacterial strains and susceptibility testing.

Twenty-nine erythromycin-resistant Gemella strains (16 G. morbillorum strains and 13 G. haemolysans strains), isolated mainly from nasopharyngeal samples between 2001 and 2003 in the Microbiology Service of the “Lozano Blesa” Clinical University Hospital (Zaragoza, Spain), were previously studied for macrolide resistance phenotypes and genes. Macrolide resistance phenotypes were classified by the method of Seppälä et al. (15). The macrolide resistance (M) phenotype was confirmed by the induction test described by Malke (9).

Eighteen strains showed the M phenotype and possessed the mef(A) gene, nine strains had the constitutive macrolide-lincosamide-streptogramin B resistance (cMLSB) phenotype, and two strains had the inducible MLSB (iMLSB) phenotype. Streptococci showing the cMLSB or iMLSB phenotype possessed the erm(B) gene either alone or in combination with the mef(A) gene (27.3%). Six transformants of Streptococcus pneumoniae R6 strains obtained with DNA from mef(E)-containing Gemella sp. isolates were also included in this study (2).

The MICs for tetracycline (Sigma, St. Louis, MO) were determined by an agar plate dilution method according to the guidelines established by the Clinical Laboratory Standards Institute (CLSI) (3). S. pneumoniae ATCC 49619 was used as a control strain.

Genetic analysis of resistance genes.

Primers and genes used in this study are listed in Table 1. In order to complete the genetic analysis of resistance determinants, the presence of the tetracycline resistance genes tet(O) and tet(K) and the erythromycin resistance determinant msr(A) were studied by PCR amplification. The 402-bp amplicon of the msr(A) gene was digested with the HindII restriction enzyme (Sigma, St. Louis, MO), resulting in two fragments of 305 and 97 bp. For mef(A/E)-containing strains, another PCR was performed to study the presence of ORF3/ORF6 in mega and Tn1207.1 genetic elements, respectively. The PCR conditions were as follows: 35 cycles, with 1 cycle consisting of 94°C for 1 min, 50°C for 1 min, and 72°C for 1.5 min. PCR was performed with 2 mM MgCl2, 0.2 mM each deoxynucleoside triphosphate, 0.4 mM (each) primer, and 2.5 U Taq polymerase. Amplifications were performed in a Perkin-Elmer Cetus DNA thermal cycler (Perkin-Elmer, Norwalk, CT). PCR products were resolved by electrophoresis on 1.5% agarose gels.

TABLE 1.

Genes and primers used in this study

Gene(s) Primer direction Primer sequence (5′ to 3′) Annealing temp (°C) Product size (bp) Reference
tet(O) Forward AACTTAGGCATTCTGGCTCAC 50 516 11
Reverse TCCCACTGTTCCATATCGTCA
tet(K) Forward TATTTTGGCTTTGTATTCTTTCAT 50 1,159 16
Reverse GCTATACCTGTTCCCTCTGATAA
msr(A) Forward GCAAATGGTGTAGGTAAGACAACT 55 402 18
Reverse ATCATGTGATGTAAACAAAAT
mef(A/E)-ORF3/ORF6 Forward TGGTCTTGTCTATGGCTTCA 50 2,615 This study
Reverse TTTCGAGTAATCGTTTATCG
mef(A/E) Forward GAACCGAAACTATGACAGCCT 50 1,700 This study
Reverse GTCCTTTGAATTCCACACGA
mef(A/E) (sequencing) Reverse TAATCACTAGTGCCATCCTGC 50 This study

PCR amplification products of the erm(B), mef(E) (2), and msr(A) genes were purified (GFX PCR DNA and gel band purification kit; Amersham Biosciences, Freiburg, Germany) and sequenced by using the corresponding amplification primers. In addition, the mef(A) gene from G. haemolysans 68 was fully sequenced. Sequencing reactions were performed by using the DYEnamic ET dye terminator cycle sequencing kit for MegaBACE DNA analysis systems (Amersham Biosciences, Freiburg, Germany) according to the manufacturer's instructions. BLAST software was used to carry out identity searches of the GenBank database available at the website of the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov).

PFGE.

PFGE was performed as described previously (4). Briefly, genomic DNA was extracted in agarose plugs after incubation with lysozyme and proteinase K. The DNA-containing agar plugs were treated with the restriction endonuclease SmaI. The resultant DNA fragments were separated by PFGE in 1.2% agarose gels in a Gene Navigator system (Pharmacia Biotech AB, Uppsala, Sweden) with pulse times increasing from 10 to 50 s over 19 h at a voltage of 200 V. The gels were stained with ethidium bromide. Band patterns of the different gels were analyzed with the Gel Compare 3.0 program (Applied Maths, Kortrijke, Belgium) to calculate Dice coefficients of correlations and to generate a tree using the unweighted-pair group method using average linkages. A value of 80% similarity was used as a cutoff criterion for comparison of PFGE patterns.

Nucleotide sequence accession numbers.

The nucleotide sequence of G. haemolysans strain 68 mef(A) gene was assigned GenBank accession no. DQ304772, and G. haemolysans strain 244 mef(E) PCR product was assigned GenBank accession no. DQ304776. G. morbillorum strain 27 mef(E) PCR product was assigned GenBank accession no. DQ304777, and G. haemolysans 207 erm(B) PCR product was assigned GenBank accession no. DQ304775. G. morbillorum strain 141 erm(B) PCR product was assigned GenBank accession no. DQ315672, and G. morbillorum 24a msr(A) PCR product was assigned GenBank accession no. DQ304780.

RESULTS AND DISCUSSION

Of the 15 tetracycline-resistant isolates, three (G. morbillorum strains 256, 182, and 227) carried the tet(O) gene in combination with the tet(M) gene. No isolate had the tet(K) gene. The tet(O) gene has been found in different species from the oral and respiratory tracts (17), but to our knowledge this is the first report of the tet(O) gene in Gemella spp. The carriage of two tetracycline resistance determinants in G. morbillorum (MIC50, 16 μg/ml) did not increase the tetracycline MIC level in comparison with those strains that harbored only the tet(M) gene (MIC50, 16 μg/ml). These results agree with those observed by Villedieu et al. (17) in oral bacteria. However, we cannot exclude the presence of other tetracycline resistance genes that were not investigated.

The msr(A) gene was detected in G. morbillorum strains 27 and 24a. Two fragments of the expected size were obtained when the PCR products of both isolates were digested with HindII. The nucleotide sequence of the amplicon of strain 24a demonstrated a similarity of ≥99% to the sequences of the corresponding fragments of the msr(A) genes reported for Staphylococcus epidermidis (GenBank accession no. X52085.1), Staphylococcus aureus (GenBank accession no. AF167161), and Corynebacterium spp. (GenBank accession no. AY591760.1). The msr(A) gene is commonly found in staphylococci (8); therefore, its presence in Gemella spp. suggests an intergeneric exchange of genetic information. As far as we know, this is the first report of the msr(A) gene in G. morbillorum.

In order to generate more information about the molecular basis of macrolide resistance in Gemella spp., two PCR products of the erm(B) and mef(E) genes of each Gemella species and a complete mef(A) gene, previously obtained (2), were sequenced. The sequences of the mef(E) amplicons of G. morbillorum strain 27 and G. haemolysans strain 244 shared 99% identity to the sequences of the corresponding fragments of S. pneumoniae (GenBank accession no. AB011259.1 and U83667.1), G. haemolysans (GenBank accession no. AY422729.1), Granulicatella adiacens (GenBank accession no. AY422728.1), Streptococcus salivarius (GenBank accession no. AJ318993.2), Streptococcus intermedius (GenBank accession no. AY064722.1), and S. aureus (GenBank accession no. AY064721.1). The sequence of the mef(A) gene of Gemella haemolysans strain 68 demonstrated a similarity of 99% on the nucleotide level and more than 99% amino acid identity to the mef(A) sequence originally described for Streptococcus pyogenes (GenBank accession no. U70055.1) and 90% identity on the nucleotide level to the sequence of the mef(E) gene originally described for S. pneumoniae (GenBank accession no. U83667). The erm(B) PCR product sequences of G. morbillorum strain 141 and G. haemolysans strain 207 displayed 99% identity on the nucleotide level to the corresponding fragments of the erm(B) genes found in S. pyogenes (GenBank accession no. AY357120.1), S. pneumoniae (GenBank accession no. AB111455.1), S. aureus (GenBank accession no. Y13600), Enterococcus faecalis (GenBank accession no. U86375.1), and Enterococcus faecium (GenBank accession no. AF516335.1). The high similarity between the sequences of the erythromycin resistance determinants implied that there could be horizontal gene transfer of these genes among gram-positive cocci.

All the Gemella sp. isolates harboring the mef(A/E) and msr(D) genes possessed ORF3/ORF6, suggesting the presence of mega and Tn1207.1 genetic elements. Since the mef(A) gene is generally associated with Tn1207.1-related elements and the mef(E) gene is generally associated with mega-like elements (1, 6, 12, 13), it seems likely that this last genetic element would be prevalent in our isolates. This situation resembles that described for S. pneumoniae in the United States, where mega is the most prevalent (6), but is in contrast to the situation in Italy and Scotland, where Tn1207.1-related elements dominate as a result of the spread of a clone that possesses the mef(A) gene (1, 5). Besides, the presence of ORF3/ORF6 was analyzed in the six transformant strains obtained by introducing the gemellae mef(E) gene into S. pneumoniae R6. All transformant strains possessed ORF3/ORF6.

The epidemiologic relatedness of the Gemella sp. strains was analyzed by PFGE. The 16 G. morbillorum isolates represented 15 distinct DNA profiles (Fig. 1). Dendrogram analysis of the erythromycin-resistant strains identified four clusters (≥80% of genetic relatedness), each containing two isolates. Two strains had the same PFGE pattern. These isolates originated from pharyngeal exudates and sputum samples from patients in the Pediatric Service and Infectious Service of Lozano Blesa Hospital, respectively. Both strains had the same antimicrobial phenotype and genotype, except for the presence of the msr(A) gene in G. morbillorum strain 27. This suggests the dissemination of the same clone with the distinct acquisition of resistance determinants, probably due to the adaptation to different environments.

FIG. 1.

FIG. 1.

Dendrogram depicting the genetic relatedness of 16 commensal G. morbillorum isolates. Similarities are based on Dice coefficients of SmaI macrorestriction profiles demonstrated by PFGE. The 80% similarity was used as a cutoff criterion for comparison of PFGE patterns. The same antimicrobial phenotype and genotype were observed both in genetically closely and unrelated strains, i.e., strains 23 and 135. Abbreviations: S, sputum; PE, pharyngeal exudate; NS, nasal swab sample; BA, bronchial aspirate; A, adult; Ch, child; ERY, erythromycin; TET, tetracycline; MIN, minocycline; Q-D, quinupristin-dalfopristin; TEL, telithromycin.

Of the 13 G. haemolysans isolates, one was PFGE untypeable, i.e., its DNA was not digested by SmaI. The other 12 strains all belonged to different PFGE types, with homology among their PFGE patterns of <80%, except for G. haemolysans strains 68 and 174, which represented one cluster (89% genetic relatedness) (Fig. 2).

FIG. 2.

FIG. 2.

Dendrogram depicting the genetic relatedness of 12 commensal G. haemolysans isolates. Similarities are based on Dice coefficients of SmaI macrorestriction profiles demonstrated by PFGE. The 80% similarity was used as a cutoff criterion for comparison of PFGE patterns. The same antimicrobial phenotype and genotype were observed in genetically unrelated strains, i.e., strains 68, 280, and 70. Abbreviations: S, sputum; PE, pharyngeal exudate; BA, bronchial aspirate; A, adult; Ch, child; ERY, erythromycin; TET, tetracycline; MIN, minocycline; Q-D, quinupristin-dalfopristin.

The clonal diversity found in G. morbillorum and G. haemolysans strains suggests that as with other gram-positive bacterial species (10, 14, 19), horizontal transfer may be the main route through which erythromycin resistance is acquired. Specially, the high heterogeneity found in mef(E)-msr(D)-ORF3-containing strains, the evidence of their transfer by transformation and the described lack of conjugation of the mega genetic element (6, 12) suggest that transformation probably plays an important role in the transfer of mef(E)-containing elements, not only between different strains of gemellae but between these species and S. pneumoniae.

Acknowledgments

This work was supported in part by FIS PI052310 (Ministerio de Sanidad y Consumo, Instituto Aragonés de Ciencias de la Salud). P. Cerdá Zolezzi was the recipient of fellowship B102/2003 from Diputación General de Aragón, Departamento de Ciencia, Tecnología y Universidad, Spain. J. Ruiz is the recipient of grant CP05/0130 from Fondo de Investigaciones Sanitarias of Spain.

Footnotes

▿

Published ahead of print on 5 February 2007.

REFERENCES

  • 1.Amezaga, M. R., P. E. Carter, P. Cash, and H. McKenzie. 2002. Molecular epidemiology of erythromycin resistance in Streptococcus pneumoniae isolates from blood and noninvasive sites. J. Clin. Microbiol. 40:3313-3318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Cerdá Zolezzi, P., L. Millán Laplana, M. C. Rubio Calvo, P. Goñi Cepero, M. Canales Erazo, and R. Gómez-Lus. 2004. Molecular basis of resistance to macrolides and other antibiotics in commensal viridans group streptococci and Gemella spp. and its transfer to Streptococcus pneumoniae. Antimicrob. Agents Chemother. 48:3462-3467. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Clinical Laboratory Standards Institute. 2006. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically. Approved standard M7-A7. Clinical Laboratory Standards Institute, Wayne, PA.
  • 4.D'Agata, E. M., H. J. Li, C. Gouldin, and Y. W. Tang. 2001. Clinical and molecular characterization of vancomycin-resistant Enterococcus faecium during endemicity. Clin. Infect. Dis. 33:511-516. [DOI] [PubMed] [Google Scholar]
  • 5.Del Grosso, M., F. Ianelli, C. Messina, M. Santagati, N. Petrosillo, S. Stefani, G. Pozzi, and A. Pantosti. 2002. Macrolide efflux genes mef(A) and mef(E) are carried by different genetic elements in Streptococcus pneumoniae. J. Clin. Microbiol. 40:774-778. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Gay, K., and D. Stephens. 2001. Structure and dissemination of a chromosomal insertion element encoding macrolide efflux in Streptococcus pneumoniae. J. Infect. Dis. 184:56-65. [DOI] [PubMed] [Google Scholar]
  • 7.La Scola, B. D., and D. Raoult. 1998. Molecular identification of Gemella species from three patients with endocarditis. J. Clin. Microbiol. 36:866-871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Leclercq, R. 2002. Mechanisms of resistance to macrolides and lincosamides: nature of the resistance elements and their clinical implications. Clin. Infect. Dis. 34:482-492. [DOI] [PubMed] [Google Scholar]
  • 9.Malke, H. 1978. Zonal-pattern resistance to lincomycin in Streptococcus pyogenes: genetic and physical studies, p. 142-145. In D. Schlessinger (ed.), Microbiology. American Society for Microbiology, Washington, DC.651683
  • 10.Marimón, J. M., A. Valiente, M. Ercibengoa, J. M. García-Arenzana, and E. Pérez-Trallero. 2005. Erythromycin resistance and genetic elements carrying macrolide efflux genes in Streptococcus agalactiae. Antimicrob. Agents Chemother. 49:5069-5074. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Olsvik, B., I. Olsen, and F. C. Tenover. 1995. Detection of tet(M) and tet(O) using the polymerase chain reaction in bacteria isolated from patients with periodontal disease. Oral Microbiol. Immunol. 10:87-92. [DOI] [PubMed] [Google Scholar]
  • 12.Pozzi, G., F. Iannelli, M. R. Oggioni, M. Santagati, and S. Stefani. 2004. Genetic elements carrying efflux genes in streptococci. Curr. Drug Targets Infect. Disord. 4:203-206. [DOI] [PubMed] [Google Scholar]
  • 13.Santagati, M., F. Iannelli, M. Oggioni, S. Stefani, and G. Pozzi. 2000. Characterization of a genetic element carrying the macrolide efflux gene mef(A) in Streptococcus pneumoniae. Antimicrob. Agents Chemother. 44:2585-2587. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Seppälä, H., M. Haamperä, M. Al-Juhaish, H. Järvinen, J. Jalava, and P. Huovinen. 2003. Antimicrobial susceptibility patterns and macrolide resistance genes of viridans group streptococci from normal flora. J. Antimicrob. Chemother. 52:636-644. [DOI] [PubMed] [Google Scholar]
  • 15.Seppälä, H., A. Nissinen, Q. Yu, and P. Huovinen. 1993. Three different phenotypes of erythromycin-resistant Streptococcus pyogenes in Finland. J. Antimicrob. Chemother. 32:885-891. [DOI] [PubMed] [Google Scholar]
  • 16.Trzcinski, K., B. S. Cooper, W. Hryniewicz, and C. G. Dowson. 2000. Expression of resistance to tetracyclines in strains of methicillin-resistant Staphylococcus aureus. J. Antimicrob. Chemother. 45:763-770. [DOI] [PubMed] [Google Scholar]
  • 17.Villedieu, A., M. L. Diaz-Torres, N. Hunt, R. McNab, D. A. Spratt, M. Wilson, and P. Mullany. 2003. Prevalence of tetracycline resistance genes in oral bacteria. Antimicrob. Agents Chemother. 47:878-882. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Wondrack, L., M. Massa, B. V. Yang, and J. Sutcliffe. 1996. Clinical strain of Staphylococcus aureus inactivates and causes efflux of macrolides. Antimicrob. Agents Chemother. 40:992-998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Woo, P. C. Y., A. P. C. To, S. K. P. Lau, A. M. Y. Fung, and K.-Y. Yuen. 2004. Phenotypic and molecular characterization of erythromycin resistance in four isolates of Streptococcus-like gram-positive cocci causing bacteremia. J. Clin. Microbiol. 42:3303-3305. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES