Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2007 Jan 22;51(4):1223–1227. doi: 10.1128/AAC.01195-06

Prevalence of Plasmid-Mediated Quinolone Resistance Determinants QnrA, QnrB, and QnrS among Clinical Isolates of Enterobacter cloacae in a Taiwanese Hospital▿

Jiunn-Jong Wu 1, Wen-Chien Ko 2, Shu-Huei Tsai 3, Jing-Jou Yan 3,4,*
PMCID: PMC1855486  PMID: 17242140

Abstract

The prevalence of three plasmid-mediated quinolone resistance determinants, QnrA, QnrB, and QnrS, among 526 nonreplicate clinical isolates of Enterobacter cloacae collected at a Taiwanese university hospital in 2004 was determined by PCR and colony hybridization, and the association of Qnr with the IMP-8 metallo-β-lactamase was investigated. Eighty-six (16.3%) of all isolates were qnr positive, and the qnrA1-like, qnrB2-like, and qnrS1-like genes were detected alone or in combination in 3 (0.6%), 53 (10.1%), and 34 (6.5%) isolates, respectively. Among 149 putative extended-spectrum-β-lactamase-producing isolates, 59 (39.6%) isolates, all of which were SHV-12 producers, harbored qnrA (0.7%; 1 isolate), qnrB (28.9%; 43 isolates), or qnrS (12.1%; 18 isolates). Forty-four (78.6%) of 56 IMP-8 producers carried qnrB (58.9%; 33 isolates), qnrS (25.0%; 14 isolates), or both. PCR and sequence analysis revealed that qnrA1 was located in a complex sul1-type integron that contains dhr15, aadA2, qacEΔ1, sul1, orf513, qnrA1, ampR, and qacEΔ1. Conjugation experiments revealed the coexistence of qnrB and blaIMP-8 on the transferred plasmids and the absence of β-lactamase content on the transferred qnrS-positive plasmids. The transferred blaIMP-8-positive plasmids with and without qnrB had very similar restriction patterns, suggesting the horizontal mobility of qnrB. Pulsed-field gel electrophoresis showed six major patterns among the 44 qnr-positive IMP-8-producing isolates. Thus, the extremely high prevalence of qnr among the metallo-β-lactamase-producing E. cloacae isolates in the hospital may be due mainly to the intrahospital spread of a few clones and the dissemination of plasmids containing both qnrB and blaIMP-8.


Since the first plasmid-mediated quinolone resistance determinant, Qnr (later termed QnrA), was described in a Klebsiella pneumoniae strain from the United States in 1998 (17), three major groups of Qnr determinants, QnrA, QnrB, and QnrS, have been identified in various enterobacterial species (3-14, 17, 20, 22, 33, 34). Qnr determinants may protect DNA gyrase directly from quinolone inhibition, leading to an 8- to 32-fold increase in MICs of quinolones (31). qnrA has been well known for its worldwide distribution and is located in complex sul1-type class 1 integrons (12, 16, 20, 22, 28, 33). Such integrons consist of duplicate qacEΔ1 and sul1 genes, which surround a putative recombinase gene, orf513 (23). At least five qnrB and two qnrS variants have been described (1, 7-9, 11, 26), among which only qnrB2 has been found in the complex sul1-type integron (7). QnrB and QnrS have been detected in Asia, Europe, and the United States (1, 4, 8, 9, 14, 24).

In Taiwan, qnrS on a plasmid encoding the SHV-2 extended-spectrum β-lactamase (ESBL) from a K. pneumoniae strain has been described (4), and the presence of qnrA and qnrB has not been reported. The present study was conducted to determine the prevalence of the three groups of Qnr among Enterobacter cloacae isolates in a Taiwanese teaching hospital. An extraordinary high frequency of qnr among E. cloacae isolates with the IMP-8 metallo-β-lactamase (MBL) was observed, and the emergence of qnrA and qnrB in Taiwan is reported first in this work.

MATERIALS AND METHODS

Bacterial isolates.

A total of 526 nonreplicate clinical isolates of E. cloacae consecutively collected in 2004 at National Cheng Kung University Hospital were analyzed for the presence of qnr genes. Each isolate was obtained from a single patient.

Detection of qnr genes.

The qnrA, qnrB, and qnrS genes were detected by PCR with the primer sets shown in Table 1 and colony hybridization with a DIG DNA labeling and detection kit (Roche Applied Science, Mannheim, Germany) according to the manufacturer's instructions. qnrB-CS-1A and qnrB-CS-1B are consensus primers chosen from regions with high levels of sequence homology to the qnrB genes known in April 2006. Both strands of amplicons were sequenced with the same primers for PCR amplification, and all PCR experiments were performed at least twice. The qnr probes were prepared by using PCR products as the templates.

TABLE 1.

Primers used for PCR amplification

Target Primer Sequence (5′-3′) Annealing temp (°C) GenBank accession no. Nucleotide position Reference or source
blaIMP-2-like Imp2-1A GGCAGTCGCCCTAAAACAAA 55 AF322577 2045-2064 36
Imp2-2B TAGTTACTTGGCTGTGATGG AF322577 2821-2802 36
blaSHV SHV-F CGCCGGGTTATTCTTATTTGTCGC 60 X04515 215-238 21
SHV-R TCTTTCCGATGCCGCCGCCAGTCA X04515 1223-1204 21
blaTEM TEM-F ATAAAATTCTTGAAGACGAAA 60 V00613 3736-3756 15
TEM-R GACAGTTACCAATGCTTAATCA V00613 4815-4794 15
blaCTX-M-1-like M13U GGTTAAAAAATCACTGCGTC 60 X92506 65-84 29
M13L TTGGTGACGATTTTAGCCGC X92506 928-909 29
blaCTX-M-9-like M9U ATGGTGACAAAGAGAGTGCA 60 D89862 112-131 29
M9L CCCTTCGGCGATGATTCTC D89862 975-957 29
qnrA qnrA-1A TTCAGCAAGAGGATTTCTCA 55 AY070235 325-344 This study
qnrA-1B GGCAGCACTATTACTCCCAA AY070235 952-933 This study
qnrB qnrB-CS-1A CCTGAGCGGCACTGAATTTAT 60 DQ351241 138-158 This study
qnrB-CS-1B GTTTGCTGCTCGCCAGTCGA DQ351241 546-527 This study
qnrS qnrS-1A CAATCATACATATCGGCACC 60 AB187515 9748-9767 This study
qnrS-1B TCAGGATAAACAACAATACCC AB187515 10389-10369 This study
Integron Int1-6A ATAAGCCTGTTCGGTTCGTA 55 AF191564 1039-1058 37
qacE-2B GATTTTAATGCGGATGTTGCG AF191564 2350-2370 37

Susceptibility testing.

Isolates were screened for the production of ESBLs and MBLs by the double-disk synergy test and the 2-mercaptopropionic acid double-disk potentiation method, respectively, as described previously (32, 35). MICs of amikacin, ampicillin, aztreonam, cefepime, cefotaxime, ceftazidime, cephalothin, ciprofloxacin, gentamicin, imipenem, and nalidixic acid were determined by the agar dilution method according to CLSI (formerly NCCLS) guidelines (19).

β-Lactamase characterization.

The expression of β-lactamases was detected by isoelectric focusing (IEF) using an LKB Multiphor apparatus (GE Healthcare Life Sciences, Hong Kong) as described previously (18, 36). The presence of blaSHV (21), blaTEM (15), and bla genes related to blaCTX-M-1 (29), blaCTX-M-9 (29), and blaIMP-2 (36) was detected by PCR and nucleotide sequencing with previously reported oligonucleotide primers (Table 1).

PFGE.

Pulsed-field gel electrophoresis (PFGE) analysis of XbaI-digested genomic DNA was performed using a CHEF-DR 3 apparatus (Bio-Rad Laboratories, Hercules, CA) according to the instruction manual. PFGE patterns were interpreted according to criteria described previously by Tenover et al. (30). The patterns were considered to belong to the same type if there was a difference of no more than three bands.

Conjugation experiments and plasmid analysis.

Conjugation experiments were performed by the liquid mating-out assay using streptomycin-resistant Escherichia coli C600 as the recipient as described previously (25, 36). Transconjugants were selected on tryptic soy agar plates containing 512 μg of streptomycin (Sigma Chemical Co., St. Louis, MO) per ml and 8 μg of nalidixic acid (Sigma) per ml or 2 μg of ceftazidime (Glaxo Group Research, Greenford, United Kingdom) per ml. Plasmid DNA samples extracted from transconjugants were digested with the endonuclease EcoRI (Roche Applied Science). The resulting fragments were loaded onto a 0.8% agarose gel and then subjected to Southern hybridization with the digoxigenin-labeled qnr probes. The sizes of transferred plasmids were estimated by adding up restriction fragments.

Structure analysis of the qnrA-containing integron.

A qnrA-positive isolate was randomly selected for structure analysis of the qnrA-containing integron. PCR was performed with the primer pair Int1-6A and qnrA-1B and the primer pair Int1-6A and qacE-2B to amplify nucleotide sequences upstream and downstream, respectively, of qnrA (Table 1). Both strands of PCR products were sequenced by gene walking with custom sequencing primers. Nucleotide and amino acid sequences were analyzed and compared by use of the BLAST computer program (National Center for Biotechnology Information).

Nucleotide sequence accession number.

The nucleotide sequence of the qnrA-positive integron from isolate EB715/04 has been submitted to the GenBank database and assigned accession number DQ989302.

RESULTS

Prevalence of qnr genes.

The qnrA, qnrB, and qnrS genes were detected in 3 (0.6%), 53 (10.1%), and 34 (6.5%) of the isolates, respectively, by PCR and colony hybridization and were found to belong to the qnrA1, qnrB2, and qnrS1 alleles by subsequent sequencing of all PCR products. Since four isolates carried both qnrS and qnrB, the prevalence of any qnr gene was 86 (16.3%) of all isolates.

Association of qnr with MBL and ESBL production.

Among the 526 E. cloacae isolates, the phenotypic screening tests suggested MBL and ESBL production in 56 (10.6%) and 149 (28.3%) isolates, respectively. Presumptive ESBLs were detected in 46 (82.1%) of the 56 putative MBL producers. The prevalence of the three qnr genes among putative ESBL, MBL, non-ESBL, and non-MBL producers is shown in Table 2. Overall, 44 (78.6%) of the 56 putative MBL producers and 59 (39.6%) of the 149 putative ESBL producers carried any of the three qnr genes.

TABLE 2.

Distribution of qnrA, qnrB, and qnrS among ESBL-producing, MBL-producing, and non-ESBL- and non-MBL-producing E. cloacae isolates

MBL and ESBL screening test result No. of isolates No. (%) of isolates carrying:
qnrA qnrB qnrS Any qnr
ESBL+ 149 1 (0.7) 43 (28.9) 18 (12.1) 59 (39.6)
MBL+ 56 0 (0) 33 (58.9) 14 (25.0) 44 (78.6)
ESBL+, MBL− 103 1 (1.0) 20 (19.4) 5 (4.9) 25 (24.3)
ESBL−, MBL+ 10 0 (0) 10 (100) 1 (10.0) 10 (100)
ESBL+, MBL+ 46 0 (0) 23 (50.0) 13 (28.3) 34 (73.9)
ESBL−, MBL− 367 2 (0.5) 0 (0) 15 (4.1) 17 (4.6)
Total 526 3 (0.6) 53 (10.1) 34 (6.5) 86 (16.3)

The β-lactamase contents of all putative MBL producers and all qnr-positive ESBL-producing isolates were determined according to the results of IEF and PCR experiments (2, 36). The IMP-8-type MBL (pI 8.2) was detected in all 56 putative MBL producers, and the SHV-12-type ESBL (pI 8.2) was detected in all 59 qnr-positive ESBL producers. Moreover, the TEM-1-type narrow-spectrum β-lactamase (pI 5.4) was detected in all MBL producers and 11 of the 25 non-MBL-producing ESBL producers, and a pI 8.0 β-lactamase that might represent the chromosomal AmpC β-lactamase of E. cloacae was detected in all test isolates. The blaCTX-M genes were not detected by PCR. Accordingly, one of the three qnrA1-like-positive isolates expressed SHV-12; 43 (81.1%) and 33 (62.3%) of the 53 qnrB2-like-positive isolates and 18 (52.9%) and 14 (41.2%) of the 34 qnrS1-like-positive isolates produced SHV-12 and IMP-8, respectively.

PFGE.

The 44 qnr-positive IMP-8-producing isolates gave six major patterns, designated patterns I to VI, and various subtypes were observed in patterns I to IV and VI (Fig. 1). Among the 14 qnrS-positive MBL producers, all 11 isolates that were negative for qnrB belonged to pattern II; the remaining 3 isolates that were positive for qnrB belonged to three different patterns. The 33 qnrB-positive isolates belonged to five major patterns, patterns I and III to VI, and 18 of them belonged to pattern IV.

FIG. 1.

FIG. 1.

PFGE patterns of 44 qnr-positive IMP-8-producing E. cloacae isolates. Lane M, lambda ladder. The numbers of isolates that were represented by each pattern are shown below the gel.

Conjugation experiments and plasmid analysis.

The results of conjugation experiments and plasmid analysis for the 56 IMP-8-producing isolates are shown in Fig. 2 and Table 3. Five qnrS-positive transconjugants were obtained and revealed no β-lactamase activity in the IEF analysis. All qnrS-positive plasmids showed the same restriction pattern and were about 7 kb in size. Eight qnrB-positive transconjugants were obtained, and blaTEM-1, blaSHV-12, and blaIMP-8 were found to be cotransferred with qnrB. blaIMP-8-positive plasmids that were negative for any qnr gene were also obtained from 4 of 12 qnr-negative and 11 of 14 qnrS-positive isolates; these conjugable plasmids were all greater than 150 kb in size and gave 12 restriction patterns, designated B1 to B12. With only one to three band differences, the qnrB-positive plasmids with patterns B3 to B5 were very similar to the qnrB-negative plasmids with patterns B6 to B8. The qnrB probe hybridized with a 2.4-kb restricted fragment in all qnrB-positive plasmids.

FIG. 2.

FIG. 2.

EcoRI restriction patterns of conjugative plasmids. The results of Southern hybridization with the digoxigenin-labeled qnr probes are shown below the gels. Asterisks indicate the hybridized restriction fragments. Lane M1, molecular marker II (Roche Applied Science); lane M2, 1-kb molecular marker (Promega Co., Taipei, Taiwan, Republic of China). (A) Transferred qnrS-positive plasmids and hybridization with the qnrS probe. Lanes 1 and 2, restriction pattern A. (B) Transferred blaIMP-8-positive plasmids that were positive (lanes 1 to 5) and negative (lanes 6 to 12) for qnrB and hybridization with the qnrB probe. Lanes 1 to 12, restriction patterns B1 to B12.

TABLE 3.

Restriction patterns of conjugative plasmids and transferred resistance genes in conjugation experiments

Coexistent resistance gene(s) (no. of isolates)a Pattern (no. of transconjugants) of transferred plasmids containing:
blaIMP-8 and blaSHV-12 blaIMP-8, blaSHV-12, and qnrB blaIMP-8 and qnrB qnrS
blaSHV-12 (12) B7 (2), B10 (1), B11 (1)
qnrS, blaSHV-12 (11) B6 (1), B7 (7), B8 (1), B9 (1), B12 (1) A (4)
qnrB (9) B1 (1)
qnrB, blaSHV-12 (21) B2 (1), B3 (3), B4 (1), B5 (1)
qnrS, qnrB (1)
qnrS, qnrB, blaSHV-12 (2) B5 (1) A (1)
a

Coexistent qnr genes and/or blaSHV-12 with blaIMP-8 in E. cloacae isolates.

Susceptibility testing.

Of the 86 qnr-positive isolates, 100% and 43.0% were nonsusceptible (resistant or intermediately resistant) to nalidixic acid (MIC, 32 to >256 μg/ml; MIC90, >256 μg/ml) and ciprofloxacin (MIC, 0.13 to 32 μg/ml; MIC90, 16 μg/ml), respectively, and 86.0% were nonsusceptible to ceftazidime, 97.8% to cefotaxime, 33.7% to cefepime, 77.9% to aztreonam, 9.3% to imipenem, 75.6% to gentamicin, and 3.5% to amikacin. Eight imipenem-nonsusceptible isolates were all MBL producers. Among the 86 qnr-positive isolates, the 69 isolates that were positive for IMP-8 and/or SHV-12 had remarkably higher rates than the 17 isolates that were negative for MBL and ESBL in nonsusceptibilities to ceftazidime (100% versus 29.4%), cefepime (40.6% versus 5.9%), aztreonam (85.5% versus 47.1%), and gentamicin (89.9% versus 17.6%).

The five qnrS-positive and eight qnrB-positive transconjugants revealed decreased susceptibilities to nalidixic acid (MIC, 16 to 32 μg/ml) and ciprofloxacin (MIC, 0.25 to 0.5 μg/ml). All qnrB-positive transconjugants revealed resistance or decreased susceptibilities to extended-spectrum cephalosporins, imipenem, and gentamicin; all qnrS-positive transconjugants showed no decreased susceptibilities to ampicillin, cephalothin, extended-spectrum cephalosporins, and aminoglycosides (data not shown).

Structure of the qnrA1-containing integron.

Primers Int1-6A and qnrA-1B generated an approximately 5.8-kb amplicon and primers qnrA-1A and qacE-2B generated an approximately 2-kb amplicon from a qnrA-positive strain, EB715/04. Nucleotide sequencing revealed that qnrA1 was located in a complex sul1-type integron that contains dhr15, aadA2, qacEΔ1, sul1, orf513, qnrA1, ampR, and qacEΔ1. The integron and In36 of an E. coli isolate from the People's Republic of China differed only by the first gene cassette, which is the dhr16 cassette in In36 (33).

DISCUSSION

The present study demonstrated the high prevalence (16.3%) of plasmid-mediated quinolone resistance among E. cloacae isolates in a Taiwanese university hospital. The prevalence rates of qnr among putative ESBL producers (39.6%) and MBL producers (78.6%) were much higher than that among putative non-ESBL and non-MBL producers (4.6%) (Table 2). The high prevalence of qnr among E. cloacae isolates, and extended-spectrum-cephalosporin-resistant or ESBL-producing isolates in particular, has also been described in several reports (6, 22, 26). Three Qnr groups were all detected, and QnrA and QnrB are described for the first time in Taiwan in this report. Among all isolates, qnrB was the most prevalent (10.1%), followed by qnrS (6.5%); however, qnrS was the most prevalent among the putative non-ESBL and non-MBL producers. qnrA was uncommon (0.6%) in this study, and the low rates of qnrA have been observed in most surveillance studies (10, 12, 16, 20, 27). The qnrA1 gene of our isolate is also located in a complex sul1-type integron, which is different from In36 of an E. coli isolate from the People's Republic of China only in the first gene cassette (33).

Only one qnrA1-positive isolate from Australia has been reported to express an MBL (IMP-4), and this is the first report of the association of qnrB and qnrS with genes encoding MBLs. IMP-8 is an IMP-2 variant that is unique in Taiwan (36). The coexistence of the qnrB2-like gene and blaIMP-8 on the same plasmids and only five major PFGE patterns among the 33 qnrB-positive IMP-8-producing isolates suggest that the high prevalence of qnrB among MBL producers was due to the horizontal transfer of plasmids containing both qnrB and blaIMP-8 and the intrahospital spread of several clones. The high prevalence of qnrS among MBL producers may be due mainly to intrahospital spread or nosocomial outbreaks of an E. cloacae clone that carried qnrS and blaIMP-8 on different plasmids.

Previous studies showed that qnr-positive strains frequently expressed ESBLs, such as SHV-2 (4), SHV-7 (34), SHV-12 (11, 26), CTX-M-9 (22), CTX-M-14 (5), CTX-M-15 (11), and VEB-1 (16), and QnrA has also been linked to genes encoding plasmid-mediated cephalosporinases (20, 27, 34). All our qnr-positive ESBL-producing isolates carried blaSHV-12. The qnrB2-like gene was more prevalent than the qnrS1-like gene among the 149 putative ESBL producers (28.9% versus 12.1%) (Table 2). The prevalence rate of qnrS among the non-MBL-producing ESBL producers was very close to that among the non-MBL- and non-ESBL-producing isolates (4.9% versus 4.1%). Among the 18 qnrS-positive ESBL producers, 13 (72.2%) isolates were also MBL producers. Moreover, 46 of the 56 MBL producers carried blaSHV-12, and the coexistence of blaSHV-12 and blaIMP-8 on the transferred plasmids was observed as described previously (36). Thus, the finding that qnrS was common among the ESBL producers may result from the clonal spread of E. cloacae isolates that harbored plasmids with both blaSHV-12 and blaIMP-8.

Although the qnrS1 gene first reported in Taiwan was identified on a plasmid encoding the SHV-2-type ESBL (4), all transferable qnrS-positive plasmids in our isolates appeared to contain no β-lactamase gene. The restriction patterns of the transferred qnrB-positive, blaIMP-8-positive plasmids were very similar to those of qnrB-negative, blaIMP-8-positive plasmids (Fig. 2), suggesting the occurrence of horizontal mobility of the qnrB2-like gene. The qnrB2 gene has been located in a complex sul1-type integron of a Salmonella enterica serovar Keurmassar strain (7). The association of qnrS and qnrB with integrons was not found in our isolates by PCR mapping (unpublished data). The genetic mechanisms responsible for the mobility of the two qnr genes in Taiwan need further studies.

Acknowledgments

This work was supported by grant NSC89-2314-B-006-031 from the National Science Council, Taiwan.

Footnotes

▿

Published ahead of print on 22 January 2007.

REFERENCES

  • 1.Bönemann, G., M. Stiens, A. Pühler, and A. Schlüter. 2006. Mobilizable IncQ-related plasmid carrying a new quinolone resistance gene, qnrS2, isolated from the bacterial community of a wastewater treatment plant. Antimicrob. Agents Chemother. 50:3075-3080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification scheme for β-lactamases and its correlation with molecular structure. Antimicrob. Agents Chemother. 39:1211-1233. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Cambau, E., C. Lascols, W. Sougakoff, C. Bebear, R. Bonnet, J. D. Cavallo, L. Gutmann, M. C. Ploy, V. Jarlier, C. J. Soussy, and J. Robert. 2006. Occurrence of qnrA-positive clinical isolates in French teaching hospitals during 2002-2005. Clin. Microbiol. Infect. 12:1013-1020. [DOI] [PubMed] [Google Scholar]
  • 4.Chen, Y.-T., H.-Y. Shu, L.-H. Li, T.-L. Liao, K.-M. Wu, Y.-R. Shiau, J.-J. Yan, I.-J. Su, S.-F. Tsai, and T.-L. Lauderdale. 2006. Complete nucleotide sequence of pK245, a 98-kilobase plasmid conferring quinolone resistance and extended-spectrum-β-lactamase activity in a clinical Klebsiella pneumoniae isolate. Antimicrob. Agents Chemother. 50:3861-3866. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Cheung, T. K., Y. W. Chu, M. Y. Chu, C. H. Ma, R. W. Yung, and K. M. Kam. 2005. Plasmid-mediated resistance to ciprofloxacin and cefotaxime in clinical isolates of Salmonella enterica serotype Enteritidis in Hong Kong. J. Antimicrob. Chemother. 56:586-589. [DOI] [PubMed] [Google Scholar]
  • 6.Corkill, J. E., J. J. Anson, and C. A. Hart. 2005. High prevalence of the plasmid-mediated quinolone resistance determinant qnrA in multidrug-resistant Enterobacteriaceae from blood cultures in Liverpool, UK. J. Antimicrob. Chemother. 56:1115-1117. [DOI] [PubMed] [Google Scholar]
  • 7.Garnier, F., N. Raked, A. Gassama, F. Denis, and M.-C. Ploy. 2006. Genetic environment of quinolone resistance gene qnrB2 in a complex sul1-type integron in the newly described Salmonella enterica serovar Keurmassar. Antimicrob. Agents Chemother. 50:3200-3202. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Gay, K., A. Robicsek, J. Strahilevitz, C.-.H. Park, G. Jacoby, T. J. Barrett, F. Medalla, T. M. Chiller, and D. C. Hooper. 2006. Plasmid-mediated quinolone resistance in non-Typhi serotypes of Salmonella enterica. Clin. Infect. Dis. 43:297-304. [DOI] [PubMed] [Google Scholar]
  • 9.Hata, M., M. Suzuki, M. Matsumoto, M. Takahashi, K. Sato, S. Ibe, and K. Sakae. 2005. Cloning of a novel gene for quinolone resistance from a transferable plasmid in Shigella flexneri 2b. Antimicrob. Agents Chemother. 49:801-803. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Jacoby, G. A., N. Chow, and K. B. Waites. 2003. Prevalence of plasmid-mediated quinolone resistance. Antimicrob. Agents Chemother. 47:559-562. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Jacoby, G. A., K. E. Walsh, D. M. Mills, V. J. Walker, H. Oh, A. Robicsek, and D. C. Hooper. 2006. qnrB, another plasmid-mediated gene for quinolone resistance. Antimicrob. Agents Chemother. 50:1178-1182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Jeong, J.-Y., H. J. Yoon, E. S. Kim, Y. Lee, S.-H. Choi, N. J. Kim, J. H. Woo, and Y. S. Kim. 2005. Detection of qnr in clinical isolates of Escherichia coli from Korea. Antimicrob. Agents Chemother. 49:2522-2524. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Jonas, D., K. Biehler, D. Hartung, B. Spitzmüller, and F. D. Daschner. 2005. Plasmid-mediated quinolone resistance in isolates obtained in German intensive care units. Antimicrob. Agents Chemother. 49:773-775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Kehrenberg, C., S. Friederichs, A. de Jong, G. B. Michael, and S. Schwarz. 2006. Identification of the plasmid-borne quinolone resistance gene qnrS in Salmonella enterica serovar Infantis. J. Antimicrob. Chemother. 58:18-22. [DOI] [PubMed] [Google Scholar]
  • 15.Mabilat, C., and S. Goussard. 1993. PCR detection and identification of genes for extended-spectrum β-lactamases, p. 553-559. In D. H. Persing, T. F. Smith, F. C. Tenover, and T. J. White (ed.), Diagnostic molecular microbiology: principles and applications. American Society for Microbiology, Washington, DC.
  • 16.Mammeri, H., M. Van De Loo, L. Poirel, L. Martinez-Martinez, and P. Nordmann. 2005. Emergence of plasmid-mediated quinolone resistance in Escherichia coli in Europe. Antimicrob. Agents Chemother. 49:71-76. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Martínez-Martínez, L., A. Pascual, and G. A. Jacoby. 1998. Quinolone resistance from a transferable plasmid. Lancet 351:797-799. [DOI] [PubMed] [Google Scholar]
  • 18.Matthew, M., M. Harris, M. J. Marshall, and G. W. Rose. 1975. The use of analytical isoelectric focusing for detection and identification of β-lactamases. J. Gen. Microbiol. 88:169-178. [DOI] [PubMed] [Google Scholar]
  • 19.National Committee for Clinical Laboratory Standards. 2003. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, 6th ed. Approved standard M7-A6. National Committee for Clinical Laboratory Standards, Wayne, PA.
  • 20.Nordmann, P., and L. Poirel. 2005. Emergence of plasmid-mediated resistance to quinolones in Enterobacteriaceae. J. Antimicrob. Chemother. 56:463-469. [DOI] [PubMed] [Google Scholar]
  • 21.Nüesch-Inderbinen, M. T., H. Hächler, and F. H. Kayser. 1996. Detection of genes coding for extended-spectrum SHV beta-lactamases in clinical isolates by a molecular genetic method, and comparison with the E test. Eur. J. Clin. Microbiol. Infect. Dis. 15:398-402. [DOI] [PubMed] [Google Scholar]
  • 22.Paauw, A., A. C. Fluit, J. Verhoef, and M. A. Leverstein-van Hall. 2006. Enterobacter cloacae outbreak and emergence of quinolone resistance gene in Dutch hospital. Emerg. Infect. Dis. 12:807-812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Partridge, S. R., and R. M. Hall. 2003. In34, a complex In5 family class 1 integron containing orf513 and dfrA10. Antimicrob. Agents Chemother. 47:342-349. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Poirel, L., T. V. Nguyen, A. Weintraub, C. Leviandier, and P. Nordmann. 2006. Plasmid-mediated quinolone resistance determinant qnrS in Enterobacter cloacae. Clin. Microbiol. Infect. 12:1021-1023. [DOI] [PubMed] [Google Scholar]
  • 25.Provence, D. L., and R. Curtiss III. 1994. Gene transfer in gram-negative bacteria, p. 319-347. In P. Gerhardt, R. G. E. Murray, W. A. Wood, and N. R. Krieg (ed.), Methods for general and molecular bacteriology. American Society for Microbiology, Washington, DC.
  • 26.Robicsek, A., J. Strahilevitz, D. F. Sahm, G. A. Jacoby, and D. C. Hooper. 2006. qnr prevalence in ceftazidime-resistant Enterobacteriaceae isolates from the United States. Antimicrob. Agents Chemother. 50:2872-2874. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Rodríguez-Martínez, J.-M., A. Pascual, I. García, and L. Martínez-Martínez. 2003. Detection of the plasmid-mediated quinolone resistance determinant qnr among clinical isolates of Klebsiella pneumoniae producing AmpC-type β-lactamase. J. Antimicrob. Chemother. 52:703-706. [DOI] [PubMed] [Google Scholar]
  • 28.Rodriguez-Martinez, J.-M., L. Poirel, A. Pascual, and P. Nordmann. 2006. Plasmid-mediated quinolone resistance in Australia. Microb. Drug Resist. 12:99-102. [DOI] [PubMed] [Google Scholar]
  • 29.Saladin, M., V. T. B. Cao, T. Lambert, J.-L. Donay, J.-L. Herrmann, Z. Ould-Hocine, C. Verdit, F. Delisle, A. Philippon, and G. Arlet. 2002. Diversity of CTX-M β-lactamases and their promoter regions from Enterobacteriaceae isolated in three Parisian hospitals. FEMS Microbiol. Lett. 209:161-168. [DOI] [PubMed] [Google Scholar]
  • 30.Tenover, F. C., R. D. Arbeit, R. V. Goering, P. A. Mickelsen, B. E. Murray, D. H. Persing, and B. Swaminathan. 1995. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J. Clin. Microbiol. 33:2233-2239. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Tran, J. H., and G. A. Jacoby. 2002. Mechanism of plasmid-mediated quinolone resistance. Proc. Natl. Acad. Sci. USA 99:5638-5642. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Tzelepi, E., P. Giakkoupi, D. Sofianou, V. Loukova, A. Kemeroglou, and A. Tsakris. 2000. Detection of extended-spectrum β-lactamases in clinical isolates of Enterobacter cloacae and Enterobacter aerogenes. J. Clin. Microbiol. 38:542-546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Wang, M., J. H. Tran, G. A. Jacoby, Y. Zhang, F. Wang, and D. C. Hooper. 2003. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from Shanghai, China. Antimicrob. Agents Chemother. 47:2242-2248. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Wang, M., D. F. Sahm, J. A. Jacoby, and D. C. Hooper. 2004. Emerging plasmid-mediated quinolone resistance associated with the qnr gene in Klebsiella pneumoniae clinical isolates in the United States. Antimicrob. Agents Chemother. 48:1295-1299. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yan, J.-J., J.-J. Wu, S.-H. Tsai, and C.-L. Chuang. 2004. Comparison of the double-disk, combined disk, and Etest methods for detecting metallo-β-lactamases in gram-negative bacilli. Diagn. Microbiol. Infect. Dis. 49:5-11. [DOI] [PubMed] [Google Scholar]
  • 36.Yan, J.-J., W.-C. Ko, S.-H. Tsai, H.-M. Wu, and J.-J. Wu. 2001. Outbreak of infection with multidrug-resistant Klebsiella pneumoniae carrying blaIMP-8 in a university medical center in Taiwan. J. Clin. Microbiol. 39:4433-4439. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Yan, J.-J., P.-R. Hsueh, J.-J. Lu, F.-Y. Chang, W.-C. Ko, and J.-J. Wu. 2006. Characterization of acquired β-lactamases and their genetic support in multidrug-resistant Pseudomonas aeruginosa isolates in Taiwan: the prevalence of unusual integrons. J. Antimicrob. Chemother. 58:530-536. [DOI] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES