Abstract
Background and aims
The OCTN1 (SLC22A4 1672C→T) and OCTN2 (SLC22A5 −207G→C) variants within the IBD5 locus have been associated with susceptibility to adult onset Crohn's disease (CD), but their contribution in children has not been examined.
Methods
These OCTN1/2 variants and IBD5 marker single nucleotide polymorphisms (SNPs) (IGR2096a_1, IGR2198a_1, and IGR2230a_1) were examined in 299 Scottish children (200 with CD, 74 with ulcerative colitis (UC), and 25 with indeterminate colitis (IC)), together with 502 parents (for transmission disequilibrium testing) and 256 controls.
Results
All SNPs were in strong linkage disequilibrium (D′ >0.94). TDT analysis showed association of the OCTN1 variant with inflammatory bowel disease (IBD) (p = 0.01) and CD (p = 0.04). Allele frequencies of the OCTN1/2 variants were significantly higher in IBD/CD cases (p<0.04). The homozygous mutant OCTN1/2 haplotype was increased in IBD (24.3% v 16.1%, p = 0.02) and UC (28.2% v 16.1%, p = 0.02) compared with controls. The OCTN1/2 variants were not independent of the background IBD5 risk haplotype in conferring disease susceptibility. Unifactorial analysis in CD patients showed that carriage of the TC haplotype was associated with lower weight, height, and BMI centile (<9th centile) at diagnosis (weight: 87.9% v 67.3% (p = 0.002), odds ratio (OR) = 3.52 (95% confidence interval, 1.51 to 8.22); height: 84.1% v 68.4% (p<0.05), OR = 2.44 (1.00 to 5.99); BMI: 79.6% v 61.1% (p = 0.02), OR = 2.49 (1.14 to 5.44)), and lower weight centile at follow up (87.5% v 64.6% (p = 0.03), OR = 3.83 (1.03 to 14.24)). Multifactorial binary logistic regression analysis confirmed association of the TC haplotype with lower weight centile at diagnosis (p = 0.02, OR = 3.41 (1.20 to 9.66)).
Conclusions
These data implicate variants within the IBD5 haplotype, as determinants of disease susceptibility and growth indices in early onset IBD. The OCTN1/2 variants remain potential positional candidate genes, but require further analysis.
Keywords: Crohn's disease, ulcerative colitis, OCTN, IBD5, growth
The inflammatory bowel diseases (IBD) are chronic relapsing inflammatory conditions affecting the gastrointestinal tract, comprising Crohn's disease (CD), ulcerative colitis (UC), and indeterminate colitis (IC). The aetiology of IBD is unknown, although there is strong evidence for a gene–environment interaction.1 Around 15–25% of cases will present in childhood.2 The incidence of paediatric IBD in Scotland is higher than elsewhere in the United Kingdom and has increased threefold in the past 30 years.3,4,5
IBD starting in childhood can have profound effects on a child's growth, pubertal development, and education. Growth failure is a common feature of childhood IBD, particularly in Crohn's disease.6 Several factors have been linked to growth failure in Crohn's disease including delay to diagnosis,7 jejunal inflammation,8 disease severity,9 age at diagnosis,10 and genotype.11
Genome‐wide scanning in IBD has identified various susceptibility loci, with two that are particularly noteworthy in early onset disease—IBD1 and IBD5.12 The contribution of the NOD2/CARD15 gene to genetic susceptibility to Crohn's disease varies between populations. In Scotland and northern Europe this effect is significantly less strong than in many other paediatric and adult IBD populations.13
The IBD5 locus (5q31–33) was first identified in genome‐wide scanning of North American Crohn's disease patients.14,15 Rioux et al stratified the genetic data from the Canadian genome‐wide scan by age, and showed that the highest LOD (log of odds) score was found in patients with Crohn's disease diagnosed under 16 years of age.14
In a detailed study of the IBD5 locus, Daly and colleagues reported strong linkage disequilibrium across the region, and derived a risk haplotype for Crohn's disease that as represented by 11 marker single nucleotide polymorphisms (SNPs) in separate haplotype blocks that spanned the whole 250 kb interval.16 Heterozygotes for the IBD5 risk haplotype had a twofold increased risk of Crohn's disease, and homozygotes a sixfold increase, but with no increased risk of ulcerative colitis.17 Several European studies have now replicated the association of IBD5 with susceptibility to adult onset Crohn's disease,18,19,20,21 and additionally one study has shown an association with ulcerative colitis.18 Genotype–phenotype studies in adult onset disease have shown association with perianal Crohn's disease20 and earlier age of disease onset.19 IBD5 epistasis has been demonstrated with the IBD6 locus22 and with NOD2/CARD15, for both Crohn's disease19 and ulcerative colitis.18,23
Two variants within the IBD5 interval have been suggested to be independently associated with Crohn's disease; variant alleles of the OCTN1 gene (SLC22A4 C/T, missense mutation) and OCTN2 (SLC22A5 −207 G/C, promoter mutation).24 Both of these genes have been suggested to play a role in carnitine transport but critical expression and functional data in IBD patients are still awaited. In the initial publication from Peltekova and colleagues, the resulting two allele risk (TC) haplotype was independently associated with susceptibility to Crohn's disease when Crohn's disease patients and controls who were homozygous wild type for marker SNP IGR2078a_1 were compared.24 Moreover, several subsequent adult studies have been unable to confirm that the OCTN1/2 effect is independent of the other potential determinants within the extended IBD5 haplotype.25,26
In this study we have analysed the contribution to disease susceptibility and phenotype of three markers on the IBD5 haplotype, together with the OCTN1/2 variants and the TC haplotype within a large homogenous paediatric IBD population. We have specifically examined whether the OCTN1/2 effect is independent of other determinants within the IBD5 locus. In addition our detailed phenotypic data have allowed us to examine the effect of these markers on growth indices.
Methods
Patients
We recruited 299 patients with IBD diagnosed at less than 16 years of age from Scottish paediatric gastroenterology centres and from the Western General Hospital, Edinburgh. Two hundred patients had an established diagnosis of Crohn's disease, 74 ulcerative colitis, and 25 indeterminate colitis.
Parents and controls
We also enrolled 502 parents to construct family trios for transmission disequilibrium testing (TDT) (71% of the patients had complete family trios). DNA from 256 healthy adult controls was also available for case–control analysis.26
Disease phenotype
Standardised criteria were used for IBD diagnosis.27 A patient was categorised as having “indeterminate colitis” if definite evidence of chronic inflammatory bowel disease affecting the colon only was present, but the patient remained unclassifiable as either Crohn's disease or ulcerative colitis after considering all clinical, radiological, endoscopic, and pathological findings. The location and behaviour of Crohn's disease was assessed at the time of diagnosis and at two yearly intervals after diagnosis, categorised using the Vienna classification.28 Disease location in Crohn's disease was also categorised and analysed according to disease location regardless of disease involvement elsewhere in the gastrointestinal tract, as previously described.13 The use of this comprehensive complementary classification system overcomes some of the recognised limitations of the Vienna classification, notably the difficulties of categorising patients with disease involving both the upper gastrointestinal tract and other sites.29 In this classification, patients were diagnosed with Crohn's disease of the upper gastrointestinal tract (oesophagus, stomach, and duodenum) when biopsies from any of these sites confirmed the presence of epithelioid granulomas (not merely in the presence of chronic inflammation), or when features of macroscopic disease were present,30,31,32 or both. Perianal disease was defined by the presence of anal fissures, perianal abscesses, fistulae, and perianal ulcers, consistent with recommendations of Lennard‐Jones et al.27 To allow comparison with the results published by other groups,20,33 we also analysed data using the more limited definition of perianal disease applied by these investigators, who excluded anal fissures.
Data collection
Disease phenotype was determined using a combination of patient questionnaire, interview, and retrospective case note review, as previously described.13 Information collected included weight, height, and body mass index (BMI) values, which were plotted on a centile chart (© Child Growth Foundation, 1996) and an appropriate centile band allocated. Each patient had their height measured on a wall mounted stadiometer. Anthropometric data were also defined using z scores. A z score for a growth parameter indicates how far and in what direction that item deviates from its distribution's mean, expressed in units of its distribution's standard deviation. The demographics details of the patients with Crohn's disease and ulcerative colitis in the study are shown in tables 1 and 2, respectively.
Table 1 Demographic variables at the time of diagnosis in the Crohn's disease patients included in the study.
| Sex (M/F) | 121/79 |
| Median age at diagnosis (y) | 11.2 (IQR 8.6 to 13.0) |
| Current smoker | 3 (2%) |
| Family history | 68 (34%) |
| White (%) | 195 (97%) |
| Location according to the Vienna classification28 | |
| Terminal ileum (L1) | 9 (4.6%) |
| Colon (L2) | 48 (24.4%) |
| Ileocolon (L3) | 38 (19.2%) |
| Upper gastrointestinal (L4) | 93 (47.2%) |
| None* | 9 (4.6%) |
| Behaviour according to the Vienna classification28 | |
| Inflammatory (B1) | 163 (82.7%) |
| Stricturing (B2) | 7 (3.6%) |
| Penetrating (B3) | 27 (13.7%) |
| Disease location† | |
| Oral | 27/182 (14.8%) |
| Oesophageal | 7/170 (4.1%) |
| Gastric antrum | 49/168 (29.2%) |
| Gastric body | 32/167 (19.1%) |
| Duodenal | 26/167 (15.6%) |
| Jejunal | 29/165 (17.6%) |
| Ileal | 111/173 (64.2%) |
| Caecal | 108/142 (76.0%) |
| Ascending | 110/146 (75.3%) |
| Transverse | 119/156 (76.3%) |
| Descending | 125/167 (77.1%) |
| Sigmoid | 137/174 (78.7%) |
| Rectal | 139/182 (76.4%) |
| Perianal‡ | 80/190 (42.1%) |
| Perianal§ | 20/190 (10.5%) |
| Anthropometry¶ | |
| Weight <9th centile | 71/185 (38.4%) |
| Weight <25th centile | 104/185 (56.2%) |
| Height <9th centile | 46/178 (25.8%) |
| Height <25th centile | 83/178 (46.6%) |
| BMI <9th centile | 66/178 (37.1%) |
| BMI <25th centile | 92/178 (51.7%) |
| Mean weight z score (SD) | −0.68 (1.55) |
| Mean height z score (SD) | −0.48 (2.01) |
| Mean BMI z score (SD) | 0.66 (1.60) |
| Associated diseases | |
| Asthma | 58/198 (29.3%) |
| Eczema | 68/198 (34.3%) |
| Hayfever | 41/198 (20.7%) |
| All three diseases | 15/198 (7.9%) |
The phenotypic data at diagnosis are based on 197 Crohn's disease patients unless otherwise stated.
*These were patients who fulfilled the diagnostic criteria for Crohn's disease but whose disease location does not allow the use of the Vienna classification; all had perianal or oral Crohn's disease or both without evidence of disease elsewhere in the gastrointestinal tract.
†The presence or absence of evidence for Crohn's disease activity in each location was based on evidence from endoscopy, biopsy, or barium follow through and was independent of disease activity elsewhere in the gastrointestinal tract.
‡Perianal disease was defined by the presence of fissures, perianal ulcers, abscesses, or fistulae but not by the presence of skin tags alone.
§Perianal disease was defined by the presence perianal ulcers, abscesses, or fistulae but not by the presence of skin tags or fissures.
¶Based on centile plotted on UK Growth Chart (© Child Growth Foundation, 1996).
BMI, body mass index; IQR, interquartile range; y, years.
Table 2 Demographic variables at the time of diagnosis in the ulcerative colitis patients included in the study.
| Sex (M/F) | 32/37 |
| Median age at diagnosis (y) | 10.7 (IQR 8.5 to 12.9) |
| Current smoker | 1 (1.4%) |
| Family history | 20 (29.0%) |
| White (%) | 66 (95.6%) |
| Disease extent | |
| Pancolitis | 36 (52.2%) |
| Extensive colitis* | 13 (18.8%) |
| Left sided colitis† | 16 (23.2%) |
| Proctitis | 4 (5.8%) |
| Colectomy (%)‡ | 9/64 (14.1%) |
| Extraintestinal manifestations (%) | 7/67 (10.4%) |
| Anthropometric measurements§ | |
| Weight <9th centile | 11/65 (16.9%) |
| Weight <25th centile | 20/65 (30.8%) |
| Height <9th centile | 9/59 (15.2%) |
| Height <25th centile | 23/59 (39.0%) |
| BMI <9th centile | 6/59 (10.2%) |
| BMI <25th centile | 19/59 (15.2%) |
The data refer to 69 patients at disease diagnosis unless otherwise stated.
*Inflammation beyond the splenic flexure excluding patients with pancolitis.
†Inflammation distal to the splenic flexure excluding patients with proctitis.
‡The number of patients who had had a colectomy by the time of last clinic follow up.
§Based on centile plotted on UK Growth Chart (© Child Growth Foundation, 1996).
BMI, body mass index; IQR, interquartile range; y, years.
Ethical approval was given for all participating centres. All families gave informed written consent before participation in the study.
Genotyping
Genomic DNA was extracted from blood using a modified salting‐out technique,34 and resuspended in 1×TE (10 mM Tris (pH 8.0), 1 mEDTA (pH 8.0)) at a final concentration of 100 ng/μl. Three marker SNPs on the IBD5 haplotype were typed IGR2096a_1, IGR2198a_1, and IGR2230a_1. The rs1050152 polymorphism of the OCTN1 gene (SCL22A4 exon 9 1672C→T) and the rs26313667 (SLC22A5 promoter, −207G→C) polymorphism of the OCTN2 gene were also typed. The primers used in the study are given in table 3.
Table 3 Primers used to examine each of the five single nucleotide polymorphisms involved in this study.
| IGR | TaqMan primers |
|---|---|
| number | |
| IGR2096 | Forward: TCTGAGACAGGAGCCACTAGAG |
| Reverse: CACAGCATCCAGAGTGATCCT | |
| IGR2198 | Forward: GGGTTGCATGAGCATTAAGTTTCAA |
| Reverse: CCACATCAAGGATAAGACTGCTAAATACT | |
| IGR2222 | Forward: GCGGCTGGCCTTACATAGG |
| Reverse: CCGCTCTGCCTGCCA | |
| IGR2230 | Forward: GCAGGCAGAACAGCCATACT |
| Reverse: GGCCACAGAACTTTCATTAAAGTAGGA | |
| IGR3002 | Forward: TTTACAGGTGCTTACAACAGAATG |
| Reverse: TAGTCTGACTGTCCTGATTGGAATC |
The relative positions of these markers within the haplotype blocks described by Daly et al are shown in fig 1. All genotyping was carried out using the TaqMan system (©Biosystems). The three NOD2/CARD15 mutations (Leu1007InsC, G908R, and R702W) were genotyped as previously described.35
Figure 1 The relative position within the haplotype blocks of the IBD5 locus (as described by Daly et al16) of the five single nucleotide polymorphisms (SNPs) within the haplotype examined in this study. Also shown is the marker SNP IGR 2078a_1 examined in the study by Peltekova et al.24 The corresponding rs numbers are given below each SNP examined in this study. In Daly's original study, 11 separate haplotype blocks were described; the numbers shown here are the ones referred to in the original publication. IGR 2222a_1 refers to the OCTN2 variant (−207G→C) and IGR 3002a_1 refers to the OCTN1 variant (1672C→T).
Statistical analysis
Each of the five SNPs was analysed individually using allele frequencies and carriage rates for association with IBD, Crohn's disease, and ulcerative colitis. As the total number of patients with indeterminate colitis was small these data were included in IBD analysis overall and were not analysed as an individual disease group. TDT analysis was carried out using Transmit (version 2.5)36 after the Pedcheck software program was used to exclude any potential cases of non‐paternity or genotyping error.37 Genotype–phenotype relations were determined by χ2 or Fisher's exact test using Minitab v.13 (Minitab Ltd, Coventry, UK). Multifactorial analysis was done using binary logistic regression analysis. Haplotypes were calculated using Haploview, v.3.2. All SNPs in patients and controls were in Hardy–Weinberg equilibrium. We calculated z scores using a program designed by Dr C Wright (Glasgow University) and values were compared by the Mann–Whitney test. Odds ratios (OR) and 95% confidence intervals (CI) are given.
Results
Strong linkage disequilibrium was seen between the three IBD5 haplotype SNPs and the two OCTN variants (fig 2). The pairwise D′ scores for all five markers were 0.94 or above.
Figure 2 The D′ scores of the five single nucleotide polymorphisms studied across the IBD5 haplotype and the common haplotype frequencies.
Transmission disequilibrium testing analysis
These results are shown in table 4. The IGR2198a_1 allele was associated with susceptibility to IBD (p = 0.02). Homozygosity for the mutant IBD5 haplotype (patients who were homozygous mutants for all three IBD5 haplotype marker variants IGR2096a_1, IGR2198a_1, and IGR2230a_1) was associated with susceptibility to Crohn's disease (p<0.05). The OCTN1 variant was associated with susceptibility to IBD and Crohn's disease (p = 0.01 and p = 0.04, respectively). The homozygous OCTN1/2 mutant haplotype was associated with susceptibility to IBD (p = 0.01).
Table 4 Transmission disequilibrium testing results for IBD5 and OCTN variants in patients with inflammatory bowel disease.
| Mutation | IBD | CD | UC | |||
|---|---|---|---|---|---|---|
| χ2 | p Value | χ2 | p Value | χ2 | p Value | |
| IGR2230a_1 | 2.42 | 0.12 | 0.87 | 0.35 | 2.00 | 0.16 |
| IGR2198a_1 | 5.57 | 0.02 | 2.24 | 0.15 | 4.03 | 0.06 |
| IGR2096a_1 | 2.34 | 0.16 | 1.11 | 0.32 | 1.36 | 0.24 |
| IBD5 haplotype | 10.59 | 0.05 | 10.13 | <0.05 | 4.07 | 0.42 |
| OCTN1 | 7.54 | 0.01 | 4.21 | 0.04 | 3.54 | 0.06 |
| OCTN2 | 1.57 | 0.23 | 0.47 | 0.52 | 1.54 | 0.18 |
| TC haplotype | 12.92 | 0.01 | 6.59 | 0.11 | 7.72 | 0.21 |
The results were based on 293 patients with IBD, together with one or both parents (the numbers of informative trios were 271/197/74 for IBD/CD/UC, respectively). The results represented are for the allelic variants of the IBD5 marker single nucleotide polymorphisms IGR2096a_1, IGR2198a_1, and IGR2230a_1, the 1672C→T variant of the OCTN1 gene, and the −207G→C variant of the OCTN2 gene. The IBD5 haplotype in this table refers to the homozygosity for mutants of IGR2096a_1, IGR2198a_1, and IGR2230a_1 combined; the TC haplotype refers to homozygosity for the mutants of OCTN1/2 combined.
CD, Crohn's disease; IBD, inflammatory bowel disease; UC, ulcerative colitis.
Case–control analysis
Inflammatory bowel disease
The results are given in table 5. The allele frequencies were significantly higher in IBD patients for all three IBD5 SNPs and for the OCTN1/2 variants than in healthy controls (p = 0.01 to 0.04). Homozygosity rates for the IBD5 variant alleles IGR2096a_1 and IGR2198a_1, as well as homozygosity rates for the mutant TC haplotype in patients with IBD, were significantly higher than in healthy controls:
Table 5 Allele frequencies and carriage rates for variants in the IBD5 haplotype in patients with inflammatory bowel disease compared with healthy controls.
| IBD patients (n = 299) v | p Value | Odds ratio | |
|---|---|---|---|
| healthy controls (n = 256) | |||
| Allelic frequency | |||
| IGR2096a_1 | 49.6% v 42.0% | 0.01 | 1.36 (1.07 to 1.73) |
| IGR2198a_1 | 48.4% v 41.0% | 0.01 | 1.35 (1.07 to 1.72) |
| IGR2230a_1 | 53.8% v 47.5% | 0.04 | 1.29 (1.01 to 1.64) |
| OCTN 1 | 50.0% v 42.9% | 0.02 | 1.33 (1.05 to 1.69) |
| OCTN 2 | 54.5% v 47.9% | 0.03 | 1.30 (1.03 to 1.66) |
| Homozygous carriage | |||
| IGR2096a_1 | 24.4% v 15.2% | 0.008 | 1.79 (1.16 to 2.78) |
| IGR2198a_1 | 22.8% v 15.2% | 0.03 | 1.64 (1.06 to 2.54) |
| IGR2230a_1 | 27.0% v 21.2% | 0.12 | 1.38 (0.92 to 2.05) |
| TC haplotype | 24.3% v 16.1% | 0.02 | 1.67 (1.08 to 2.58) |
| Combined IBD5 carriage | 21.3% v 14.7% | 0.06 | 1.57 (0.99 to 2.49) |
Three marker single nucleotide polymorphisms (SNPs) (IGR2096a_1, IGR2198a_1, and IGR2230a_1) were used to represent the IBD5 haplotype together with two SNPs in the OCTN1 and 2 (1672C→T and −207G→C, respectively). All five SNPs were associated with susceptibility to inflammatory bowel disease (IBD). Homozygous carriage of IGR2096a_1, IGR2198a_1, and the TC haplotype were associated with susceptibility to IBD. The results for heterozygous carriage all failed to achieve significance (results not shown).
IBD, inflammatory bowel disease.
IGR2096a_1: 24.4% v 15.2% (p = 0.008), odds ratio (OR) = 1.79 (1.16 to 2.78);
IGR2198a_1: 22.8% v 15.2% (p = 0.03), OR = 1.64 (1.06 to 2.54);
mutant TC haplotype: 24.3% v 16.1% (p = 0.02), OR = 1.67 (1.08 to 2.58).
Crohn's disease
These results are shown in table 6. The frequencies of variant alleles in Crohn's disease patients compared with healthy controls were significantly higher for the variants:
Table 6 Allele frequencies and carriage rates for variants in the IBD5 haplotype in Crohn's disease patients compared with healthy controls.
| CD patients (n = 200) v | p Value | Odds ratio | |
|---|---|---|---|
| healthy controls (n = 256) | |||
| Allelic frequency | |||
| IGR2096a_1 | 49.2% v 42.0% | 0.04 | 1.34 (1.02 to 1.75) |
| IGR2198a_1 | 47.7% v 41.0% | 0.04 | 1.31 (1.01 to 1.71) |
| IGR2230a_1 | 53.8% v 47.5% | 0.06 | 1.29 (0.99 to 1.69) |
| OCTN 1 | 49.5% v 42.9% | 0.05 | 1.30 (1.00 to 1.70) |
| OCTN 2 | 54.8% v 47.9% | 0.04 | 1.32 (1.01 to 1.72) |
| Homozygous carriage | |||
| IGR2096a_1 | 23.6% v 15.2% | 0.03 | 1.72 (1.06 to 2.79) |
| IGR2198a_1 | 20.8% v 15.2% | 0.12 | 1.46 (0.90 to 2.38) |
| IGR2230a_1 | 26.9% v 21.2% | 0.16 | 1.37 (0.88 to 2.14) |
| TC haplotype | 22.2% v 16.1% | 0.11 | 1.48 (0.91 to 2.40) |
| Combined IBD5 haplotype | 19.2% v 14.7% | 0.42 | 1.38 (0.82 to 2.32) |
Three marker single nucleotide polymorphisms (SNPs) (IGR2096a_1, IGR2198a_1, and IGR2230a_1) were used to represent the IBD5 haplotype together with two SNPs in the OCTN1 and 2 (1672C→T and −207G→C, respectively). The three SNPs IGR2096a_1, IGR2198a_1, and −207G→C were associated with susceptibility to Crohn's disease. Homozygous carriage of the IGR2096a_1 was also associated with susceptibility to Crohn's disease. The results for heterozygous carriage all failed to achieve significance (results not shown).
CD, Crohn's disease.
IGR2096a_1: 49.2% v 42.0% (p = 0.04), OR = 1.34 (1.02 to 1.75);
IGR2198a_1: 47.7% v 41.0% (p = 0.04), OR = 1.31 (1.01 to 1.71);
OCTN2: 54.8% v 47.9% (p = 0.04), OR = 1.32 (1.01 to 1.72).
Homozygous carriage of mutant IGR2096a_1 was higher in Crohn's disease patients than in the controls, at 23.6% v 15.2% (p = 0.03), OR = 1.72 (1.06 to 2.79).
Ulcerative colitis
These results are shown in table 7. The frequency of the IGR2198a_1 variant allele was higher in the patients with ulcerative colitis than in the controls (50.7% v 41.0% (p = 0.04), OR = 1.48 (1.02 to 2.15)). Homozygosity for the variant alleles was higher in ulcerative colitis patients than controls, as follows:
Table 7 Allele frequencies and carriage rates for variants in the IBD5 haplotype in patients with ulcerative colitis compared with healthy controls.
| Allelic frequency | UC patients (n = 74) v | p Value | Odds ratio |
|---|---|---|---|
| healthy controls (n = 256) | |||
| IGR2096a_1 | 50.7% v 42.0% | 0.07 | 1.42 (0.97 to 2.08) |
| IGR2198a_1 | 50.7% v 41.0% | 0.04 | 1.48 (1.02 to 2.15) |
| IGR2230a_1 | 52.9% v 47.5% | 0.25 | 1.24 (0.85 to 1.81) |
| OCTN1 | 52.1% v 42.9% | 0.05 | 1.45 (1.00 to 2.10) |
| OCTN2 | 54.1% v 47.9% | 0.18 | 1.28 (0.89 to 1.86) |
| Homozygous carriers | |||
| IGR2096a_1 | 27.9% v 15.2% | 0.01 | 2.16 (1.15 to 4.05) |
| IGR2198a_1 | 26.8% v 15.2% | 0.04 | 1.92 (1.03 to 3.58) |
| IGR2230a_1 | 27.5% v 21.2% | 0.26 | 1.41 (0.77 to 2.60) |
| TC Haplotype | 28.2% v 16.1% | 0.02 | 2.04 (1.10 to 3.78) |
| Combined IBD5 haplotype | 26.6% v 14.7% | 0.02 | 2.10 (1.09 to 4.05) |
Three marker single nucleotide polymorphisms (SNPs) (IGR2096a_1, IGR2198a_1, and IGR2230a_1) were used to represent the IBD5 haplotype together with two SNPs in the OCTN1 and 2 (1672C→T and −207G→C, respectively). The SNP IGR2198a_1 was associated with susceptibility to ulcerative colitis. Homozygous carriage both of the SNPs IGR2096a_1 and IGR2198a_1 and of the TC and IBD5 haplotype was associated with susceptibility to ulcerative colitis. The results for heterozygous carriage all failed to achieve significance (results not shown).
UC, ulcerative colitis.
IGR2096a_1: 27.9% v 15.2% (p = 0.01), OR = 2.16 (1.15 to 4.05);
IGR2198a_1: 26.8% v 15.2% (p = 0.04), OR = 1.92 (1.03 to 3.58).
Homozygous carriage of the mutant TC haplotype and of a combined IBD5 haplotype (homozygosity for all three IBD5 marker SNP variants) was also higher in patients with ulcerative colitis than in controls:
mutant TC haplotype: 28.2% v 16.1% (p = 0.02), OR = 2.04 (1.10 to 3.78);
combined IBD5 haplotype: 26.6% v 14.7% (p = 0.02), OR = 2.10 (1.09 to 4.05).
Association between the OCTN1/2 TC haplotype and disease susceptibility
There was no independent association between the TC haplotype and susceptibility to IBD, Crohn's disease, or ulcerative colitis in individuals lacking the extended IBD5 risk haplotype markers (IGR2198a_1, IGR2230a_1, and IGR2096a_1) (table 8). The data shown in table 8 do not show a significant differences between IBD, Crohn's disease, or ulcerative colitis compared with controls in the carriage of the variant alleles representing the TC haplotype on a background of having no IGR2198a_1 risk alleles. Thus for Crohn's disease only four of 47 patients carried the TC haplotype but no IGR2198a_1 variants, compared with 10 of 82 IGR2198a_1 variant negative controls (p = 0.57). The same lack of association was also seen with the TC haplotype if either of the two other variants (IGR2230a_1 and IGR2096a_1) was analysed similarly, or if all three IBD5 SNPs were combined (data available on request).
Table 8 Comparison of patients and controls who are homozygous wild type for the IGR2198a_1 IBD5 haplotype marker single nucleotide polymorphism but have a risk allele in the TC haplotype.
| Subjects with no IBD5 risk alleles | Subjects with TC haplotype but no IBD5 risk alleles | |
|---|---|---|
| Controls | 82 | 10 |
| IBD patients | 72 | 5 |
| χ2 p value comparing IBD patients with controls | 0.27 | |
| CD patients | 47 | 4 |
| χ2 p value comparing CD patients with controls | 0.57 | |
| UC patients | 18 | 0 |
| χ2 p value comparing UC patients with controls | 0.20 | |
The TC haplotype does not show an independent effect on disease susceptibility of the three IBD5 marker SNPs IGR2096a_1, IGR2198a_1, and IGR2230a_1, examined either individually or when combined in patients with IBD, Crohn's disease, or ulcerative colitis compared with controls. The data shown are only for IGR2198a_1, but results for all SNPs were non‐significant and are available on request.
CD, Crohn's disease; IBD, inflammatory bowel disease; SNP, single nucleotide polymorphism; UC, ulcerative colitis.
No independent effect was demonstrated if the OCTN variants 1 and 2 were considered individually rather than as the TC haplotype (data available on request).
Epistasis with NOD2/CARD15 mutations
There was no evidence of epistasis between IBD/CD patients with regard to the TC haplotype and patients carrying the common NOD2/CARD15 mutations (Leu1007InsC, G908R, and R702W) in NOD2/CARD15 carriers v non‐carriers for IBD and Crohn's disease (70.3% v 76.8% (p = 0.39) and 71.0% v 76.9% (p = 0.49), respectively).
Genotype–phenotype analysis: unifactorial analysis
For clarity, the results presented in the genotype–phenotype analysis (table 9) describe associations with the TC haplotype only, with the exception of growth indices. The phenotypic associations with the TC haplotype generally reflected the genotype–phenotype results for all SNPs analysed across the IBD5 haplotype (all SNPs in close linkage disequilibrium). Supplementary information on the IBD5 alleles and OCTN variant alleles individually is available on request.
Table 9 Genotype–phenotype of carriage rates of the TC haplotype and homozygous TC haplotype in patients with Crohn's disease at the time of diagnosis.
| TC haplotype variants carriage rates at diagnosis | p Value | Homozygous mutant TC haplotype carriage rates at diagnosis | p Value | |
|---|---|---|---|---|
| Individual disease location* | ||||
| Oral | 79.2% v 75.3% | 0.68 | 20.8% v 18.1% | 0.75 |
| Oesophageal | 83.3% v 75.3% | 0.65 | 50% v 15.8% | 0.06 |
| Gastric antrum | 86.4% v 71.7% | 0.05 | 36.7% v 14.2% | 0.006 |
| Gastric body | 82.1% v 75.2% | 0.43 | 14.3 % v 18.2% | 0.78 |
| Duodenal | 86.9% v 74.6% | 0.19 | 26.1% v 17.5% | 0.33 |
| Jejunal | 78.6% v 76.8% | 0.84 | 17.8% v 18.2% | 0.96 |
| Ileal | 75.0% v 78.2% | 0.65 | 23.0% v 18.2% | 0.48 |
| Caecal | 75.2% v 79.3% | 0.65 | 18.8% v 17.2% | 0.84 |
| Sigmoid | 75.8% v 81.8% | 0.46 | 22.6% v 18.2% | 0.58 |
| Rectum | 77.6% v 73.7% | 0.61 | 22.4% v 23.7% | 0.86 |
| Perianal† | 78.9% v 74.0% | 0.46 | 22.5% v 22.0% | 0.93 |
| Perianal‡ | 83.3% v 75.3% | 0.59 | 27.8% v 22.2% | 0.45 |
| Weight <9th centile | 87.9% v 67.3% | 0.002 | 28.8% v 16.8% | 0.07 |
| Height <9th centile | 84.1% v 68.4% | <0.05 | 25.0% v 21.4% | 0.62 |
| BMI <9th centile | 79.6% v 61.1% | 0.02 | 27.8% v 16.8% | 0.11 |
| Location according to the Vienna classification28 | ||||
| Colonic | 77.8% v 75.9% | 0.80 | 28.9% v 21.1% | 0.28 |
| Ileal | 77.8% v 76.3% | 0.92 | 44.4% v 21.9% | 0.21 |
| Ileo‐colonic | 67.6% v 78.4% | 0.18 | 17.6% v 24.3% | 0.40 |
| Upper GI | 78.3% v 74.7% | 0.57 | 20.5% v 25.3% | 0.45 |
| None§ | 85.7% v 76.0% | 0.55 | 14.3% v 23.4% | 1 |
| Behaviour according to the Vienna classification28 | ||||
| Inflammatory | 74.8% v 83.9% | 0.28 | 22.4% v 25.8% | 0.68 |
| Stricturing | 83.3% v 76.2% | 0.68 | 16.7% v 23.3% | 1 |
| Penetrating | 84.0% v 75.2% | 0.33 | 28.0% v 22.2% | 0.52 |
| Atopic disease | ||||
| Eczema | 69.8% v 77.3% | 0.27 | 15.9% v 26.1% | 0.12 |
| Asthma | 73.1% v 75.4% | 0.74 | 11.5% v 26.9% | 0.02 |
| Hayfever | 72.5% v 75.9% | 0.66 | 7.5% v 27% | 0.009 |
| All atopy | 60.0% v 76.3% | 0.16 | 0% v 25.3% | 0.02 |
| No atopy | 75.6% v 74.5% | 0.86 | 29.1% v 17.7% | 0.07 |
The clinical features of the Crohn's disease patients included in the study comparing carriage of the TC and homozygous TC haplotype showing the percentage carriage of each phenotypic variable compared with the percentage carriage of those without the phenotypic variable. The odds ratios with 95% confidence intervals for significant results are given in the text.
*The presence or absence of evidence for Crohn's disease activity in each location was based on evidence from endoscopy, biopsy, or barium follow through and was independent of disease activity elsewhere in the gastrointestinal tract (see text).
†Perianal disease defined by the presence of fissures, perianal ulcers, abscesses, or fistulae but not by the presence of skin tags alone.
‡Perianal disease defined by the presence perianal ulcers, abscesses, or fistulae but not by the presence of skin tags or fissures.
§These were patients who fulfilled the diagnostic criteria for Crohn's disease but in whom the disease location did not fit with the Vienna classification.
BMI, body mass index.
Growth indices
A comparison was made between lowest three (<9th) centile groupings and the remaining seven (>9th) centiles for weight, height, and BMI. Carriage of the TC haplotype was more common in patients with lower weight, height, and BMI than in those in higher centiles at diagnosis of Crohn's disease:
lower weight: 87.9% v 67.3% (p = 0.002), OR = 3.52 (1.51 to 8.22);
lower height: 84.1% v 68.4% (p<0.05), OR = 2.44 (1.00 to 5.99);
lower BMI: 79.6% v 61.1% (p = 0.02), OR = 2.49 (1.14 to 5.44).
Analysis using median z scores comparing homozygous carriers of the TC haplotype with non‐carriers confirmed a significant difference between the groups in BMI (−1.32 v −0.51, p = 0.03) and for weight (−1.16 v −0.49, p = 0.05) but not for height (p = 0.89).
At two year follow up the TC haplotype was more common in lower than in higher weight centiles, at 87.5% v 64.6% (p = 0.03), OR = 3.83 (1.03 to 14.24).
Carriage of the TC haplotype showed a significance difference for weight centile (<25th centile v >25th centile): 83.0% v 65.8% (p = 0.01), OR = 2.54 (1.23 to 5.23) at diagnosis; 88.9% v 58.5% (p = 0.002), OR = 5.68 (1.75 to 18.37) at the two year follow up.
Disease location
Homozygous carriage of the TC haplotype was associated with gastric antral Crohn's disease, when comparison was made with patients assessed and found to have no antral disease at diagnosis (36.7% v 14.2% (p = 0.006), OR = 3.51 (1.40 to 8.83)).
Asthma, eczema, hayfever, and atopy
Homozygosity for the TC haplotype was less often seen in patients with asthma than in those without (11.5% v 26.9% (p = 0.02), OR = 0.35 (0.14 to 0.90)); was less common in patients with hayfever than in those without (7.5% v 27.0% (p = 0.009), OR = 0.22 (0.06 to 0.75)); and was less common in patients who had all three atopic diseases combined (asthma, eczema, and hayfever) than in those without (0% v 25.3% (p = 0.02)).
Disease behaviour and need for surgery
At Crohn's disease diagnosis and at the most recent follow up no association was seen between carriage of the TC haplotype and disease behaviour. During the period of analysis 26.9% of patients underwent abdominal surgery for Crohn's disease. Carriage of the TC haplotype was no higher in those patients needing surgery than those who did not (77.6% v 73.9% (p = 0.61)).
Age at diagnosis
The median age at diagnosis of carriers of the TC haplotype was 11.6 years (v 10.9 years for non‐carriers (p = 0.12)) and for TC homozygotes it was 12.1 years (v 11.3 years in non‐carriers (p = 0.06)).
Other phenotypic variables
No association was seen with the TC haplotype and family history of IBD, extraintestinal manifestations, granulomas, or blood test abnormalities (full blood count, erythrocyte sedimentation rate, C reactive protein, or albumin concentration).
Ulcerative colitis
Carriers of the TC haplotype were more common in patients in lower height centiles at diagnosis (<25th centile v >25th centile: 85.7% v 55.9% (p = 0.02), OR = 4.74 (1.17 to 19.16)) and showed a trend towards significance for weight centile (83.3% v 59.5% (p = 0.07), OR = 3.40 (0.85 to 13.57)). Genotype–phenotype analysis in this group was limited by the small number of patients available for analysis (n = 69). No relations were found between the TC haplotype and age at diagnosis, extraintestinal manifestations, IBD family history, need for surgery, and extent of disease (data not shown).
Multifactorial analysis
Using multifactorial binary logistic regression considering the weight centile as either less than or more than the 9th centile, disease location and behaviour as defined by the Vienna classification, family history of IBD, erythema nodosum, and gastric antral Crohn's disease, a low weight centile was predicted by carriage of the TC haplotype (p = 0.02; OR = 3.41 (1.20 to 9.66)) and the presence of antral Crohn's disease (p = 0.003; OR = 4.02 (1.58 to 10.21)).
Using a logistic regression model to compare propensity across all 11 weight centile groupings, a very strong trend towards higher carriage of the TC haplotype at lower weight centiles and lower TC haplotype carriage at higher weight centiles (p = 0.05) was apparent at Crohn's disease diagnosis. Homozygous carriers of the extended IBD5 risk haplotype (patients who were homozygous mutants for all three IBD5 haplotype markers, IGR2096a_1, IGR2198a_1, and IGR2230a_1) were more likely to lie within lower BMI centiles and less likely to be within the highest BMI centiles in a logistic regression model (p = 0.04).
Discussion
Our data provide a series of novel and important insights into the contribution of the IBD5 locus. We confirm a role in determining susceptibility to early onset Crohn's disease and report the first evidence of association in early onset ulcerative colitis. In addition, we have presented the first consistent genotype–phenotype data suggesting that these variants influence growth in both Crohn's disease and ulcerative colitis. We have shown that the OCTN1/2 variants do not act independently of variants within this region in determining susceptibility, emphasising the complexity of the IBD5 contribution.
Perhaps the unique strengths of our study lie in the robust phenotypic data that accompany the genetic data and in the size of the early onset population studied. A strong association between the IBD5 haplotype (and TC haplotype) with low weight and body mass index at diagnosis of Crohn's disease is evident, with a less significant association with height centile. The relation was demonstrated on unifactorial and multifactorial analysis for weight centile (with the TC haplotype) and for homozygosity for the extended IBD5 haplotype with BMI. Although the relation was most marked in Crohn's disease, there was a strong suggestion that it was also present in ulcerative colitis. Given the relatively small numbers of patients with ulcerative colitis, the study may have been underpowered to assess this relation fully.
Our data represent perhaps the strongest to date relating genotype to abnormal growth variables in inflammatory bowel disease. Previous paediatric studies have tried to correlate patient genotype with growth indices but overall results have been not been consistent between populations. One study has suggested variant alleles of the −238 promoter polymorphism in the TNFα gene protect patients from height retardation.10 Tomer et al showed a relation between carriage of NOD2/CARD15 variant alleles and weight below the 5th centile (but not for height; BMI was not examined) and no follow up data were presented.11 The data in Tomer's study were not subjected to multifactorial analysis; the findings have been confounded by the strong relation between NOD2/CARD15 carriers with ileal disease, which in turn is associated with lower weight at diagnosis.38 Two subsequent publications have failed to replicate these findings.9,39
In our own population, we have studied the relation of NOD2/CARD15 genotype with growth indices; no relation was found at diagnosis, while at follow up carriers of NOD2/CARD15 variant alleles were more common in a low centile band for height (2–9th) and for weight (<0.4th) only.13
There is no universally accepted definition of growth failure or good evidence of how it should be treated.40 Growth failure nevertheless remains a common problem, especially in paediatric Crohn's disease, and can persist into adult life.41 There is also evidence from prospective paediatric studies that the growth failure is “preprogrammed”, strongly suggesting a genetic influence.42 Although our data do not establish that the genotype predicts “growth failure”—because our strongest growth associations were with weight and BMI, not height—they do show that genetic markers have the potential to be used to predict growth problems, and even perhaps determine treatment strategies.
The association of markers in the IBD5 haplotype with low anthropometric centiles signifying a more severe disease phenotype are entirely consistent with our recent findings in Scottish adults with Crohn's disease.26 Possession of the variant alleles of the TC haplotype in 374 Scottish adults with Crohn's disease was associated with disease progression at follow up and, on multifactorial analysis, the need for surgery—both phenotypic variables representing a severe disease phenotype. As discussed in an accompanying editorial to our paper,43 other adult datasets may also implicate the IBD5 locus as a determinant of severe disease.
We describe a novel association of the TC haplotype with gastric antral Crohn's disease. Previous adult studies have linked possession of the TC haplotype with ileal,44 colonic,25 and perianal33 Crohn's disease, but none of these studies considered a relation with Crohn's disease of the proximal gastrointestinal tract. The establishment of such a relation gives some justification for using a phenotypic classification of Crohn's disease location in genotype–phenotype studies that is more extensive than the Vienna classification—an issue that has been intensively examined by the 2005 Montreal World congress Working Party into the classification of IBD.29 The relation of antral disease with low weight centile at diagnosis on multifactorial analysis is intriguing in the light of previous prospective paediatric studies establishing a link between jejunal Crohn's disease and low weight centile at diagnosis.8
Our data show an incidence of proximal gastrointestinal Crohn's disease that may appear high in comparison with published adult series,26 but the figures are similar to the prospective paediatric Crohn's disease studies from Europe and North America.8,45 The difference may in part reflect a different disease phenotype between paediatric and adult Crohn's disease, but may also reflect the different investigation practices of paediatric gastroenterologists who would regard routine upper gastrointestinal endoscopy at diagnosis as standard practice.30
The association between the IBD5 haplotype and susceptibility to Crohn's disease has now been clearly demonstrated in adult studies18,19,20,21,25,26 but here we present further data from an exclusive early onset population to replicate the findings in Rioux's genome‐wide scan.14 Our data represent the first paediatric study in ulcerative colitis to date and complement adult data.18 It is noteworthy that the index study from Canada may have been underpowered to assess the association between IBD5 and ulcerative colitis, as it contained only 20 families with ulcerative colitis.14 Our own dataset is considerably larger than the index study; nevertheless is relatively small for a case–control association study, and therefore the data have to be interpreted carefully because of the small number of patients compared with controls. The TC haplotype has been associated with Crohn's disease susceptibility in three adult studies,24,25,26 but no previous association has been shown with ulcerative colitis. This difference may be explained by a greater influence of the TC haplotype in early onset disease, or may indeed reflect differing disease phenotypes in the paediatric and adult ulcerative colitis populations, notably the higher proportion of paediatric patients with more extensive colitis.8,46
Despite demonstrating an association between the OCTN1/2 variants and disease susceptibility, our data do not support these variants as independent predictors of disease when the IBD5 risk markers are considered. This finding is contrary to the findings of Peltekova's study,24 but consistent with subsequent publications and presentations.25,26,47,48 These apparent inconsistencies are likely to reflect the haplotype block structure of the region as described by Daly et al (fig 1).16 The published studies to date, apart from our own studies in the Scottish IBD population, have only examined one haplotype marker, IGR2078a_1 (haplotype block 4), and explored its relation (or lack of relation) with the OCTN1/2 genes (haplotype block 7).24,25 Our study examined markers in block 4 (IGR2096a_1), block 5 (IGR2198a_1), and block 7 (IGR2230a_1), representing an extended haplotype across the region. Thus the apparently independent effect reported in Peltekova's data may reflect recombination events between haplotype block 4 and 7 in the Canadian population. This issue would be best resolved by further studies in the Canadian dataset.
Given this uncertainty about the identity of the causal gene within the IBD5 locus it remains pertinent to examine the role of other genes within the region: interleukin 4,49,50,51 interleukin 13,52 and interleukins 3 and 5, together with GMCSF, are all plausible candidate genes within the linkage interval.53,54 The protective association of the homozygous TC haplotype with asthma, hayfever, and atopy would be consistent with the evidence from genome‐wide scans that genes within the 5q31–33 region are not only important in IBD but also in asthma and atopy.55,56,57,58 Indeed, candidate genes within the 5q31–33 region, including IL12B gene59 and IL13,60 have been associated with asthma and atopy.
Conclusions
In summary, we have demonstrated evidence for genetic association between the OCTN1/2 variants within the IBD5 locus and susceptibility to inflammatory bowel disease, Crohn's disease, and ulcerative colitis. Of note, our study also describes novel and consistent phenotypic associations with low anthropometric centiles. However, the effect of the OCTN1/2 variants is not independent of the extended IBD5 region and further investigation of these and other candidate genes within the IBD5 linkage interval is necessary.
Acknowledgements
We acknowledge the help of all patients and parents who participated in the study, together with the specialist nurses, dieticians, and secretaries in each of the teaching hospitals, as well as the paediatricians, practice nurses, and GPs throughout Scotland, whose support for the study was invaluable. We would also like to thank John Rioux and Mark Daly for their advice.
The University of Edinburgh Medical Faculty Fellowship funds RKR. This study is supported by a Wellcome Trust programme grant (072789/Z/03/Z) with additional support from Schering Plough and the GI/Nutrition research fund, Child Life and Health, University of Edinburgh.
These data were presented as an oral presentation at the 36th Digestive Diseases Week in Chicago, USA, May 2005.
Abbreviations
CD - Crohn's disease
IBD - inflammatory bowel disease
IC - indeterminate colitis
SNP - single nucleotide polymorphism
UC - ulcerative colitis
Footnotes
Conflict of interest: None declared.
References
- 1.Bonen D K, Cho J H. The genetics of inflammatory bowel disease. Gastroenterology 2003124521–536. [DOI] [PubMed] [Google Scholar]
- 2.Kim S C, Ferry G D. Inflammatory bowel diseases in pediatric and adolescent patients: clinical, therapeutic, and psychosocial considerations. Gastroenterology 20041261550–1560. [DOI] [PubMed] [Google Scholar]
- 3.Sawczenko A, Sandhu B K, Logan R F.et al Prospective survey of childhood inflammatory bowel disease in the British Isles. Lancet 20013571093–1094. [DOI] [PubMed] [Google Scholar]
- 4.Armitage E, Drummond H E, Wilson D C.et al Increasing incidence of both juvenile‐onset Crohn's disease and ulcerative colitis in Scotland. Eur J Gastroenterol Hepatol 2001131439–1447. [DOI] [PubMed] [Google Scholar]
- 5.Barton J R, Gillon S, Ferguson A. Incidence of inflammatory bowel disease in Scottish children between 1968 and 1983; marginal fall in ulcerative colitis, three‐fold rise in Crohn's disease. Gut 198930618–622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Griffiths A M. Specificities of inflammatory bowel disease in childhood. Best Pract Res Clin Gastroenterol 200418509–523. [DOI] [PubMed] [Google Scholar]
- 7.Spray C, Debelle G D, Murphy M S. Current diagnosis, management and morbidity in paediatric inflammatory bowel disease. Acta Paediatr 200190400–405. [PubMed] [Google Scholar]
- 8.Sawczenko A, Sandhu B K. Presenting features of inflammatory bowel disease in Great Britain and Ireland. Arch Dis Child 200388995–1000. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Wine E, Reif S S, Leshinsky‐Silver E.et al Pediatric Crohn's disease and growth retardation: the role of genotype, phenotype, and disease severity. Pediatrics 20041141281–1286. [DOI] [PubMed] [Google Scholar]
- 10.Levine A, Shamir R, Wine E.et al TNF promoter polymorphisms and modulation of growth retardation and disease severity in pediatric Crohn's disease. Am J Gastroenterol 20051001598–1604. [DOI] [PubMed] [Google Scholar]
- 11.Tomer G, Ceballos C, Concepcion E.et al NOD2/CARD15 variants are associated with lower weight at diagnosis in children with Crohn's disease. Am J Gastroenterol 2003982479–2484. [DOI] [PubMed] [Google Scholar]
- 12.Russell R K, Wilson D C, Satsangi J. Unravelling the complex genetics of inflammatory bowel disease. Arch Dis Child 200489598–603. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Russell R K, Drummond H E, Nimmo E R.et al Genotype‐phenotype analysis in childhood‐onset Crohn's disease: NOD2/CARD15 variants consistently predict phenotypic characteristics of severe disease. Inflamm Bowel Dis 200511955–964. [DOI] [PubMed] [Google Scholar]
- 14.Rioux J D, Silverberg M S, Daly M J.et al Genomewide search in Canadian families with inflammatory bowel disease reveals two novel susceptibility loci. Am J Hum Genet 2000661863–1870. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Ma Y, Ohmen J D, Li Z.et al A genome‐wide search identifies potential new susceptibility loci for Crohn's disease. Inflamm Bowel Dis 19995271–278. [DOI] [PubMed] [Google Scholar]
- 16.Daly M J, Rioux J D, Schaffner S F.et al High‐resolution haplotype structure in the human genome. Nat Genet 200129229–232. [DOI] [PubMed] [Google Scholar]
- 17.Rioux J D, Daly M J, Silverberg M S.et al Genetic variation in the 5q31 cytokine gene cluster confers susceptibility to Crohn disease. Nat Genet 200129223–228. [DOI] [PubMed] [Google Scholar]
- 18.Giallourakis C, Stoll M, Miller K.et al IBD5 is a general risk factor for inflammatory bowel disease: replication of association with Crohn disease and identification of a novel association with ulcerative colitis. Am J Hum Genet 200373205–211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Mirza M M, Fisher S A, King K.et al Genetic evidence for interaction of the 5q31 cytokine locus and the CARD15 gene in Crohn disease. Am J Hum Genet 2003721018–1022. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Armuzzi A, Ahmad T, Ling K L. et al Genotype‐phenotype analysis of the Crohn's disease susceptibility haplotype on chromosome 5q31. Gut 2003521133–1139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Negoro K, McGovern D P, Kinouchi Y.et al Analysis of the IBD5 locus and potential gene‐gene interactions in Crohn's disease. Gut 200352541–546. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Van Heel D A, Dechairo B M, Dawson G.et al The IBD6 Crohn's disease locus demonstrates complex interactions with CARD15 and IBD5 disease‐associated variants. Hum Mol Genet 2003122569–2575. [DOI] [PubMed] [Google Scholar]
- 23.McGovern D P, Van Heel D A, Negoro K.et al Further evidence of IBD5/CARD15 (NOD2) epistasis in the susceptibility to ulcerative colitis. Am J Hum Genet 2003731465–1466. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Peltekova V D, Wintle R F, Rubin L A.et al Functional variants of OCTN cation transporter genes are associated with Crohn disease. Nat Genet 200436471–475. [DOI] [PubMed] [Google Scholar]
- 25.Torok H P, Glas J, Tonenchi L.et al Polymorphisms in the DLG5 and OCTN cation transporter genes in Crohn's disease. Gut 2005541421–1427. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Noble C L, Nimmo E R, Drummond H.et al The contribution of OCTN1/2 variants within the IBD5 locus to disease susceptibility and severity in Crohn's disease. Gastroenterology 20051291854–1864. [DOI] [PubMed] [Google Scholar]
- 27.Lennard‐Jones J E. Classification of inflammatory bowel disease. Scand J Gastroenterol 19891702–6. [DOI] [PubMed] [Google Scholar]
- 28.Gasche C, Scholmerich J, Brynskov J.et al A simple classification of Crohn's disease: report of the Working Party for the World Congresses of Gastroenterology, Vienna 1998. Inflamm Bowel Dis 200068–15. [DOI] [PubMed] [Google Scholar]
- 29.Silverberg M S, Satsangi J, Ahmad T.et al Towards an integrated clinical, molecular and serological classification of inflammatory bowel disease: report of a Working Party of the 2005 Montreal World Congress of Gastroenterology. Can J Gastroenterol 200519(suppl A)5–36. [DOI] [PubMed] [Google Scholar]
- 30.IBD Working Group of the European Society for Paediatric Gastroenterology, Hepatology and Nutrition Inflammatory bowel disease in children and adolescents: recommendations for diagnosis‐the Porto criteria. J Pediatr Gastroenterol Nutr 2005411–7. [DOI] [PubMed] [Google Scholar]
- 31.Sharif F, McDermott M, Dillon M.et al Focally enhanced gastritis in children with Crohn's disease and ulcerative colitis. Am J Gastroenterol 2002971415–1420. [DOI] [PubMed] [Google Scholar]
- 32.Kundhal P S, Stormon M O, Zachos M.et al Gastric antral biopsy in the differentiation of pediatric colitides. Am J Gastroenterol 200398557–561. [DOI] [PubMed] [Google Scholar]
- 33.Vermeire S, Pierik M, Hlavaty T.et al Association of organic cation transporter risk haplotype with perianal penetrating Crohn's disease but not with susceptibility to IBD. Gastroenterology 20051291845–1853. [DOI] [PubMed] [Google Scholar]
- 34.Miller S A, Dykes D D, Polesky H F. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988161215. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35.Arnott I D, Nimmo E R, Drummond H E.et al NOD2/CARD15, TLR4 and CD14 mutations in Scottish and Irish Crohn's disease patients: evidence for genetic heterogeneity within Europe? Genes Immun 20045417–425. [DOI] [PubMed] [Google Scholar]
- 36.Clayton D. A generalization of the transmission/disequilibrium test for uncertain‐haplotype transmission. Am J Hum Genet 1999651170–1177. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.O'Connell J R, Weeks D E. PedCheck: a program for identification of genotype incompatibilities in linkage analysis. Am J Hum Genet 199863259–266. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38.Russell R K, Satsangi J, Wilson D C. More Pediatric NOD2/CARD Data. Am J Gastroenterol 2004991401. [DOI] [PubMed] [Google Scholar]
- 39.Roesler J, Thurigen A, Sun L.et al Influence of CARD15 mutations on disease activity and response to therapy in 65 pediatric Crohn patients from Saxony, Germany. J Pediatr Gastroenterol Nutr 20054127–32. [DOI] [PubMed] [Google Scholar]
- 40.Newby E A, Sawczenko A, Thomas A G.et al Interventions for growth failure in childhood Crohn's disease. The Cochrane Database of Systematic Reviews 2005, issue 3. Art No: CD003873. DOI:10.1002/14651858.CD003873.pub2 [DOI] [PMC free article] [PubMed]
- 41.Markowitz J, Grancher K, Rosa J.et al Growth failure in pediatric inflammatory bowel disease. J Pediatr Gastroenterol Nutr 199316373–380. [DOI] [PubMed] [Google Scholar]
- 42.Motil K J, Grand R J, Davis‐Kraft L.et al Growth failure in children with inflammatory bowel disease: a prospective study. Gastroenterology 1993105681–691. [DOI] [PubMed] [Google Scholar]
- 43.Trinh T T, Rioux J D. Understanding association and causality in the genetic studies of inflammatory bowel disease. Gastroenterology 20051292106–2110. [DOI] [PubMed] [Google Scholar]
- 44.Newman B, Gu X, Wintle R.et al A risk haplotype in the solute carrier family 22A4/22A5 gene cluster influences phenotypic expression of Crohn's disease. Gastroenterology 2005128260–269. [DOI] [PubMed] [Google Scholar]
- 45.Kugathasan S, Judd R H, Hoffmann R G.et al Epidemiologic and clinical characteristics of children with newly diagnosed inflammatory bowel disease in Wisconsin: a statewide population‐based study. J Pediatr 2003143525–531. [DOI] [PubMed] [Google Scholar]
- 46.Heyman M B, Kirschner B S, Gold B D.et al Children with early‐onset inflammatory bowel disease (IBD): analysis of a pediatric IBD consortium registry. J Pediatr 200514635–40. [DOI] [PubMed] [Google Scholar]
- 47.Onnie C, Fisher S, Hampe J.et al Multiple SNPs at the IBD5 locus contribute to the risk of Crohn's disease. Gut 200554361 [Google Scholar]
- 48.Waller S, Tremelling M, Bredin F.et al Evidence for association of OCTN genes and IBD5 with ulcerative colitis [abstract]. Gastroenterology 2005128A447. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49.Klein W, Tromm A, Griga T.et al Interleukin‐4 and interleukin‐4 receptor gene polymorphisms in inflammatory bowel diseases. Genes Immun 20012287–289. [DOI] [PubMed] [Google Scholar]
- 50.Aithal G P, Day C P, Leathart J.et al Association of single nucleotide polymorphisms in the interleukin‐4 gene and interleukin‐4 receptor gene with Crohn's disease in a British population. Genes Immun 2001244–47. [DOI] [PubMed] [Google Scholar]
- 51.Karttunnen R, Breese E J, Walker‐Smith J A.et al Decreased mucosal interleukin‐4 (IL‐4) production in gut inflammation. J Clin Pathol 1994471015–1018. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52.Kadivar K, Ruchelli E D, Markowitz J E.et al Intestinal interleukin‐13 in pediatric inflammatory bowel disease patients. Inflamm Bowel Dis 200410593–598. [DOI] [PubMed] [Google Scholar]
- 53.Carvalho A T, Elia C C, de Souza H S. et al Immunohistochemical study of intestinal eosinophils in inflammatory bowel disease. J Clin Gastroenterol 200336120–125. [DOI] [PubMed] [Google Scholar]
- 54.Noguchi M, Hiwatashi N, Liu Z X.et al Increased secretion of granulocyte‐macrophage colony‐stimulating factor in mucosal lesions of inflammatory bowel disease. Digestion 200163(suppl 1)32–36. [DOI] [PubMed] [Google Scholar]
- 55.The Collaborative Study on the Genetics of Asthma A genome‐wide search for asthma susceptibility loci in ethnically diverse populations. Nat Genet 199715389–392. [DOI] [PubMed] [Google Scholar]
- 56.Xu J, Meyers D A, Ober C.et al Genomewide screen and identification of gene‐gene interactions for asthma‐susceptibility loci in three US populations: collaborative study on the genetics of asthma. Am J Hum Genet 2001681437–1446. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57.Holloway J W, Lonjou C, Beghe B.et al Linkage analysis of the 5q31–33 candidate region for asthma in 240 UK families. Genes Immun 2001220–24. [DOI] [PubMed] [Google Scholar]
- 58.Hizawa N, Freidhoff L R, Ehrlich E.et al Genetic influences of chromosomes 5q31–q33 and 11q13 on specific IgE responsiveness to common inhaled allergens among African American families. Collaborative Study on the Genetics of Asthma (CSGA). J Allergy Clin Immunol 1998102449–453. [DOI] [PubMed] [Google Scholar]
- 59.Randolph A G, Lange C, Silverman E K.et al The IL12B gene is associated with asthma. Am J Hum Genet 200475709–715. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60.Howard T D, Whittaker P A, Zaiman A L.et al Identification and association of polymorphisms in the interleukin‐13 gene with asthma and atopy in a Dutch population. Am J Respir Cell Mol Biol 200125377–384. [DOI] [PubMed] [Google Scholar]