Abstract
Background
The β chain of the interleukin 2/15 receptor (IL‐2/15Rβ) is induced by the expression of the EWS–WT1. A case of desmoplastic small round cell tumour (DSRCT) expressing only an unusual EWS‐WT1 treated by us is reported here.
Aim
To characterise an unusual form of EWS–WT1.
Methods
Frozen tissue sections of the axillary tumour were examined using a laser‐assisted microdissection technique and reverse transcriptase polymerase chain reaction.
Results
The novel fusion of exon 8 of EWS and the defective exon 10 of WT1 (−KTS) was detected. Although it was an unusual form, the coexpression of the present EWS–WT1, IL‐2/15Rβ and Janus kinase (JAK1) mRNA was detected in the tumour cells. IL‐2 and signal transducers and activators of transcription (STAT5) mRNA were detected in both tumour and stromal cells.
Conclusion
The induction of the IL‐2/15 receptor signalling pathway may contribute to tumorigenesis in DSRCT through a paracrine or an autocrine system, even though the EWS–WT1 was an unusual form.
Desmoplastic small round cell tumour (DSRCT) is a rare malignant tumour, described by Gerald and Rosai in 1989,1 found mainly in young male adolescents. Typically, the tumour presents with abdominal serosal involvement, poor prognosis and a primitive histological appearance.1,2 Genetic analysis showed a specific translocation in the Ewing's sarcoma gene (EWS) and the Wilms's tumour gene (WT1), which produces a chimeric transcriptional message.3,4 An in‐frame junction of EWS exon 7 to WT1 exon 8 has been detected in most cases of DSRCT. A comprehensive genetic analysis showed that interleukin 2/15 receptor β chain (IL‐2/15Rβ) was highly expressed in cells expressing EWS–WT1 and suggested that the IL‐2/15R signalling pathway contributed to tumorigenesis in DSRCT.5 We treated a rare DSRCT case in which the tumour cells expressed only unusual EWS–WT1. Therefore, our study aimed at evaluating the expression of IL‐2/15Rβ and its downstream mRNA and correlating it with the present EWS–WT1.
Methods
Patient
The patient was a 25‐year‐old man. A nodular lesion was identified in his left lung by a chest radiograph in 1997. In 2001, a thoracoscopic examination showed multiple nodules in his left lung. Axillary, skin and head metastases were also identified. The patient refused to undergo chemotherapy. He was followed up in the outpatient clinic, but he died in 2003. His left lung and axillary tumour were solid and well circumscribed, measuring 1.5 cm×1.5 cm and 4.0 cm×2.6 cm in size, respectively. Histopathologically, the tumour consisted of solid sheets, nests or small clumps of round or spindle cells with clear cytoplasm and intermingled rhabdoid cells, embedded in desmoplastic stroma (fig 1A). Immunohistochemically, the tumour cells were focally positive only for wide‐molecule cytokeratin, but were negative for high‐molecule and low‐molecule cytokeratins. Calretinin, neurone‐specific enolase, WT1 and vimentin were positive. Desmin, S‐100 protein and CD34 were negative.
Figure 1 (A) Microscopic image of a section stained with haematoxylin and eosin (×200). (B) Single fragment amplified by reverse transcriptase polymerase chain reaction (RT‐PCR) assay with the conventional primer pair of Ewing's sarcoma gene (EWS) exon 7 and Wilms's tumour gene (WT1) exon 10 (primer A). The DNA ladder marker (left lane) and the present desmoplastic small round cell tumour (DSRCT) sample (right lane) are shown. (C) Sequencing analysis showed that the present cDNA was composed of the fusion of exon 8 of EWS and exon 10 of WT1, and contained a 6‐bp deletion at the 5′ end of WT1 exon 10, a 1‐bp insertion and no sequence coding a Lys‐Thr‐Ser (KTS) in the junction. This aberrant sequence was also identified by the sequencing analysis with primer B. The combined sequence of inserted “c” and WT1 exon 10 was not homologous with any intronic sequences. (D) RT‐PCR with the conventional primer pair for EWS exon 7 and WT1 exon 8 (primer C) amplified only the typical EWS–WT1 in the control DSRCT (grey arrow). The present EWS–WT1 was amplified with primer B (white arrow). The lower bands in the EWS–WT1 gel for the whole tumour and the dissected tumour of the patient were not confirmed as a specific sequence. RT‐PCR assays showed the coexpression of the EWS–WT1, IL‐2, IL‐2/15Rβ, Janus kinase (JAK1) and signal transducers and activators of transcription (STAT5) mRNA. Furthermore, the present EWS–WT1, IL‐2/15Rβ and JAK1 mRNA were detected only in tumour cells, and IL‐2 and STAT5 mRNA were detected in both tumour and stromal cells. β actin mRNA was detected as an internal control.
RT‐PCR
Frozen tissue sections, 8 μm in thickness, were obtained from the axillary tumour. Tumour and stromal cells were collected separately by a laser‐assisted microdissection technique.6 Total RNA was extracted and reverse transcribed as described previously.6 PCR assays were carried out for 50 cycles at 95°C for 30 s, 60°C for 1 min and 72°C for 1 min with the primer pairs listed in table 1. RT‐PCR products were electrophoresed on a 2% agarose gel and stained with SYBR Green I (Cambrex Bio Science, Rockland, Maine, USA). Each amplified fragment of the EWS–WT1 was purified and sequencing analysis was carried out by Prism 310 genetic analyzer (Applied Biosystems Japan, Tokyo, Japan).
Table 1 DNA oligonucleotides used in RT‐PCR sequencing.
| Gene/exon | Sense/antisense | References | Sequence | Product size (bp) |
|---|---|---|---|---|
| Primer A | ||||
| EWS/exon 7 | Sense | Ladanyi and Gerald3 | 5′‐tcctacagccaagctccaagtc‐3′ | |
| WT1/exon 10 | Antisense | Ladanyi and Gerald 3 | 5′‐gccaccgacagctgaagggc‐3′ | |
| Primer B | ||||
| EWS/exon 8 | Sense | 5′‐catgagtggccctgataacc‐3′ | ||
| WT1/exon 10 | Antisense | 5′‐accgggcaaactttttctg‐3′ | ||
| Primer C | ||||
| EWS/exon 7 | Sense | Ladanyi and Gerald 3 | 5′‐tcctacagccaagctccaagtc‐3′ | |
| WT1/exon 8 | Antisense | Gerald et al2 | 5′‐accttcgttcacagtccttg‐3′ | |
| IL‐2 | Sense | 5′‐aactcaccaggatgctcaca‐3′ | ||
| Antisense | 5′‐gcacttcctccagaggtttg‐3′ | 105 | ||
| IL‐2/15Rβ | Sense | 5′‐aatggcacttcccagttcac‐3′ | ||
| Antisense | 5′‐agcagctcacaggtttggtt‐3′ | 146 | ||
| JAK1 | Sense | 5′‐ggcgtcattctccaaagaag‐3′ | ||
| Antisense | 5′‐aataggagccaggcatttca‐3′ | 140 | ||
| STAT5 | Sense | 5′‐gtcctgaagacccagaccaa‐3′ | ||
| Antisense | 5′‐gttgcgggtgttctcatttt‐3′ | 150 | ||
| β‐actin | Sense | 5′‐aaactggaacggtgaaggtg‐3′ | ||
| Antisense | 5′‐gtggcttttaggatggcaag‐3′ | 160 |
EWS, Ewing's sarcoma gene; JAK1, Janus kinase; STAT5, signal transducers and activators of transcription; WT1, Wilms's tumour gene.
Results
In the present case, the novel EWS–WT1 fusion transcript of EWS exon 8 and WT1 exon 10 without the sequence coding a Lys‐Thr‐Ser (−KTS) was identified, but the typical EWS–WT1 fusion of EWS exon 7 and WT1 exon 8 or another form of EWS–WT1 was not detected (fig 1B,C). In addition, a 6‐bp deletion at the 5′ end of WT1 exon 10 and a 1‐bp insertion in the junction of EWS–WT1 were present (fig 1C). An RT‐PCR assay with the conventional primer pair of EWS exon 7 and WT1 exon 8 amplified only the typical EWS–WT1 in the control DSRCT (fig 1D, grey arrow), but not any other EWS–WT1 in the present case. The present EWS–WT1 was amplified with the primer pair of EWS exon 8 and WT1 exon 10 (fig 1D, white arrows). In whole‐tissue sections of both typical and the present DSRCT, RT‐PCR analysis showed the coexpression of the EWS–WT1, IL‐2, IL‐2/15Rβ, JAK1 and STAT5 mRNA. Furthermore, we investigated the difference in mRNA expressions between the tumour cells and the stromal cells. Although the EWS–WT1, IL‐2/15Rβ and JAK1 mRNA were detected only in tumour cells, IL‐2 and STAT5 mRNA were detected in both tumour and stromal cells (fig 1D).
Discussion
The EWS–WT1 fusion transcripts, typically at the in‐frame junction of EWS exon 7 and WT1 exon 8, have been detected by RT‐PCR in most documented cases of DSRCT.7 Molecular variants have been reported.8,9 Although Liu et al9 have reported the fusion of EWS exons 1–5 and WT1 exon 10, this tumour also expressed the typical EWS–WT1.9 The present tumour, however, expressed only an unusual transcript between EWS exon 8 and the defective WT1 exon 10 (−KTS). RT‐PCR assays with the conventional primer pairs did not amplify any other EWS–WT1, although the typical fusion was detectable in another case. Further investigation needs to clarify whether these results occurred by the transcription error or by unusual genomic fusion. Transcriptional targets of EWS–WT1 have been analysed.5,10,11 Wong et al5 have reported that the IL‐2/15Rβ transcript was induced by EWS–WT1 directly, but not by wild‐type WT1 and EWS–WT1 including a Lys‐Thr‐Ser (+KTS), an alternative splice form of WT15 with three amino acids (KTS) between zinc fingers 3 and 4.12 The fusion of EWS exon 8 and WT1 exon 8 is frame shifted by EWS exon 8 and did not bind to the target.10 One reported case of DSRCT expressed the fusion of EWS exon 8 and WT1 exon 8, but it contained a 4‐bp deletion and a 6‐bp insertion. By this mutation, the reading frame of WT1 may have been incidentally preserved. The present tumour must have further gene mutations in EWS exons 1–8 to have preserved the reading frame of WT1 exon 10. RT‐PCR analysis, however, showed the simultaneous expression of IL‐2/15 Rβ signalling mRNA and EWS–WT1. We may suggest that the present EWS–WT1 had the effect of transcriptional activity, although its form was incomprehensible. In addition, the EWS–WT1 and IL‐2/15Rβ mRNA were coexpressed only in tumour cells and IL‐2 mRNA was expressed in both tumour and stroma cells. IL‐2 expression was not detected in DSRCT tumour cells themselves.5IL‐2 message may, however, be produced also by DSRCT tumour cells themselves.
Take‐home messages
In the desmoplastic small round cell tumour (DSRCT), novel fusion of only exon 8 of the Ewing's sarcoma gene (EWS) with the defective exon 10 of the Wilms' tumour gene (WT1) (−KTS) was detected.
Coexpression of the unusual EWS–WT1, interleukin 2/15 receptor β (IL‐2/15Rβ) and JAK1 mRNA were detected in the tumour cells. IL‐2 and STAT5 mRNA were detected in both tumour and stromal cells.
Coexpression of EWS–WT1, IL‐2/15Rβ and its downstream mRNA may suggest that the induction of the IL‐2/15 receptor signalling pathway may contribute to tumorigenesis in DSRCT through a paracrine or an autocrine system, even though the EWS–WT1 was an unusual form.
In this study, the actual transcriptional activity by the present EWS–WT1 was not clarified. Coexpression of the present EWS–WT1, IL‐2/15Rβ and its downstream mRNA, however, may suggest that the induction of the IL‐2/15R signalling pathway may contribute to tumorigenesis in DSRCT through a paracrine or an autocrine system, even though the EWS–WT1 was an unusual form.
Abbreviations
DSRCT - desmoplastic small round cell tumour
EWS - Ewing's sarcoma gene
IL‐2/15Rβ - interleukin 2/15 receptor β chain
JAK - Janus kinase
RT‐PCR - reverse transcriptase polymerase chain reaction
STAT5 - signal transducers and activators of transcription
WT1 - Wilms's tumour gene
Footnotes
Competing interests: None declared.
References
- 1.Gerald W L, Rosai J. Case2 desmoplastic small round cell tumor with divergent differentiation. Pediatr Pathol 19899177–183. [DOI] [PubMed] [Google Scholar]
- 2.Gerald W L, Miller H K, Battifora H.et al Intra‐abdominal desmoplastic small round‐cell tumor. Report of 19 cases of a distinctive type of high‐grade polyphenotypic malignancy affecting young individuals. Am J Surg Pathol 199115499–513. [PubMed] [Google Scholar]
- 3.Ladanyi M, Gerald W. Fusion of the EWS and WT1 genes in the desmoplastic small round cell tumor. Cancer Res 1994542837–2840. [PubMed] [Google Scholar]
- 4.Gerald W L, Rosai J, Ladanyi M. Characterization of the genomic breakpoint and chimeric transcripts in the EWS‐WT1 gene fusion of desmoplastic small round cell tumor. Proc Natl Acad Sci USA 1995921028–1032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Wong J C, Lee S B, Bell M D.et al Induction of the interleukin 2/15 receptor β‐chain by the EWS‐WT1 translocation product. Oncogene 2002212009–2019. [DOI] [PubMed] [Google Scholar]
- 6.Nakanishi Y, Mizutani G, Sano M.et al Comparison of HER2 mRNA amplification with immunohistochemistry in human breast cancer using laser assisted microdissection technique. Acta Histochem Cytochem 20043773–79. [Google Scholar]
- 7.Lae M E, Roche P C, Jin L.et al Desmoplastic small round cell tumor—a clinicopathologic, immunohistochemical, and molecular study of 32 tumors. Am J Surg Pathol 200226823–835. [DOI] [PubMed] [Google Scholar]
- 8.Antonescu C R, Gerald W L, Magid M S.et al Molecular variants of the EWS‐WT1 gene fusion in desmoplastic small round cell tumor. Diagn Mol Pathol 1998724–28. [DOI] [PubMed] [Google Scholar]
- 9.Liu J, Nau M M, Yeh J C.et al Molecular heterogeneity and function of EWS‐WT1 fusion transcripts in desmoplastic small round cell tumors. Clin Cancer Res 200063522–3529. [PubMed] [Google Scholar]
- 10.Karnieli E, Werner H, Rauscher FJ I I I.et al The IGF‐I receptor gene promoter is a molecular target for the Ewing's sarcoma‐Wilms' tumor 1 fusion protein. J Biol Chem 199627119304–19309. [DOI] [PubMed] [Google Scholar]
- 11.Lee S B, Kolquist K A, Nichols K.et al The EWS‐WT1 translocation product induces PDGFA in desmoplastic small round‐cell tumour. Nat Genetics 199717309–313. [DOI] [PubMed] [Google Scholar]
- 12.Rauscher FJ I I I, Morris J F, Tournay O E.et al Binding of the Wilms' tumor locus zinc finger protein to the EGR‐1 consensus sequence. Science 19902501259–1262. [DOI] [PubMed] [Google Scholar]