Skip to main content
Journal of Clinical Microbiology logoLink to Journal of Clinical Microbiology
. 2007 Feb 28;45(5):1515–1522. doi: 10.1128/JCM.02189-06

Multiple Genotypes of Influenza B Viruses Cocirculated in Taiwan in 2004 and 2005▿

Guang-Wu Chen 1,2,5,†, Shin-Ru Shih 1,3,4,5,†, Mei-Ren Hsiao 3,4, Shih-Cheng Chang 1,3,4,5, Shu-Hung Lin 2, Chien-Fen Sun 3,4, Kuo-Chien Tsao 1,3,4,5,*
PMCID: PMC1865862  PMID: 17329451

Abstract

An influenza B outbreak occurred in Taiwan in 2004 and 2005, during which both Victoria (Vic) and Yamagata (Ya) lineages cocirculated. This study examined 36 influenza B viral genomes isolated during the outbreak to reveal their reassortment patterns. According to the isolate groupings in phylogenetic analysis, we were able to categorize those 36 isolates as being of either the Victoria or Yamagata lineage for all eight influenza B virus genomic segments, except for the NS gene, in which clades A and B existed. Based on these groupings, three genome patterns clearly emerged, namely, pattern I (Vic+Vic+Ya+Vic+Ya+Ya+Ya+A, from segments 1 to 8), pattern II (Ya+Ya+Ya+Ya+Ya+Ya+Ya+B), and pattern III (Ya+Ya+Ya+Ya+Ya+Ya+Ya+A). According to the timeline of those isolates under investigation, it appears that pattern I and II viruses could have generated pattern III via reassortment of the NS gene. On the other hand, a genomewide comparison of all six pattern III Taiwanese viruses with 37 international influenza B viral genomes showed that two international strains, B/Oslo/71/04 and B/England/23/04, were consistently clustered with the pattern III viruses isolated in Taiwan in 2004 and 2005, suggesting that Taiwanese pattern III viruses might also have been imported due to their matching genomic composition.


Belonging to the Orthomyxoviridae family, influenza B virus contains a single-stranded, negative-sense, segmented genome. The eight gene segments that code for 11 proteins are as follows: segments 1, 2, and 3 code for the polymerase proteins PB2, PB1, and PA; segment 4 codes for hemagglutinin (HA); segment 5 codes for the nucleoprotein NP; segment 6 codes for the neuraminidase (NA) and an integral membrane protein, NB; segment 7 codes for the matrix protein M1 and another BM2 protein with unclear function; and segment 8 codes for the nonstructural protein NS1 and a nuclear export protein, NS2 (also called NEP) (3). No antigenic shift has ever been detected in influenza B viruses, and no subtype divisions of surface antigens exist, as seen in influenza A viruses. The evolution of influenza B viruses has long been characterized by cocirculation of antigenically and genetically distinct lineages for extended periods of time. Two lineages, as defined by the phylogenetic relationship of the HA gene, have diverged since 1983 (2). One lineage, B/Victoria/2/87, is known as the “Victoria lineage” (Vic87), whereas the other, an antigenic variant B/Yamagata/16/88 strain that emerged in 1988, is known as the “Yamagata lineage” (Yam88) (9). Each of these two viruses achieves predominance at different times and in different geographical regions, as indicated by recommendations for inclusion in influenza vaccines (10). Since 1991, viruses of the Vic87 lineage have been infrequently isolated in Africa, America, and Europe, but have continued to circulate in Asia and have been the predominant influenza B virus in certain Asian countries for years. The segmented genome of influenza viruses allows genetic exchange to occur via a process called reassortment. Reassortment occurs frequently among influenza B viruses and likely allows unrestricted lineage mixing (4). An influenza B outbreak occurred in Taiwan during the 2004 and 2005 influenza season, in which both Vic87 and Yam88 lineages cocirculated (12). In addition to analyzing 36 influenza B viral genomes isolated during the outbreak to identify their reassortment patterns, this study examines their genetic characteristics when both Vic87 and Yam88 lineages were cocirculating.

MATERIALS AND METHODS

Specimen collection and transportation.

Clinical isolates from patients with symptoms of respiratory tract infections, including coughing, sore throat, tonsillitis, pharyngitis, pneumonia, and bronchiolitis, were obtained from Chang Gung Memorial Hospital. Throat or nasopharyngeal swabs were collected and placed in transport medium containing 2 ml Eagle's minimum essential medium (pH 7.2) with gelatin (5 mg/liter), penicillin (400 U/liter), streptomycin (400 μg/liter), gentamicin (50 μg/liter), and amphotericin B (Fungizone) (1.25 μg/liter). Specimens were placed on ice and transported to the Clinical Virology Laboratory at Chang Gung Memorial Hospital within 24 h after collection.

Virus isolation and identification.

Respiratory specimens were inoculated into Madin-Darby canine kidney cells. Influenza viruses were typed using an immunofluorescent assaywith type-specific monoclonal antibodies (Chemicon International, Inc., Temecula, CA).

RNA extraction and RT-PCR.

Viral RNA was extracted using a viral RNA extraction Miniprep system kit (Viogene, Sunnyvale, CA). Briefly, 300 μl culture medium was mixed with 700 μl RNA extraction virus buffer. After sitting at room temperature for 10 min, 700 μl 100% ethanol was added to the mixture. The whole mixture was then applied to the spin column, followed by addition of 650 μl washing solution buffer. The RNA was eluted in 50 μl RNA-free H2O, from which 6 μl RNA was used as the template. The Reverse iT one-step reverse transcription-PCR (RT-PCR) kit (Abgene, Epsom, Surrey, United Kingdom) was used with 25 μl reaction mixture under the following conditions: 0.5 μl of kit-supplied enzyme mixture, 1 μl of 10 μM of each primer, 12.5 μl of 2× RT-PCR master mix, and 6 μl RNA template. The following RT-PCR program was used for the PB2, HA, NP, M, and NS genes: 42°C for 1 h and 94°C for 4 min, followed by 40 cycles of 94°C for 30 s, 58°C for 30 s, and 72°C for 5 min, and with a final elongation step of 72°C for 10 min. The same RT-PCR conditions were used for NA and PA genes, except the annealing temperature was reduced to 55°C. Also, the same RT-PCR conditions were utilized for the PB1 gene, except the annealing temperature was decreased to 50°C. Final products were stored at 4°C and analyzed by gel electrophoresis on 1% agarose gel containing 2 μg/ml ethidium bromide. The DNA bands were visualized and photographed via UV transillumination. Table 1 lists the primer sets used for specific target gene amplification by RT-PCR.

TABLE 1.

Primer sets used in specific gene amplification by RT-PCR

Gene Primer name Sequence (5′ to 3′)a Locationb Size (bp)
PB2 PB2-F-34 AGCAGAAGCAGAGCATCTTC 34-709 676
PB2-R-709 CGATGCARTTGCAGGCACTT
PB1 PB1-F-31 ATCCWTATTTTCTYTTCATAGATGT 31-1228 1,198
PB1-R-1228 GATGCHGTTCCTTCTTCATTGAAG
PA PA-F-289 CAAGAGCATGGAATAGAGACTCC 289-1324 1,036
PA-R-1324 AGTATTTYCTTCTTTCACTCCCT
HA HA-F-97 ATAACATCGTCAAACTCACC 97-1321 1,225
HA-R-1321 CACCRCTTAGTCTTTGAAG
NP NP-F-544 ACCATCTACTTCAGCCCTATAA 544-1711 1,168
NP-R-1711 CTGTGTCCCTCCCAAAGAAGAAA
M M-F-26 TGTCGCTGTTTGGAGACACAA 26-1157 1,132
M-R-1157 CYGACATTGAKTACAATTTGCTT
NS NS-F-64 ACACAAATYGAGGTGGGTCC 64-1050 987
NS-R-1050 CTGTACACTTCAACCACATC
NA NA1-F-1 AGCAGAAGCAGAGCATCTTC 1-750 750
NA1-R-750 CGATGCARTTGCAGGCACTT
NA2-F-621 TATATCGGAGTTGATGG 621-1049 429
NA2-R-1049 GCTTCCATCATYTGGTCTGG
NA3-F-910 CCATAGAATGTGCCTGTAGAG 910-1557 648
NA3-R-1557 AGTAGTAACAAGAGCATTTTTC
a

Key to degenerated nucleotides: R = A+G, W = A+T, K = G+T, Y = C+T, and H = A+T+C.

b

Based on nucleotide position of coding sequences from B/Lee/40.

Nucleotide sequence analysis.

The nucleotide sequence of the purified fragments was determined using an automated ABI 3730 DNA sequencer (PE-Applied Biosystems, Foster City, CA). Sequence assembly was performed using EditSeq in Lasergene software, version 3.18 (DNASTAR, Madison, WI) (1). Pairwise sequence identities were computed by the NEEDLE program in the EMBOSS software package (8). Multiple sequence alignment was conducted using Clustal W, version 1.83 (11). Phylogenetic analysis was performed using PHYLIP (6, 7), version 3.63, with a Kimura two-parameter distance matrix (program DNADIST) and the neighbor-joining method (NEIGHBOR program). Support for tree topology was determined via bootstrap analysis with 1,000 pseudoreplicate data sets generated using the SEQBOOT program in PHYLIP. A consensus tree was obtained utilizing the CONSENSE program in PHYLIP, and the topology was viewed with TreeView, version 1.6.6 (5). Partial nucleotide sequences under investigation were as follows: PB2, 49 to 693; PB1, 121 to 1147; PA, 370 to 1117, HA, 238 to 945, NP, 796 to 1596; NA, 40 to 1398; M, 64 to 1059; and NS, 73 to 843, according to coding sequences of B/Hong Kong/330/01.

Nucleotide sequence accession number.

The nucleotide sequence data reported in this work have been deposited in the GenBank nucleotide sequence database under accession no. EF041529 to EF041816.

RESULTS AND DISCUSSION

In total, 121 influenza B viruses were isolated in Clinical Virology Laboratory during the outbreak of December 2004 to April 2005, including 74 Victoria-like and 47 Yamagata-like strains according to their HA nucleotide sequences. As both lineages were cocirculating, the question arose as to whether a genetic reassortment occurred during that outbreak. Partial nucleotide sequences from all eight genomic segments of 20 randomly selected Taiwanese isolates were obtained and analyzed during the outbreak (December 2004 to April 2005). Furthermore, six isolates that represent the first monthly isolate in the preceding 6 months (May 2004 to November 2004) were included in the analysis, in addition to 10 isolates that represent the first monthly isolate in the previous four influenza seasons (May 2000 to February 2004). Phylogenetic analysis of eight gene segments of those 36 Taiwanese isolates (listed in Table 2), together with B/Lee/40 (used as an outgroup node for phylogenetic inference), B/Victoria/2/87, and B/Yamagata/16/88, is shown in Fig. 1. According to the grouping of isolates to either Victoria-like or Yamagata-like clusters, the isolates were labeled “Vic” or “Ya” (Table 2). For the NS gene, 36 Taiwanese isolates were grouped to neither Victoria-like nor Yamagata-like clusters and were assigned to clade A or B based on the tree topology (Fig. 1).

TABLE 2.

Influenza B viruses used for genome analysis

Phylogenetic group Straina Time of isolation Genome compositionb
PB2 PB1 PA HA NP NA M NS
I B/Taiwan/00076/03 January 2003 Vic Vic Ya Vic Ya Ya Ya Clade A
B/Taiwan/00937/03 March 2003
B/Taiwan/71207/04 July 2004
B/Taiwan/72266/04* December 2004
B/Taiwan/70007/05* 4 January 2005
B/Taiwan/70122/05* 11 January 2005
B/Taiwan/70149/05* 13 January 2005
B/Taiwan/70299/05* 22 January 2005
B/Taiwan/70325/05* 25 January 2005
B/Taiwan/70555/05* 16 February 2005
B/Taiwan/00710/05* 16 March 2005
B/Taiwan/70878/05* 22 March 2005
B/Taiwan/90680/05* 28 March 2005
B/Taiwan/70949/05* 7 April 2005
III B/Taiwan/71024/04 June 2004 Ya Ya Ya Ya Ya Ya Ya Clade A
B/Taiwan/71426/04 August 2004
B/Taiwan/71540/04 September 2004
B/Taiwan/70513/05* 4 February 2005
B/Taiwan/90584/05* 11 March 2005
B/Taiwan/70864/05* 19 March 2005
II B/Taiwan/01742/00 May 2000 Ya Ya Ya Ya Ya Ya Ya Clade B
B/Taiwan/02091/00 May 2000
B/Taiwan/03852/00 September 2000
B/Taiwan/00013/01 January 2001
B/Taiwan/02112/01 May 2001
B/Taiwan/00979/02 February 2002
B/Taiwan/01709/02 April 2002
B/Taiwan/70125/04 February 2004
B/Taiwan/71718/04 October 2004
B/Taiwan/71891/04 November 2004
B/Taiwan/03395/04* December 2004
B/Taiwan/70131/05* 12 January 2005
B/Taiwan/70146/05* 13 January 2005
B/Taiwan/00202/05* 21 January 2005
B/Taiwan/70539/05* 7 February 2005
B/Taiwan/01026/05* 18 April 2005
a

Asterisks indicate strains isolated from the winter peak season of 2004 and 2005.

b

Vic, strains grouped with B/Victoria/2/87; Ya, strains grouped with B/Yamagata/16/88.

FIG. 1.

FIG. 1.

FIG. 1.

Phylogenetic relationship of 36 Taiwanese influenza B isolates for all eight genomic segments. According to the grouping in each subplot, isolates were labeled as being of either the Yamagata or Victoria lineage. One exception is that for the NS gene, for which no Taiwanese isolates were grouped to the Yamagata or Victoria lineage: clades A and B were used instead. Also labeled were the three phylogenetic group numbers (Table 2). Some bootstrap values based on the percentage of 1,000 pseudoreplicates are included for reference.

Table 2 presents the three patterns of genome composition that clearly emerged. In the 2004 and 2005 winter outbreak (strains labeled with * in Table 2), 11 of 20 isolates belonged to pattern I (Vic+Vic+Ya+Vic+Ya+Ya+Ya+A, from segments 1 to 8), six belonged to pattern II (Ya+Ya+Ya+Ya+Ya+Ya+Ya+B), and three belonged to pattern III (Ya+Ya+Ya+Ya+Ya+Ya+Ya+A). In the six isolates from the six months (June 2004 to November 2004) immediately preceding the 2004 and 2005 outbreak, one isolate belonged to pattern I, two belonged to pattern II, and three belonged to pattern III. In the 10 isolates from the four previous influenza seasons (2000 to 2004), 2 had pattern I in 2003 and 8 had pattern II; no isolate had pattern III.

According to this analysis, pattern III viruses first appeared in the summer of 2004 (B/Taiwan/71024/04, B/Taiwan/71426/04, and B/Taiwan/71540/04) and continued to be active in the subsequent winter influenza outbreak (February and March 2005). The two major patterns (I and II) of influenza B viruses that were circulating in the 2004 and 2005 season originated in previous years. For example, pattern II viruses have been observed since mid-2000, and pattern I viruses emerged in early 2003. Thus, we speculate that pattern III viruses either likely originated from a local reassortment of pattern I and II viruses as early as the summer of 2004 or were imported from other countries. To test this hypothesis, we performed a genomewide comparison of the six Taiwanese pattern III viruses with 37 international influenza B viral genomes available from the Influenza Virus Resource of NCBI. Phylogenetic trees of each of the eight genomic segments were constructed (Fig. 2). Two international strains, B/Oslo/71/04 and B/England/23/04, were consistently clustered together with the six putative reassortants isolated in Taiwan in 2004 and 2005, suggesting that the Taiwanese reassortants may not have completely originated from a mixing of local Taiwanese strains.

FIG. 2.

FIG. 2.

FIG. 2.

Phylogenetic relationship of six Taiwanese pattern III influenza B strains versus 37 international influenza B viral genomes. Both B/England/23/04 and B.Oslo/71/04 were consistently grouped together with group III Taiwanese isolates in all eight subplots. Some bootstrap values based on the percentage of 1,000 pseudoreplicates are included for reference.

In this study, we performed phylogenetic analysis of all eight genomic segments of Taiwanese influenza B virus isolates from 2002 to 2005. Our results were consistent with the observations of Tsai et al. (12) that locally circulated influenza B virus strains in 2005 were dominated by reassortants with the Victoria lineage of hemagglutinin and the Yamagata lineage of neuraminidase. We additionally analyzed Victoria and Yamagata lineage groupings of the six internal genes and noted that only the NS genes could be assigned to neither the Victoria nor Yamagata lineage. In particular, the grouping of NS genes has crossed the boundary, as depicted by the other seven genes (Table 2). Accordingly we have labeled them clades A and B. Based on these groupings of the eight influenza B segments, we have revealed three distinct phylogenetic patterns for those Taiwanese strains under consideration, namely patterns I, II, and III. From the timeline of these isolates, it was speculated that pattern III viruses might have originated from a local mixing of pattern I and II viruses. On the other hand, we cannot completely rule out the possibility that pattern III viruses might have been imported because, as shown in Fig. 2, all six Taiwanese pattern III viruses consistently cluster together with B/Oslo/71/04 and B/England/23/04 and are well separated from the rest of the other international reference strains. The NS gene can encode NS1 and NS2 proteins, of which NS1 protein is a multifunctional protein for influenza virus replication. This would be important for further investigation of the impact of observed NS genetic diversity on influenza B virus infection.

Acknowledgments

The authors thank Chang Gung Memorial Hospital (grants CMRPD250031, CMRPG350331, and CMRPD150161) and the National Science Council of the Republic of China, Taiwan (grants NSC94-2213-E-182-027 and NSC93-2317-B-182A-001) for financially supporting this research.

Footnotes

▿

Published ahead of print on 28 February 2007.

REFERENCES

  • 1.Burland, T. G. 2000. DNASTAR's Lasergene sequence analysis software. Methods Mol. Biol 132:71-91. [DOI] [PubMed] [Google Scholar]
  • 2.Hay, A. J., V. Gregory, A. R. Douglas, and Y. P. Lin. 2001. The evolution of human influenza viruses. Phil. Trans. R. Soc. Lond. B 356:1861-1870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lamb, R. A., and P. W. Choppin. 1983. The gene structure and replication of influenza virus. Annu. Rev. Biochem. 52:467-506. [DOI] [PubMed] [Google Scholar]
  • 4.McCullers, J. A., T. Saito, and A. R. Iverson. 2004. Multiple genotypes of influenza B virus circulated between 1979 and 2003. J. Virol. 78:12817-12828. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Page, R. D. 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12:357-358. [DOI] [PubMed] [Google Scholar]
  • 6.Persson, B. 2000. Bioinformatics in protein analysis. EXS 88:215-231. [DOI] [PubMed] [Google Scholar]
  • 7.Retief, J. D. 2000. Phylogenetic analysis using PHYLIP. Methods Mol. Biol 132:243-258. [DOI] [PubMed] [Google Scholar]
  • 8.Rice, P., I. Longden, and A. Bleasby. 2000. EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet. 16:276-277. [DOI] [PubMed] [Google Scholar]
  • 9.Rota, P. A., T. R. Wallis, M. W. Harmon, J. S. Rota, A. P. Kendal, and K. Nerome. 1990. Cocirculation of two distinct evolutionary lineages of influenza type B virus since 1983. Virology 175:59-68. [DOI] [PubMed] [Google Scholar]
  • 10.Shaw, M. W., X. Xu, Y. Li, S. Normand, R. T. Ueki, G. Y. Kunimoto, H. Hall, A. Klimov, N. J. Cox, and K. Subbarao. 2002. Reappearance and global spread of variants of influenza B/Victoria/2/87 lineage viruses in the 2000-2001 and 2001-2002 seasons. Virology 303:1-8. [DOI] [PubMed] [Google Scholar]
  • 11.Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Tsai, H.-P., H.-C. Wang, D. Kiang, S.-W. Huang, P.-H. Kuo, C.-C. Liu, I.-J. Su, and J.-R. Wang. 2006. Increasing appearance of reassortant influenza B virus in Taiwan from 2002 to 2005. J. Clin. Microbiol. 44:2705-2713. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Clinical Microbiology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES