Skip to main content
NCBI home page
The American Journal of Pathology logoLink to The American Journal of Pathology
. 2002 Oct;161(4):1467–1474. doi: 10.1016/S0002-9440(10)64422-7

Heterogeneous Expression and Functions of Androgen Receptor Co-Factors in Primary Prostate Cancer

Peng Li *, Xin Yu †, Kai Ge †, Jonathan Melamed *, Robert G Roeder †, Zhengxin Wang ‡
PMCID: PMC1867282  PMID: 12368219

Abstract

The androgen receptor (AR), a ligand-activated transcription factor of the steroid receptor superfamily, plays an important role in normal prostate growth and in prostate cancer. The recent identification of various AR co-factors prompted us to evaluate their possible roles in prostate tumorigenesis. To this end, we analyzed the expression of AR and eight of its co-factors by quantitative in situ RNA hybridization in 43 primary prostate cancers with different degrees of differentiation. Our results revealed nearly constant expression of AR and heterogeneous expression of AR co-factors, with increased expression of PIAS1 and Ran/ARA24, decreased expression of ELE1/ARA70, and no change in TMF1/ARA160, ARA54, SRC1, or TRAP220. Interestingly, whereas TMF1/ARA160, ELE1/ARA70, ARA54, RAN/ARA24, and PIAS1 were preferentially expressed in epithelial cells, another co-factor, ARA55, was preferentially expressed in stromal cells. Although the changes in levels of these co-activators did not correlate with Gleason score, their occurrence in high-grade prostatic intraepithelial neoplasia, suggests their involvement in initiation (or an early stage) of cancer. In addition, human prostate tumor cell proliferation and colony formation were markedly reduced by ELE1/ATRA70. Together, these findings indicate that changes in levels of expression of AR co-factors may play important, yet different, roles in prostate tumorigenesis.

Androgens mediate development and maintenance of normal prostate tissue and also seem to be involved in prostate tumor growth and progression. 1 Androgens act through the androgen receptor (AR), which belongs to the large family of nuclear receptors. 2 These receptors are hormone-activated transcription factors and structurally conserved. Activation of AR by androgens is a multistep process that involves androgen binding to the receptor, an accompanying structural change in the receptor, loss of associated heat shock/chaperone proteins, translocation of the liganded receptor to the nucleus, and binding of the liganded receptor to target genes. There is increasing evidence that the transcriptional activity of AR and other nuclear receptors depends on their interaction with various co-factors (co-activators and co-repressors). 3,4 A variety of co-factors have been identified by their ability to bind various nuclear receptor domains and to alter the transcriptional activity of nuclear receptors after overexpression in cell lines. 5 The best-studied group includes p300/CBP, the p160 family (SRC-1, TIF-2/GRIP-1, ACTR/P-CIP), 5 and PCAF/GCN5 complexes (yeast SAGA, human STAGA). 6,7 All have histone acetyltransferase activities and are thought to act mainly through histone acetylation and consequent chromatin structural perturbations, although they can also act through functional acetylation of activators 8 and co-activators. 9 A second group includes the TRAP/DRIP/ARC/SMCC/mediator complex, 10 which shows subunit-specific interactions with both nuclear receptors (mainly through TRAP220) and other activators. 10 This complex in turn facilitates the function of RNA polymerase II and the general initiation factors on DNA templates at postchromatin-remodeling steps. 10,11 Of these various co-activators, p300/CBP 12,13 and p160s 12,14-16 have been shown to function with AR. Other co-factors implicated in the function of AR and, in most cases, other nuclear receptors, include the ARA group (ARA24, ARA54, ARA55, ARA70, and ARA160), 17-20,35 ARIP3, 21 SNURF, 22 and AES. 23

Altered expression of nuclear hormone receptor co-factors has been implicated in the genesis and progression of breast cancers. Increased expression of TIF2, CBP, and steroid receptor RNA activator has been observed in breast tumor tissues. 24-26 Peroxisome proliferator-activated receptor-binding protein (PBP/TRAP220) and SRC3/AIB1 genes are frequently amplified and overexpressed in breast tumors. 27,28 In comparison, however, little is known about the possibility of abnormal expression of co-factors in prostate cancer. Recently, Fujimoto and colleagues 40 found that the expression levels of ARA55 and SRC1 were higher in cancer specimens with a poor response to endocrine therapy than in those with a good response to endocrine therapy. To explore this question, we analyzed the levels of expression of both relatively AR-selective co-factors (TMF1/ARA160, ELE1/ARA70, ARA55, ARA54, Ran/ARA24, and PIAS1) and more general co-factors (SRC1, TRAP220) in human prostate cancer tissue by quantitative in situ hybridization. Among the tested co-factors, PIAS1 and RAN/ARA24 showed significantly higher expression levels in cancer tissue compared with benign tissue. In contrast, expression of ELE1/ARA70 was dramatically decreased in primary prostate tumor tissues. A subsequent analysis has demonstrated suppression of LNCaP cell growth by ELE1/ARA70. Collectively, these results imply that these co-factors likely play important but contrasting roles in prostate cancer differentiation and tumorigenesis.

Materials and Methods

Prostate Tissue Specimens and Pathological Evaluation

Prostate cancer and normal control tissues were derived from radical prostatectomy specimens of 43 prostate cancer patients treated at New York University Medical Center. The study protocol was approved by Institutional Review Board of New York University Medical Center. Tissues were fixed in 10% neutral buffered formalin and embedded in paraffin. Sections of tissue (4 μm) were cut and mounted on Superfrost Plus adhesion slides and used for histology, immunohistochemistry, and in situ hybridization. Prostate cancer foci were categorized as well differentiated (combined Gleason score 2 to 4; n = 9), moderately differentiated (combined Gleason score 5 to 6; n = 17), and poorly differentiated (combined Gleason score 7 and 8 to 10; n = 17). The histological features and the Gleason score of each individual specimen were confirmed by two pathologists (JM and PL).

Immunohistochemistry

The immunohistochemical staining was performed on an automated Ventana machine. Before staining, antigen retrieval was performed by heating the specimens in a microwave oven for 30 minutes in citrate buffer (pH 8.0) after dewaxing. A rabbit polyclonal anti-AR antibody (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) was applied to the sections at a 1:100 dilution, and sections were then incubated overnight at 4°C. A streptavidin-biotin peroxidase detection system was used according to the manufacturer’s instruction (DAKO, Carpinteria, CA), with 3,3′-diaminobenzidine as substrate.

In Situ Hybridization

The expression sequence tag (EST) cDNA clones of interest were obtained from Research Genetics, Inc (Carlsbad, CA). Oligonucleotides were designed to bear T7 promoter sequences on one end and T3 promoter sequences on the opposite end (Table 1) ▶ such that the sense and anti-sense probes were specified by the polymerase used. Fragments of corresponding genes (∼500-bp DNA) were amplified using polymerase chain reaction. High-specific-activity 33P-labeled RNA probes were synthesized by incubation of DNA with T7 or T3 RNA polymerase; 500 μmol/L of GTP, ATP, and CTP; 3 μmol/L of UTP; and 100 μCi α-33P-UTP (6000 Ci/mmol) at 37°C for 45 minutes followed by DNase treatment for 15 minutes at 37°C. The probes were purified by chromatography on a Sephadex G-50 column. The yield and quality of the probes were assessed by trichloroacetic acid precipitation and scintillation counting, as well as by agarose gel electrophoresis and autoradiography.

Table 1.

List of Oligonucleotide Primers Used for Polymerase Chain Reaction

Protein Primer Sequence (5′-3′) Size (bp)
AR T3/2263 accaatgtcaactccaggatgct 499
T7/2762 cttcactgggtgtggaaatagatg
Ran/ARA24 T3/22 caggtccagttcaaacttgtattggtt 605
T7/627 gagagcagttgtctgagcaacct
ARA54 T3/863 ttgcccgttatgaccgc 474
T7/1337 aaatgtttgtaagggtttgctctagag
ARA55 T3/−20 ctggagactaccacctcgacatg 608
T7/588 actgcagcagccccagc
ELE1/ARA70 T3/1344 tgagcctgagaagcataaagattc 491
T7/1835 acatctgtagaggagttcgatataac
TMF1/ARA160 T3/477 ttcaggggaaactctggcag 581
T7/1058 tatcccttgcctgacaattcatcat
PIAS1 T3/7 gacagtgcggaactaaagcaaatg 638
T7/645 gaagtgatcttcttgtggacaactggt
SRC1 T3/3235 tatcagtcaccagacatgaagg 499
T7/3734 ggttattcagtcagtagctgctg
TRAP220 T3/172 ttggtcagctgtttggagacat 628
T7/800 ttgtacacagcagatgttccttca
Open in a new tab

T3 primers contain the T3 RNA polymerase promoter sequence gcaattaaccctcactaaaggg at the 3′ ends and T7 primers contain the T7 RNA polymerase promoter sequence cgtaatacgactcactataggg at the 5′ ends. Numbers indicate position of the primers’ 5′ ends on the cDNA sequences (the A of the ATG translation start codon was arbitrarily given the number 1).

After wax removal and rehydration, 4-μm sections of formalin-fixed tissue were hybridized to the sense and anti-sense probes following the described procedures. 30 Then, slides were subjected to autoradiography by dipping in NTB-2 X-ray emulsion (Eastman-Kodak, Rochester, NY), exposed for 1 to 2 weeks, developed in D-19 developer (Eastman-Kodak), and fixed in G33C fixer. Lastly, the slides were counterstained with Gill’s hematoxylin stain.

Image and Statistical Analyses

The benign and malignant tissue components were compared on the same section to eliminate tissue-to-tissue and slide-to-slide variations of grain signals. We first examined the consistency of quantification of a given case by analyzing randomly selected areas of nonneoplastic and cancer foci in the cancer specimens for five cases. The results from block to block were comparable in all cases (data not shown). These results validated the in situ hybridization approach with formalin-fixed and paraffin-embedded tissues for analyzing the expression of AR and its co-factors. Slides were evaluated under a microscope (Nikon Eclipse E400) equipped with a digital camera (Princeton Scientific Instruments, Inc., Monmouth Junction, NJ) interfaced to a computer with IPLab software. The specimens were categorized into four groups according to degree of differentiation by Gleason score; Gleason score 4, Gleason score 5 to 6, Gleason score 7, and Gleason score 8 to 10. The grain (in situ signal) numbers from the areas of interest (cancer, prostatic intraepithelial neoplasia, and normal) were captured and counted using IPLab software, and divided by the number of cells to quantify as grain number/cell. An average of 30 to 50 cells were analyzed for each case. Differences in expression levels of the genes of interest among these four groups were subjected to nonparametric Kruskal-Wallis analysis of variance analyses. Results were further grouped according to changes in RNA levels (malignant versus benign tissue) of less than twofold and greater than twofold and analyzed by the chi-square test.

Assays of Cell Growth Suppression

LNCaP cells were plated in six-well plates (35-mm wells) and grown in RPMI 1640 medium to ∼70% confluency for transfection with plasmid DNA (pcDNA3.1 and pcDNA-ELE/ARA70) and 6 μl of lipofectamine (Invitrogen Life Technologies, Carlsbad, CA). Two days later, cells were selected with G418 at 0.8 μg/ml. After 4 weeks of selection with the medium change every 3 days, the cells were rinsed with phosphate-buffered saline (PBS), fixed with 2% formaldehyde in PBS for 15 minutes, stained with 0.5% crystal violet in PBS for 15 minutes, rinsed once or twice with distilled water, dried, and stored for subsequent quantification of colonies.

Results

Analysis of mRNA Expression by In Situ Hybridization

A large number of co-factors that regulate AR-driven transcription has been identified. 4 To determine possible relationships to prostate tumorigenesis and prostate cancer progression, we investigated the expression levels of various AR co-factors in normal and tumor prostate tissues by in situ hybridization. To validate the in situ hybridization results, we performed both in situ hybridization and immunohistochemical analysis for AR with the same set of slides from the formalin-fixed, paraffin-embedded tissue blocks. Strong and uniform immunostaining of AR was observed in the nuclei of both epithelial and stromal cells in the benign areas of each of the 43 specimens (Figure 1G) ▶ . Consistently, AR mRNA expression levels were high in epithelial cells and lower in stromal cells revealed by in situ hybridization (Figure 1, A and B) ▶ . As a negative control, only background signals were detected with the sense AR probe (Figure 1C) ▶ , indicating that the signals obtained with the anti-sense AR probe were specific.

Figure 1.

Figure 1.

Open in a new tab

Expression of AR and ARA55 in prostate tissues. A and D: Bright field (emulsion-coated) of AR and ARA55, respectively. B and E: Dark field of the same slide areas. B and E were hybridized with AR and ARA55 anti-sense probes, respectively, and C was hybridized with AR sense probes. F and G: Immunohistochemical analysis of ARA55 and AR in human prostate tissues. All slides were emulsion-coated, except F and G.

Expression of AR and Co-Factor mRNAs: Epithelial Expression Versus Stromal Expression

In the 43 cases studied, the expression levels and overall expression patterns of AR did not differ significantly (less than twofold) between normal prostate tissue (from the same section of and adjacent to the prostate cancer region) and prostate cancer tissue. There was no apparent relationship between the amount of AR and the degree of tumor differentiation. These results are in accordance with previous reports that AR is highly expressed in a variety of normal and malignant human prostate tissues. 31 Expression levels of a panel of eight proteins described as modulators of AR function were then analyzed in the 43 prostate tumor samples. Two of these co-factors, SRC1 and TRAP220, interact with a broad spectrum of different nuclear receptors. The other six co-factors studied [the members of the ARA group (TMF1/ARA160, ELE1/ARA70, ARA55, ARA54 and Ran/ARA24) and PIAS1] are relatively specific for AR. The in situ hybridization results are summarized in Table 2 ▶ . Expression of SRC1 and TRAP220 was detected in both stromal cells and epithelial cells, whereas expression of ARA54 was observed predominantly in epithelial cells. The expression levels of these mRNAs did not differ significantly between normal and tumor tissues. Although ARA55 mRNA was moderately expressed in stromal cells, it was undetectable in glandular epithelial cells (Figure 1, D and E) ▶ , implying that ARA55 might regulate AR function in prostate stroma. Immunohistochemical staining with anti-ARA55 antibody on the same prostate tissues further confirmed that ARA55 was only expressed in stromal cells (Figure 1F) ▶ . This is consistent with results of the previous study that ARA55 was detected only in cell lines derived from prostate stroma. 32 In most of the 43 specimens studied, the expression level of ARA55 was lower in the stroma in regions of cancerous foci however quantification was not possible because of the scanty nature of stroma in cancerous foci.

Table 2.

Summary of in Situ Hybridization Data for AR and the Eight Examined Cofactors

Factors Stroma Epithelium
Benign Tumor
AR ++ +++ +++
SRC1 + + +
TMF1/ARA160 +/− + +
TRAP220 +/− + +
ARA55 ++ − −
ARA54 +/− + +
Ran/ARA24 +/− + +++
PIAS1 +/− + +++
ELE1/ARA70 − +++ +
Open in a new tab

−, Indicates undetectable levels of expression; +/−, +, ++, and +++ indicate slightly above background, low, moderate, and high levels of expression, respectively.

Increased Expression of Ran/ARA24 and PIAS1 in Prostate Tumor Tissues

The 24-kd protein Ran/ARA24 belongs to the superfamily of GTP-binding proteins that use a structurally conserved G domain as a molecular switch for cycling between the GDP- and GTP-bound states. 33 Ran/ARA24 has been clearly implicated in the two-way traffic of macromolecules between the nucleus and the cytoplasm 34 and in microtubule assembly and spindle formation in cells in M phase. Recently, it has been shown that Ran/ARA24 physically interacts with the polyglutamine region of AR and enhances AR-dependent transcription. 35 Our in situ hybridization results for normal tissue showed only a low level of Ran/ARA24 mRNA expression that was present mainly in epithelial cells (Figure 2, A and B) ▶ . Comparison of Ran/ARA24 expression in normal and tumor tissues found overexpression (Figure 2, C and D versus A and B ▶ ; Table 3 ▶ ) in 81% of the tumor specimens, with an average increase of 4.6(±1.1)-fold and no change in 19% of the specimens. More dramatic changes (more than fivefold) were observed in 35% of the tumor specimens (Table 3) ▶ . However, these changes did not correlate with prostate tumor grade (Gleason score) by nonparametric Kruskal-Wallis analysis of variance analysis and by the chi-square test when cases were further grouped according to changes of less than twofold and greater than twofold.

Figure 2.

Figure 2.

Open in a new tab

Increased expression of Ran/ARA24 in prostate cancer tissues. Left (A, C, E) and right panels (B, D, F) show bright and dark fields of the same areas of slides, respectively. A and B, C and D, and E and F show normal prostate, prostate tumor, and prostate intraepithelial neoplasia tissues, respectively. All slides are emulsion-coated.

Table 3.

Quantification of PIAS1, Ran/ARA24, and ELE1/ARA70 Expression

PIAS1 Ran/ARA24 ELE1/ARA70
fold <2 2–7.5 <2 2–5 5–20 <2 2–5 5–30
cases 24 12 8 20 15 9 18 16
% 67 33 19 46 35 20 42 38
Open in a new tab

PIAS1 has been identified as a factor that binds to Stat1 (signal transducer and activator of transcription 1) and inhibits STAT-mediated signaling by interfering with the DNA binding of Stat1. 36 PIAS1 has also been identified as a co-activator for AR-, estrogen receptor (ER)-, and progesterone receptor (PR)-dependent transcription. 37,38 In the current study, we observed higher PIAS1 expression levels in 33% of the tumor cases, with an average of 3.8-fold increase (Table 3) ▶ . Although the percentage of cases showing an increase is significantly higher for Ran/ARA24 (81%) than for PIAS1 (33%), there is an 80% concordance between the increase for Ran/ARA24 and PIAS1. The PIAS1 expression patterns also did not correlate with prostate tumor grades by nonparametric Kruskal-Wallis analysis of variance and by the chi-square test.

Lower Expression of ELE1/ARA70 in Prostate Cancer

ELE1/ARA70 was identified first as a factor involved in the activation of the RET proto-oncogene in thyroid neoplasia 39 and later as a ligand-dependent transcriptional co-factor for AR. 17 Our in situ RNA hybridization assays showed that ELE1/ARA70, like AR, is expressed at high levels (and predominantly in epithelial cells) in normal tissue (Figure 3, A and B) ▶ . However, ELE1/ARA70 expression was dramatically lower in prostate tumor tissues (Figure 3, C and D versus A and B) ▶ . Expression was decreased twofold to fivefold in 42% of the cases and 5- to 30-fold in 38% of cases (Table 3) ▶ , with an average decrease of 7.5(±1.4)-fold. We further observed that, in cases with increased expression of RAN/ARA24 and reduced expression of ELE1/ARA70, 70% of the cases showed reciprocal changes, indicating opposite effects of these co-activators in cancer. No obvious correlation between ELE1/ARA70 expression and prostate tumor grade was observed by nonparametric Kruskal-Wallis analysis of variance analysis or by the chi-square test when cases were grouped according to changes less than twofold and greater than twofold.

Figure 3.

Figure 3.

Open in a new tab

Decreased expression of ELE1/ARA70 in prostate cancer tissues. Left and right panels show bright and dark fields of the same slide areas, respectively. A and B, C and D, and E and F show normal prostate, prostate tumor, and prostate intraepithelial neoplasia tissues, respectively. All slides are emulsion-coated slides.

AR Co-Activator Expression in High-Grade Prostate Intraepithelial Neoplasia (HGPIN)

HGPIN is thought to be a prostate cancer precursor lesion as a result of abundant evidence based on morphological, topographical, immunohistochemical, and molecular studies. HGPIN was identified in the majority of our cases (40 of 43 cases), either within or away from cancerous foci. A comparative analysis of AR co-factor expression patterns in HGPIN located adjacent to the prostate cancer region showed changes similar to those observed in prostate cancer. These changes included enhanced Ran/ARA24 expression (Figure 2, E and F versus A and B) ▶ and decreased ELE1/ARA70 expression (Figure 3, E and F versus A and B) ▶ . We did not observe a significant difference in co-activator expression according to location of HGPIN. These results support the concept that HGPIN is a precursor of prostate cancer and further indicate that abnormal expression of Ran/ARA24 and ELE1/ARA70 may be involved in prostate tumor initiation.

Suppression of Human Prostate Cancer Cell Proliferation and Colony Formation by ELE1/ARA70

The decreased expression of ELE1/ARA70 in prostate cancer suggest that this co-factor might negatively regulate prostate cell growth and proliferation. We therefore tested the ability of ELE1/ARA70 gene to suppress the growth of prostate tumor cells, using the metastatic prostate cancer cell line LNCaP, which expresses reduced levels of ELE1/ARA70 compared with normal primary prostate epithelial cells. 41 Colony formation was suppressed by ELE1/ARA70 but not by the vector control (Figure 4) ▶ . The colonies were small (containing a few cells), even after 1 month of G418 selection (data not shown). These results indicate that ELE1/ARA70 suppresses tumor cell proliferation and colony formation and suggest that it may be a tissue differentiation factor or a potential tumor suppressor.

Figure 4.

Figure 4.

Open in a new tab

Growth suppression of the prostate tumor cells by ELE1/ARA70. LNCaP prostate cancer cells were transfected with 4 μg of pcDNA3.1 (vector) or pcDNA-ELE1/ARA70 and selected for plasmid-containing cells with G418 for 4 weeks. Surviving cells were then fixed and stained with crystal violet. Colonies were counted and the data are presented as histograms.

Discussion

Given the diverse functions of AR in different tissues, the large number of AR co-factors may provide means for cell- and promoter-specific regulation of AR activity. 1,2 Most co-factors are not receptor-specific but also regulate the activity of many nuclear receptors as well as unrelated transcription factors. 3 Furthermore, many co-factors are components of multiprotein complexes that have overlapping functions and nuclear receptor-binding sites. 42 The challenge is to identify co-factors involved in AR function in the prostate, particularly in prostate growth and prostate cancer progression. Our results demonstrate the heterogeneous expression and functions of AR co-factors in the prostate. Significantly, we observed increased expression of PIAS1 and Ran/ARA24 and decreased expression of ELE1/RAR70 both in prostate cancer tissues and in HGPIN, relative to normal prostate tissue. Furthermore, our in vivo studies using a malignant prostate cell line raise the possibility that ELE1/RAR70 might be a tumor suppressor.

AR and Some Co-Factors Are Relatively Constant in Benign and Malignant Prostate Tissues

Enhanced AR activity has been correlated with prostate cancer formation and progression. 43 It also has been proposed that either AR gene mutation or AR gene amplification may enhance AR activity, thus promoting tumorigenesis or leading to androgen-independent prostate cancer. 1,44 However, the relatively low incidence of AR mutation and amplification in primary prostate cancer suggests other causes. Consistent with this possibility, our in situ analyses have revealed that the levels and patterns of AR expression do not change significantly in primary prostate tumors of different grades. Down-regulation of SRC1, one of general nuclear receptor co-factors, is associated with tamoxifen resistance in breast neoplasms. 45 However, we did not detect a significant change in expression of SRC1 mRNA in prostate tumor tissue relative to normal tissue. TRAP220 was expressed in both epithelial and stromal cells, and the levels were not different in prostate cancer and benign prostate tissues. This might reflect rather broad functions of TRAP220 for various nuclear receptors and other activators. 42

Changed Expression of AR Co-Factors in Prostate Tumor

Recent studies have shown that various co-activators can bind to AR and augment the AR transcription activity in a ligand-dependent manner. 1,2 Therefore, the activity of co-factors might contribute to enhanced AR activity in primary prostate cancer. Our study shows that expression levels of Ran/ARA24 and PIAS1 are significantly higher in prostate tumor tissue compared with nonneoplastic prostate tissue. The higher levels of Ran/ARA24 and PIAS1 may contribute to overproliferation of prostate tumor cells. PIAS1 belongs to a family of PIAS proteins that, consistent with present results, are able to co-activate steroid receptor-dependent transcription. 37,38 In contrast to increased expression of RAN/ARA24 in 81% of prostate tumor cases, enhanced expression of PIAS1 was observed only in 33% of the cases. These differences may reflect the involvement of different pathways for Ran/ARA24 and PIAS1 as well as the relative efficiencies in contribution to cancer formation.

Interestingly, PIAS1 was first cloned as a protein that inhibited Stat1, 38 which has been suggested to have an anti-oncogenic effect. 46 This correlates with our findings that the level of PIAS1 is increased, possibly to revert the proapoptotic activity of Stat1, in prostate tissue. Further investigations will be needed to determine whether high levels of PIAS1 promote prostate cell proliferation through the Stat1 pathway, the AR pathway, or both pathways. Similar to PIAS1, Ran/ARA24 is also involved in nuclear translocation and chromatin organization. It is however unclear which pathways are affected by the enhanced expression of RAN/ARA24.

Previous studies demonstrated that ELE1/ARA70 can serve as a co-activator of AR, ER, PR, and peroxisome proliferator activated receptor gamma (PPARγ). 17,29,47,48 Here we report a down-regulation of ELE1/ARA70 expression in prostate cancer compared with levels expressed in nonneoplastic prostate tissues. Consistent with our observations, ELE1/ARA70 expression is reduced in prostate cancer cell lines relative to primary cells from benign prostate epithelium primary cells. 41 These observations suggest that ELE1/ARA70 may be involved in the development or progression of prostate cancer, particularly with respect to loss of androgen responsiveness. Overexpression of ELE1/ARA70 in a prostate cancer cell line suppresses cell proliferation and colony formation, suggesting that it might be a tumor suppressor or involved in the expression of genes required for prostate cell differentiation. AR in LNCaP cell harbors a mutation (codon 877, Thr to Ala) in the hormone-binding domain. This mutation confers an altered ligand-binding specificity.

The study of co-factor expression in prostate cancer should be of great importance for understanding AR function in prostate tumorigenesis and progression. A shift in the levels of various AR co-factors may influence the state of differentiation or proliferation of the prostate, possibly through the regulation of different AR responsive genes.

Acknowledgments

We thank Dr. Katia Manova for help with in situ hybridization, Michael S. Worley for his critical editorial review, Dr. Jacqueline Bromberg for critical comments on the manuscript, Dr. Stephen Vamvakas for statistical analysis, Liliana DeGeus for expert assistance in the preparation of the manuscript, and Dr. Douglas Miller and Dr. Brian West for their continuous support to Peng Li.

Footnotes

Address reprint requests to Zhengxin Wang, Department of Cancer Biology, University of Texas, MD Anderson Cancer Center, 1515 Holcombe Blvd.-173, Houston, TX 77030-4009. E-mail: zhenwang@mdanderson.org.

Supported partly by a CaP CURE award to (to R. G. R. and Z. W.), a grant from the United States Department of the Army (DAMS 17-01-1-0097 to Z. W.), and by a postdoctoral fellowship from the Cancer Research Institute (to X. Y.).

References

  • 1.Jenster G: The role of androgen receptor in the development and progression of prostate cancer. Semin Oncol 1999, 26:407-421 [PubMed] [Google Scholar]
  • 2.Brinkmann AO, Blok LJ, de Ruiter PE, Doesburg P, Steketee K, Berrevoets CA, Trapman J: Mechanisms of androgen receptor activation and function. J Steroid Biochem Mol Biol 1999, 69:307-313 [DOI] [PubMed] [Google Scholar]
  • 3.Tsai SY, Tsai MJ, O’Malley BW: Role of co-activators and co-repressors in the mechanism of steroid/thyroid receptor action. Recent Prog Horm Res 1997, 52:141-164 [PubMed] [Google Scholar]
  • 4.Janne OA, Moilanen A, Poukka H, Rouleau N, Karvonen U, Kotaja N, Hakli M, Palvimo JJ: Androgen-receptor-interacting nuclear proteins. Biochem Soc Trans 2000, 28:401-405 [PubMed] [Google Scholar]
  • 5.Xu L, Glass CK, Rosenfeld MG: Coactivator and corepressor complexes in nuclear receptor function. Curr Opin Genet Dev 1999, 9:140-147 [DOI] [PubMed] [Google Scholar]
  • 6.Berger SL: Gene activation by histone and factor acetyltransferases. Curr Opin Cell Biol 1999, 11:336-341 [DOI] [PubMed] [Google Scholar]
  • 7.Martinez E, Kundu TK, Fu J, Roeder RG: A human SPT3-TAFII31-GCN5-L acetylase complex distinct from TFIID. J Biol Chem 1998, 273:23781-23785 [DOI] [PubMed] [Google Scholar]
  • 8.Gu W, Roeder RG: Activation of p53 sequence-specific DNA binding by acetylation of its C-terminal domain. Cell 1997, 90:595-606 [DOI] [PubMed] [Google Scholar]
  • 9.Chen H, Lin RJ, Xie W, Wilpitz D, Evans RM: Regulation of hormone-induced histone hyperacetylation and gene activation via acetylation of an acetylase. Cell 1999, 98:675-686 [DOI] [PubMed] [Google Scholar]
  • 10.Malik S, Roeder RG: Transcriptional regulation through mediator-like coactivators in yeast and metazoan cells. Trends Biochem Sci 2000, 25:277-283 [DOI] [PubMed] [Google Scholar]
  • 11.Fondell JD, Ge H, Roeder RG: Ligand induction of a transcriptionally active thyroid hormone receptor coactivator complex. Proc Natl Acad Sci USA 1996, 93:8329-8333 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Ikonen T, Palvimo JJ, Jänne OA: Interaction between the amino- and carboxyl-terminal regions of the rat androgen receptor modulates transcriptional activity and is influenced by nuclear receptor coactivators. J Biol Chem 1997, 272:29821-29828 [DOI] [PubMed] [Google Scholar]
  • 13.Aarnisalo P, Palvimo JJ, Jänne OA: CREB-binding protein in androgen receptor-mediated signaling. Proc Natl Acad Sci USA 1998, 95:2122-2127 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Berrevoets CA, Doesburg P, Steketee K, Trapman J, Brinkmann AO: Functional interactions of the AF-2 activation domain core region of the human androgen receptor with the amino-terminal domain and with the transcriptional coactivator TIF2 (transcriptional intermediary factor 2). Mol Endocrinol 1998, 12:1172-1183 [DOI] [PubMed] [Google Scholar]
  • 15.Ma H, Hong H, Huang SM, Irvine RA, Webb P, Kushner PJ, Coetzee GA, Stallcup MR: Multiple signal input and output domains of the 160-kilodalton nuclear receptor coactivator proteins. Mol Cell Biol 1999, 19:6164-6173 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Alen P, Claessens F, Verhoeven G, Rombauts W, Peeters B: The androgen receptor amino-terminal domain plays a key role in p160 coactivator-stimulated gene transcription. Mol Cell Biol 1999, 19:6085-6097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yeh S, Chang C: Cloning and characterization of a specific coactivator, ARA70, for the androgen receptor in human prostate cells. Proc Natl Acad Sci USA 1996, 93:5517-5521 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Kang HY, Yeh S, Fujimoto N, Chang C: Cloning and characterization of human prostate coactivator ARA54, a novel protein that associates with the androgen receptor. J Biol Chem 1999, 274:8570-8576 [DOI] [PubMed] [Google Scholar]
  • 19.Fujimoto N, Yeh S, Kang H-Y, Inui S, Chang H-C, Mizokami A, Chang C: Cloning and characterization of androgen receptor coactivator, ARA55, in human prostate. J Biol Chem 1999, 274:8316-8321 [DOI] [PubMed] [Google Scholar]
  • 20.Hsiao PW, Chang C: Isolation and characterization of ARA160 as the first androgen receptor N-terminal-associated coactivator in human prostate cells. J Biol Chem 1999, 274:22373-22379 [DOI] [PubMed] [Google Scholar]
  • 21.Moilanen AM, Karvonen U, Poukka H, Yan W, Toppari J, Jänne OA, Palvimo JJ: A testis-specific androgen receptor coregulator that belongs to a novel family of nuclear proteins. J Biol Chem 1999, 274:3700-3704 [DOI] [PubMed] [Google Scholar]
  • 22.Moilanen AM, Poukka H, Karvonen U, Häkli M, Jänne OA, Palvimo JJA: Identification of a novel RING finger protein as a coregulator in steroid receptor-mediated gene transcription. Mol Cell Biol 1998, 18:5128-5139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Yu X, Li P, Roeder RG, Wang Z: Inhibition of androgen receptor-mediated transcription by amino-terminal enhancer of split. Mol Cell Biol 2001, 21:4614-4625 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Kurebayashi J, Otsuki T, Kunisue H, Tanaka K, Yamamoto S, Sonoo H: Expression levels of estrogen receptor-alpha, estrogen receptor-beta, coactivators, and corepressors in breast cancer. Clin Cancer Res 2000, 6:512-518 [PubMed] [Google Scholar]
  • 25.Murphy LC, Simon SL, Parkes A, Leygue E, Dotzlaw H, Snell L, Troup S, Adeyinka A, Watson PH: Altered expression of estrogen receptor coregulators during human breast tumorigenesis. Cancer Res 2000, 60:6266-6271 [PubMed] [Google Scholar]
  • 26.Leygue E, Dotzlaw H, Watson PH, Murphy LC: Expression of the steroid receptor RNA activator in human breast tumors. Cancer Res 1999, 59:4190-4193 [PubMed] [Google Scholar]
  • 27.Zhu Y, Qi C, Jain S, Le Beau MM, Espinosa R, Atkins GB, Lazar MA, Yeldandi AV, Rao MS, Reddy JK: Amplification and over-expression of peroxisome proliferator-activated receptor binding protein (PBP/PPARBP) gene in breast cancer. Proc Natl Acad Sci USA 1999, 96:10848-10853 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Anzick SL, Kononen J, Walker RL, Azorsa DO, Tanner MM, Guan XY, Sauter G, Kallioniemi OP, Trent JM, Meltzer PS: AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer. Science 1997, 277:965-968 [DOI] [PubMed] [Google Scholar]
  • 29.Heinlein CA, Ting HJ, Yeh S, Chang C: Identification of ARA70 as a ligand-enhanced coactivator for the peroxisome proliferator-activated receptor gamma. J Biol Chem 1999, 274:16147-16152 [DOI] [PubMed] [Google Scholar]
  • 30.Manova K, Nocka K, Besmer P, Bachvarova RF: Gonadal expression of c-kit encoded at the W locus of the mouse. Development 1990, 110:1057-1069 [DOI] [PubMed] [Google Scholar]
  • 31.Miyamoto KK, McSherry SA, Dent GA, Sar M, Wilson EM, French FS, Sharief Y, Mohler JL: Immunohistochemistry of the androgen receptor in human benign and malignant prostate tissue. J Urol 1993, 149:1015-1019 [DOI] [PubMed] [Google Scholar]
  • 32.Nessler-Menardi C, Jtova I, Culig Z, Eder I, Putz T, Bartsch G, Klocker H: Expression of androgen receptor coregulatory proteins in prostate cancer and stroma-cell culture models. Prostate 2000, 45:124-131 [DOI] [PubMed] [Google Scholar]
  • 33.Bourne HR, Sanders PD, McCormick F: The GTPase superfamily: a conserved structure and molecular mechanism. Nature 1991, 349:117-127 [DOI] [PubMed] [Google Scholar]
  • 34.Gorlich D, Kutay U: Transport between the cell nucleus and the cytoplasm. Annu Rev Cell Dev Biol 1999, 15:607-660 [DOI] [PubMed] [Google Scholar]
  • 35.Hsiao PW, Lin DL, Nakao R, Chang C: The linkage of Kennedy’s neuron disease to ARA24, the first identified androgen receptor polyglutamine region-associated coactivator. J Biol Chem 1999, 274:20229-20234 [DOI] [PubMed] [Google Scholar]
  • 36.Liu B, Liao J, Rao X, Kushner SA, Chung CD, Chang DD, Shuai K: Inhibition of Stat1-mediated gene activation by PIAS1. Proc Natl Acad Sci USA 1998, 95:10626-10631 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Tan J, Hall SH, Hamil KG, Grossman G, Petrusz P, Liao J, Shuai K, French FS: Protein inhibitor of activated STAT-1 (signal transducer and activator of transcription-1) is a nuclear receptor coregulator expressed in human testis. Mol Endocrinol 2000, 14:14-26 [DOI] [PubMed] [Google Scholar]
  • 38.Kotaja N, Aittomaki S, Silvennoinen O, Palvimo JJ, Janne OA: ARIP3 (androgen receptor-interacting protein 3) and other PIAS (protein inhibitor of activated STAT) proteins differ in their ability to modulate steroid receptor-dependent transcriptional activation. Mol Endocrinol 2000, 14:1986-2000 [DOI] [PubMed] [Google Scholar]
  • 39.Santoro M, Dathan NA, Berlingieri MT, Bongarzone I, Paulin C, Grieco M, Pierotti MA, Vecchio G, Fusco A: Molecular characterization of RET/PTC3: a novel rearranged version of the RET proto-oncogene in a human thyroid papillary carcinoma. Oncogene 1994, 9:509-516 [PubMed] [Google Scholar]
  • 40.Fujimoto N, Mizokami A, Harada S, Matsumoto T: Different expression of androgen receptor coactivators in human prostate. Urology 2001, 58:289-294 [DOI] [PubMed] [Google Scholar]
  • 41.Tekur S, Lau KM, Long J, Burnstein K, Ho SM: Expression of RFG/ELE1alpha/ARA70 in normal and malignant prostatic epithelial cell cultures and lines: regulation by methylation and sex steroids. Mol Carcinog 2001, 30:1-13 [DOI] [PubMed] [Google Scholar]
  • 42.Ito M, Yuan CX, Malik S, Gu W, Fondell JD, Yamamura S, Fu Z-Y, Zhang X, Qin J, Roeder RG: Identity between TRAP and SMCC complexes indicates novel pathways for the function of nuclear receptors and diverse mammalian activators. Mol Cell 1999, 3:361-370 [DOI] [PubMed] [Google Scholar]
  • 43.Moul JW: Best screening tests for prostate cancer. West J Med 1998, 169:109-110 [PMC free article] [PubMed] [Google Scholar]
  • 44.Hakimi JM, Rondinelli RH, Schoenberg MP, Barrack ER: Androgen-receptor gene structure and function in prostate cancer. World J Urol 1996, 14:329-337 [DOI] [PubMed] [Google Scholar]
  • 45.Berns EM, van Staveren IL, Klijn JG, Foekens JA: Predictive value of SRC-1 for tamoxifen response of recurrent breast cancer. Breast Cancer Res Treat 1998, 48:87-92 [DOI] [PubMed] [Google Scholar]
  • 46.Kaplan DH, Shankaran V, Dighe AS, Stockert E, Aguet M, Old LJ, Schreiber RD: Demonstration of an interferon gamma-dependent tumor surveillance system in immunocompetent mice. Proc Natl Acad Sci USA 1998, 95:7556-7561 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Alen P, Claessens F, Schoenmakers E, Swinnen JV, Verhoeven G, Rombauts W, Peeters B: Interaction of the putative androgen receptor-specific coactivator ARA70/ELE1alpha with multiple steroid receptors and identification of an internally deleted ELE1beta isoform. Mol Endocrinol 1999, 13:117-128 [DOI] [PubMed] [Google Scholar]
  • 48.Gao T, Brantley K, Bolu E, McPhaul MJ: RFG (ARA70, ELE1) interacts with the human androgen receptor in a ligand-dependent fashion, but functions only weakly as a coactivator in cotransfection assays. Mol Endocrinol 1999, 13:1645-1656 [DOI] [PubMed] [Google Scholar]

Articles from The American Journal of Pathology are provided here courtesy of American Society for Investigative Pathology

RESOURCES