Skip to main content
The American Journal of Pathology logoLink to The American Journal of Pathology
. 1999 Mar;154(3):677–681. doi: 10.1016/S0002-9440(10)65314-X

LKB1 Somatic Mutations in Sporadic Tumors

Egle Avizienyte 1, Anu Loukola 1, Stina Roth 1, Akseli Hemminki 1, Maija Tarkkanen 1, Reijo Salovaara 1, Johanna Arola 1, Ralf Bützow 1, Kirsti Husgafvel-Pursiainen 1, Arto Kokkola 1, Heikki Järvinen 1, Lauri A Aaltonen 1
PMCID: PMC1868601  PMID: 10079245

Abstract

Germline mutations of LKB1/Peutz-Jeghers syndrome gene predispose carriers to hamartomatous polyposis of the gastrointestinal tract as well as to cancer of different organ systems. Although Peutz-Jeghers syndrome patients frequently present with neoplasms of the colon, stomach, small intestine, pancreas, breast, ovaries, and cervix, somatic mutations appear to be rare in the sporadic tumor types thus far studied (colorectal, gastric, testicular, and breast cancers). To evaluate whether somatic mutations of LKB1 contribute to the tumorigenesis of yet unstudied tumor types, we screened 14 cell lines and 129 tumor specimens from different cancers for a genetic defect in LKB1. Six melanoma and eight myeloma cell lines were scrutinized for LKB1 somatic mutations by genomic sequencing. No changes were found in the coding LKB1 sequence and exon/intron boundaries. Next, we analyzed 12 pancreatic, 8 gastric, 12 ovarian granulosa cell, 26 cervical, 28 lung, 24 soft tissue, and 19 renal tumors by single-strand conformational polymorphism analysis. Three changes in LKB1 coding nucleotide sequence were identified. One base pair deletion at A957 and G958 substitution by T occurred in a cervical adenocarcinoma sample, resulting in a frameshift and premature stop codon at position 335. Substitution of A581 by T occurred in a lung adenocarcinoma sample, resulting in the change of aspartic acid at position 194 to valine. A loss of another allele was detected in this sample. One silent change, C1257T, was found in a pancreatic carcinoma sample. The changes were not present in the matched normal tissue DNA samples. Our results suggest that mutational inactivation of LKB1 is a rare event in most sporadic tumor types.


Peutz-Jeghers syndrome (PJS) is an autosomal dominantly inherited condition characterized by gastrointestinal hamartomatous polyposis and mucocutaneous pigmentation. 1 Although hamartomas are characteristic of the syndrome, hyperplastic and adenomatous polyps are occasionally detected. Mucocutaneous melanin pigmentation tends to be present on the lips, oral area, and buccal mucosa. Melanin spots are typically absent at birth but develop during childhood and may diminish or disappear during aging. 1,2 PJS patients frequently develop various neoplasms, and an 18-fold increased risk of cancer has been reported in PJS patients. 3 The neoplasms in PJS patients are usually diagnosed at a relatively young age, and survival is worse than expected in the general population. 4 Gastrointestinal tract cancers frequently occur in PJS patients, although an excess of extraintestinal cancer is also present. 3,4 The PJS intestinal hamartomas occasionally contain an adenomatous component. 4-6 A hamartoma-adenoma-carcinoma sequence in PJS polyposis has been proposed. A 100-fold excess of pancreatic carcinoma has been reported in 31 PJS patients. 3 Interestingly, some rare tumor types can be found relatively frequently in PJS patients. Adenoma malignum, being very rare in the general population, appears quite frequently in PJS patients as up to 10% of all cases are found in patients with PJS. 7 A significant number of PJS female patients have sex cord tumors with annual tubules (SCTAT) that are typically multifocal, bilateral, and benign. 8 Sertoli cell tumors are very rare testicular neoplasms; several studies have reported cases of these tumors in the patients with PJS. 9,10 An approximately fivefold increased risk of early-onset breast cancer appears to be associated with PJS. 11 Cervical adenocarcinoma and ovarian (granulosa cell) tumors are not a rare finding in PJS female patients. 12 A small number of cancers affecting lung, gall bladder, bile duct, basal cells, and blood stem cells have been described in PJS patients. 3,4,13

Recently, germline mutations in LKB1 have been associated with PJS. 14 The gene encodes a serine/threonine kinase that is highly homologous (87%) to Xenopus serine/threonine kinase XEEK1. 15 A high degree of homology was detected between LKB1 and a mouse EST (http://www.ncbi.nlm.nih.gov/irx/cgi-bin/birx_doc?genbank+431188), suggesting the existence of a mouse homologue. LKB1 is a candidate tumor suppressor gene. Loss of heterozygosity analysis on PJS polyps, derived from one patient, showed that a deletion had occurred in the chromosome inherited from the healthy parent; 16 subsequently it was shown that the other allele was mutated in the germline. LKB1 mutations are typically of inactivating nature, often causing truncation of the protein product. 14,17

Often the genes involved in hereditary cancer syndromes are also targets of somatic mutations. Several studies, with an exception of one study on colorectal cancer, 18 have reported a low frequency of LKB1 somatic mutations in colorectal, testicular, breast, and gastric cancers. 19-23 Deletion mapping data in sporadic adenoma malignum samples revealed 67% loss of heterozygosity at marker D19S886 where LKB1 resides. 24 No results on LKB1 mutation analysis in these samples have been reported so far. The aim of our study was to investigate the frequency of LKB1 somatic mutations in a wider range of sporadic tumors.

Materials and Methods

Cell Lines and Tumor Specimens

Six melanoma cell lines were used in the LKB1 mutation analysis: Bowes 2159, SK-MEL-28, SK-MEL-2, A-375, G-361, and MALME-3M. Light myeloma cell lines were also scrutinized. A series of 12 pancreatic, 8 gastric, 12 ovarian, 26 cervical, 28 lung, 24 soft tissue, and 19 renal tumors was studied next. All pancreatic and renal tumors were adenocarcinomas. The gastric cancers were classified as intestinal type (five specimens) and diffuse type (three specimens). All ovarian tumors were of granulosa cell type. Among the cervical tumors, 18 were epidermoid carcinomas and 8 adenocarcinomas. Of the lung tumors, 12 were squamous cell, 3 were large cell, and 1 was a small cell cancer, and 12 were adenocarcinomas. Among the sarcomas, 6 were liposarcomas, 10 were malignant fibrous histiocytomas, 3 were synovial sarcomas, 2 were leiomyosarcomas, 1 was a fibrosarcoma, 1 was an extraosseal Ewing’s sarcoma, and 1 was a malignant schwannoma.

DNA Extraction

DNA samples were prepared from cell lines and fresh-frozen histologically verified tumor specimens according to standard methods. DNA extraction from paraffin-embedded tissue (pancreatic, gastric, and cervical cancers) was performed as described elsewhere. 25

Sequencing

LKB1 mutations were analyzed in melanoma and myeloma cell lines by direct genomic sequencing. PCRs were performed using the primer pairs and conditions described in a previous study, 19 and 5 μl of PCR products was run in 3% agarose (NuSieve, Bioproducts, Rockland, ME) gel to verify the specificity of the PCR. The rest of the reaction product was purified using QIAquick PCR purification kit (QIAGEN, Valencia, CA). Direct sequencing of the PCR products was performed using the ABI PRISM Dye Terminator cycle sequencing kit (Perkin-Elmer Corp., Foster City, CA). Cycle sequencing products were electrophoresed on 6% Long Ranger gels (FMC Bioproducts, Rockland, ME) and analyzed on an Applied Biosystems model 373A automated DNA sequencer (Perkin-Elmer Corp.).

SSCP Analysis

LKB1 mutation analysis using DNA extracted from lung, renal, pancreatic, gastric, ovarian, and cervical cancers and sarcoma specimens was performed by SSCP. Primers used in SSCP analysis are listed in Table 1 ▶ . A 93% proportion of the coding LKB1 sequence was covered by these primers. This set of primers amplifies relatively short fragments and was used to facilitate the amplification of low-quality, especially paraffin-embedded tissue-derived, DNA. Also, the length of these PCR products is optimal for SSCP analysis. The reactions were carried out in a 25-μl reaction volume containing 100 ng of genomic DNA, 1X PCR reaction buffer (Life Technologies, Frederick, MD), 200 μmol/L each dNTP (Life Technologies), each primer at 0.6 μmol/L, 1.5 mmol/L MgCl2, and 1 U of AmpliTaqGOLD polymerase (Life Technologies). The following cycling conditions were used: 10 minutes at 95°C, 35 cycles of 45 seconds at 95°C, 45 seconds at 57°C, and 45 seconds at 72°C with the final extension 10 minutes at 72°C. After PCR, 5 μl of each sample was mixed with 5 μl of denaturing loading buffer (95% formamide, 20 mmol/L EDTA, 0.05% bromphenol blue, 0.05% xylene cyanole FF), denaturated for 5 minutes at 94°C, and loaded into a 0.4-mm × 30-cm × 45-cm gel. Electrophoresis was performed using gels containing 0.6× MDE solution (AT Biochem, Malvern, PA) and 0.6× TBE buffer and that were run at 4 W overnight. The gels were silver stained according to standard procedure. DNA fragments showing aberrant bands in SSCP analysis were sequenced as described above.

Table 1.

Oligonucleotide Primers Used for LKB1 Mutation SSCP Analysis

Exon Sequence of oligonucleotide primer Product size (bp)
1a GTCCAGCATGGAGGTGGT 153
TACTTGCCGATGAGCTTGG
1b CAAGCTCATCGGCAAGTACC 164
ACTTCTTCACGTTGGCCTCC
2 GAGGTACGCCACTTCCACAG 288
CTTCAAGGAGACGGGAAGAG
3 TGAGCTGTGTGTCCTTAGCG 196
AGTGTGGCCTCACGGAAA
4 GTGTGCCTGGACTTCTGTGA 324
GTGCAGCCCTCAGGGAGT
5 ACAGGCACTGCACCCGTT 184
GAGTGTGCGTGTGGTGAGTG
6 TCAACCACCTTGACTGACCA 251
ACACCCCCAACCCTACATTT
7 CCAGCTGACAGGCTCCTC 172
CTCTAGCGCCCGCTCAAC
8 ACTGCTTCTGGGCGTTTG 205
CACCGTGAAGTCCTGAGTGT
9 CAGGACAGGTCCCAGAAGAG 212
CCAGCCTCACTGCTGCTT

Cloning of PCR Products

To better evaluate the deletion in the cervical adenocarcinoma DNA sample, the PCR product of exon 8 was cloned into pGEM vector (Promega, Madison, WI) according to the manufacturer’s procedure. DH5α competent cells were transformed with the ligation product according to standard methods. Plasmid DNA was extracted using QIAprep Spin Miniprep kit (QIAGEN). The insert was sequenced with T7 primer.

Results

We screened six melanoma and eight myeloma cell lines for somatic LKB1 mutations by genomic sequencing. No mutations in the coding sequences and exon/intron boundaries were found. Next, we performed LKB1 mutation analysis in a series of 12 pancreatic, 8 gastric, 12 ovarian, 26 cervical, 28 lung, 24 soft tissue, and 19 renal tumor specimens. Three samples showed aberrant bands in the SSCP analysis: one cervical adenocarcinoma, one lung adenocarcinoma, and one pancreatic carcinoma. Subsequent sequencing analysis revealed three aberrations in these tumor DNA samples. A957 deletion and G958 substitution to T resulted in a frameshift and premature stop codon at 335 in a cervical adenocarcinoma sample (Figure 1A) ▶ . No change was found in the corresponding normal tissue DNA sample (Figure 1B) ▶ . A581 to T change was detected in a lung adenocarcinoma DNA sample (Figure 2A) ▶ . Sequencing results demonstrated only T, but no A, at this position, indicating the loss of the wild-type allele. No change was found in a matched normal tissue DNA sample (Figure 2B) ▶ . The same tumor sample displayed only T at a polymorphic site of intron three (Figure 2C) ▶ , whereas the matched normal tissue DNA sample demonstrated C/T polymorphism at the same position (Figure 2D) ▶ , confirming loss of an LKB1 allele. The mutation resulted in valine, which substituted aspartic acid at the position 194. The third aberration occurred in a pancreatic adenocarcinoma but not in a matched normal tissue DNA. C1257T change did not result in a substitution of amino acid at codon 419.

Figure 1.

Figure 1.

A: A957 deletion and G958T substitution in a cervical adenocarcinoma sample. B: The same position in the matched normal tissue DNA.

Figure 2.

Figure 2.

A: A581T change in a lung adenocarcinoma DNA sample. B: The same position in the matched normal tissue DNA. C: T at the polymorphic −51 position of intron three in the same lung adenocarcinoma sample. D: C/T polymorphism at the same position in the matched normal tissue DNA.

Discussion

A total of 14 cell lines and 129 solid tumors representing different tumor types were screened for somatic mutations in LKB1. We selected the series of tumor samples by considering the sites and histologies of tumors that affect PJS patients. The most frequent cancer sites in PJS patients are colon, small intestine, stomach, and pancreas. 3,4 In this regard, we have chosen gastric and pancreatic carcinomas, but, unfortunately, no tumors of the small intestine were available. We also investigated sporadic ovarian granulosa cell tumors as this histological type is characteristic of ovarian tumors developing in female PJS patients. Because the classical histological appearance of PJS polyps contains a significant smooth muscle component, we were prompted to choose sporadic soft tissue sarcomas of different histological types. Although the frequency of melanoma is not increased in PJS patients, mucocutaneous melanin pigmentation is often present in PJS patients. In this regard, we aimed at studying whether the gene defect might be associated with sporadic malignant melanoma. Although only two PJS patients with myeloma and one with lung adenocarcinoma were reported in the literature, 3,17 we wanted to study whether somatic LKB1 mutations are present in myeloma cell lines and lung cancers. There is also good evidence that genes involved in hereditary cancer syndromes are somatically mutated in tumors that are not associated with the syndrome; eg, PTEN somatic mutations are frequent in endometrial carcinomas, which are not characteristic for Cowden’s syndrome patients. 26 This prompted us to screen a series of renal tumors that was available for this work.

We found one truncating, one missense, and one silent LKB1 mutation in the series of tumor samples described above, and no changes were found in the melanoma and myeloma cell lines. The mutation that was found in a cervical adenocarcinoma sample is predicted to cause truncation of the Lkb1 protein. No change occurred in the normal tissue sample. The same mutation has been detected earlier in a PJS patient’s germline (unpublished results). One missense type mutation was detected in a lung cancer at position 194, which is conserved between Xenopus and mouse homologues in the kinase core domain 14 (unpublished data). The experiments with different LKB1 mutant constructs have showed that even subtle changes, such as missense mutations changing highly conserved amino acids and small in-frame deletions in LKB1 kinase domain, lead to impairment of kinase function. 17 Loss of heterozygosity was found in the same lung adenocarcinoma sample, indicating a complete inactivation of Lkb1. The mutation proved to be a somatic event as the analysis of matched normal tissue sample showed no changes in the same position. Finally, we found a silent mutation in a pancreatic carcinoma sample. No polymorphism has been reported in this position. The significance of this change remains to be seen.

The mutation screening methods used in our study do not allow detection of all mutation types, thus perhaps underestimating the frequency of LKB1 mutations in the studied series. We did not perform Southern analysis or RT-PCR. A subset of LKB1 mutations are likely to be large genomic rearrangements. On the other hand, methylation as an alternative mechanism of LKB1 inactivation may take place in a subset of sporadic tumors.

Our study shows that the frequency of LKB1 somatic mutations in a wide range of sporadic tumors is low. Previous studies have reported small numbers of somatic mutations in colorectal, testicular, breast, and gastric tumors. 19-23 One study, however, reported a relatively high prevalence of LKB1 mutations in left-sided invasive colon cancers. 18 These tumors were of Korean origin, whereas the series of cancers analyzed in the other three studies 19,20,23 were from a Western population. The results of the study performed on Korean sporadic gastric cancers, on the other hand, is in agreement with ours, confirming that somatic LKB1 mutations are not common in sporadic gastric carcinomas.

In summary, our results support the notion that LKB1 somatic mutations are rare in sporadic tumors. It remains to be seen whether some specific tumor types can be associated with somatic LKB1 mutations in the future and whether somatic LKB1 inactivation by epigenetic mechanisms, eg, methylation, contributes to sporadic tumorigenesis.

Acknowledgments

We thank Jozef Bizik, Albert de la Chapelle, Sakari Knuutila, Outi Monni, and Mark T Müller for helping us to extend the series of tumors and Kati Saastamoinen and Kaija Collin for technical assistance.

Footnotes

Address reprint requests to Dr. Lauri A. Aaltonen, Department of Medical Genetics, Haartman Institute, P.O. Box 21, 00014 University of Helsinki, Helsinki, Finland. E-mail: lauri.aaltonen@helsinki.fi.

Supported by grants from the Academy of Finland, University of Helsinki, European Commission (BMH4-CT98-3865), Finnish Cancer Society, Helsinki University Central Hospital, Sigrid Juselius Foundation, and Leiras Research Foundation.

References

  • 1.Phillips RKS, Spigelman AD, Thompson JPS (eds): Familial adenomatous polyposis and other polyposis syndromes. London, Edvard Arnold, 1994
  • 2.Westerman AM, Chong YK, Entius MM, Wilson JHP, van Velthuysen ML, Lindhout D, Offerhaus GJA: The diagnostic value of mucocutaneous pigmentation in Peutz-Jeghers syndrome. The 9th Annual Meeting of the International Collaborative Groop on Hereditary Non-Polyposis Colorectal Cancer and the 7th Biennial Meeting of the Leeds Castle Polyposis Group, 1997
  • 3.Giardiello FM, Welsh SB, Hamilton SR, Offerhaus GJA, Gittelsohn AM, Booker SV, Krush AJ, Yardley JH, Luk GD: Increased risk of cancer in the Peutz-Jeghers syndrome. N Engl J Med 1987, 316:1511-1514 [DOI] [PubMed] [Google Scholar]
  • 4.Spigelman AD, Murday V, Phillips RK: Cancer and the Peutz-Jeghers syndrome. Gut 1989, 30:1588-1590 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Defago MR, Higa AL, Campra JL, Paradelo M, Uehara A, Torres Mazzucchi MH, Videla R: Carcinoma in situ arising in a gastric hamartomatous polyp in a patient with Peutz-Jeghers syndrome. Endoscopy 1996, 28:267. [DOI] [PubMed] [Google Scholar]
  • 6.Hizawa K, Iida M, Matsumoto T, Kohrogi N, Yao T, Fujishima M: Neoplastic transformation arising in Peutz-Jeghers polyposis. Dis Colon Rectum 1993, 36:953-957 [DOI] [PubMed] [Google Scholar]
  • 7.Srivatsa PJ, Keeney GL, Podraiz KC: Disseminated cervical adenoma malignum and bilateral ovarian sex cord tumors with annular tubules associated with Peutz-Jeghers syndrome. Gynecol Oncol 1994, 33:256-264 [DOI] [PubMed] [Google Scholar]
  • 8.Young RH, Welch WR, Dickersin GR, Scully RE: Ovarian sex cord tumor with annular tubules: review of 74 cases including 27 with Peutz-Jeghers syndrome and four with adenoma malignum of the cervix. Cancer 1982, 50:1384-1402 [DOI] [PubMed] [Google Scholar]
  • 9.Dubois RS, Hoffman WH, Krishnan TH, Rising JA, Tolia VK, Sy DA, Chang CH: Feminizing sex cord tumor with annular tubules in a boy with Peutz-Jeghers syndrome. J Pediat. 1982, 101:568-571 [DOI] [PubMed] [Google Scholar]
  • 10.Wilson DM, Pitts WC, Hintz RL, Rosenfeld RG: Testicular tumors with Peutz-Jeghers syndrome. Cancer 1986, 57:2238-2240 [DOI] [PubMed] [Google Scholar]
  • 11.Tomlinson I, Houlston RS: Peutz-Jeghers syndrome. J Med Genet 1997, 34:1007-1011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Christian CD, Mcloughlin TG, Cathcart ER, Eisenberg MM: Peutz-Jeghers syndrome associated with functioning ovarian tumor. J Am Med Assoc 1964, 190:935-938 [DOI] [PubMed] [Google Scholar]
  • 13.Rebsdorf Pedersen IR, Hartvigsen A, Fischer Hansen BF, Toftgaard C, Konstantin-Hansen K, Büllow S: Management of Peutz-Jeghers syndrome: experience with patients from Danish Polyposis Register. Int J Colorect Dis 1994, 9:177-179 [DOI] [PubMed] [Google Scholar]
  • 14.Hemminki A, Markie D, Tomlinson I, Avizienyte E, Roth S, Loukola A, Bignell G, Warren W, Aminoff M, Höglund P, Järvinen H, Kristo P, Pelin K, Ridanpää M, Salovaara R, Toro T, Bodmer W, Olschwang S, Olsen AS, Stratton MR, de la Chapelle A, Aaltonen LA: A serine/threonine kinase gene defective in Peutz-Jeghers syndrome. Nature 1998, 391:184-187 [DOI] [PubMed] [Google Scholar]
  • 15.Su J-Y, Erikson E, Maller JL: Cloning and characterization of a novel serine/threonine protein kinase expressed in early Xenopus embryos. J Biol Chem 1996, 271:14430-14437 [DOI] [PubMed] [Google Scholar]
  • 16.Hemminki A, Tomlinson I, Markie D, Järvinen H, Sisitonen P, Björkqvist AM, Knuutila S, Salovaara R, Bodmer W, Shibata D, de la Chapelle A, Aaltonen LA: Localization of a susceptibility locus for Peutz-Jeghers syndrome to 19p using comparative genomic hybridization and targeted linkage analysis. Nature Genet 1997, 15:87-90 [DOI] [PubMed] [Google Scholar]
  • 17.Ylikorkala A, Avizienyte E, Tomlinson IPM, Tiainen M, Roth S, Loukola A, Hemminki A, Johansson M, Markie D, Neale K, Phillips R, Zauber P, Twama T, Sampson J, Jarvinen H, Mäkelä TP, Aaltonen LA: Mutations and impaired function of LKB1 in familial and non-familial Peutz-Jeghers syndrome and a sporadic testicular cancer. Hum Mol Genet 1999, 8:45-51 [DOI] [PubMed] [Google Scholar]
  • 18.Dong SM, Kim KM, Kim SY, Shin MS, Na EY, Lee SH, Park WS, Yoo NJ, Jang JJ, Yoon CY, Kim JW, Kim SY, Yang YM, Kim SH, Kim CS, Lee JY: Frequent somatic mutations in serine/threonine kinase 11/Peutz-Jeghers syndrome gene in left-sided colon cancer. Cancer Res 1998, 58:3787-3790 [PubMed] [Google Scholar]
  • 19.Avizienyte E, Roth S, Loukola A, Hemminki A, Lothe RA, Stewig AE, Fosså SD, Salovaara R, Aaltonen LA: Somatic mutations in LKB1 are rare in sporadic colorectal and testicular tumors. Cancer Res 1998, 58:2087-2090 [PubMed] [Google Scholar]
  • 20.Wang ZJ, Taylor F, Churchman M, Norbury G, Tomlinson I: Genetic pathways of colorectal carcinogenesis rarely involve the PTEN and LKB1 genes outside the inherited hamartoma syndromes. Am J Pathol 1998, 153:363-366 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Bignell GR, Barfoot R, Seal S, Collins N, Warren W, Stratton M: Low frequency of somatic mutations in the LKB1/Peutz-Jeghers syndrome gene in sporadic breast cancer. Cancer Res 1998, 58:1384-1387 [PubMed] [Google Scholar]
  • 22.Park WS, Moon YW, Yang YM, Kim YS, Kim YD, Fuller BG, Vortmeyer AO, Fogt F, Lubensky IA, Zhuang Z: Mutations of the STK11 gene in sporadic gastric carcinoma. Int J Oncol 1998, 13:601-604 [PubMed] [Google Scholar]
  • 23.Resta N, Simone C, Mareni C, Montera M, Gentile M, Susca F, Gristina R, Pozzi S, Bertario L, Bufo P, Carlomagno N, Ingrosso M, Rossini FP, Tenconi R, Guanti G: STK11 mutations in Peutz-Jeghers syndrome and sporadic colon cancer. Cancer Res 1998, 58:4799-4801 [PubMed] [Google Scholar]
  • 24.Lee JY, Dong SM, Kim HS, Kim SY, Na EY, Shin MS, Lee SH, Park WS, Kim KM, Lee YS, Jang JJ, Yoo NJ: A distinct region of chromosome 19p13.3 associated with the sporadic form of adenoma malignum of the uterine cervix. Cancer Res 1998, 58:1140-1143 [PubMed] [Google Scholar]
  • 25.Kannio A, Ridanpää M, Koskinen H, Partanen T, Anttila S, Collan Y, Hietanen E, Vainio H, Husgafvel-Pursiainen K: A molecular and epidemiological study on bladder cancer: p53 mutations, tobacco smoking, and occupational exposure to asbestos. Cancer Epidemiol Biomarkers Prev 1996, 5:33-39 [PubMed] [Google Scholar]
  • 26.Tashiro H, Blazes MS, Wu R, Cho KR, Boser S, Wang SI, Li J, Parsons R, Ellenson LH: Mutations in PTEN are frequent in endometrial carcinoma but rare in other common gynecological malignancies. Cancer Res 1997, 57:3935-3940 [PubMed] [Google Scholar]

Articles from The American Journal of Pathology are provided here courtesy of American Society for Investigative Pathology

RESOURCES