Skip to main content
Clinical and Experimental Immunology logoLink to Clinical and Experimental Immunology
. 2007 May;148(2):218–229. doi: 10.1111/j.1365-2249.2007.03341.x

Respiratory syncytial virus replication is prolonged by a concomitant allergic response

A Hassantoufighi *, M Oglesbee *, B W M Richter *, G A Prince *, V Hemming *, S Niewiesk *, M C Eichelberger *
PMCID: PMC1868883  PMID: 17335559

Abstract

Epidemiological studies show an association between early exposure to respiratory syncytial virus (RSV) and the development or exacerbation of asthma. This idea is supported by studies in mice that demonstrate worsened airway hyper-reactivity (AHR) when RSV-infected animals are exposed to allergen. The effect of allergen on RSV disease, however, has not been reported. Cotton rats (Sigmodon hispidus) that have been used as a model to study RSV pathogenesis were sensitized to extracts of Aspergillus fumigatus (Af), a common household mould. The allergic response to Af included eosinophilia, formation of granulomas and induction of Th2 type cytokines. RSV infection prior to allergen challenge resulted in exacerbation of the inflammatory response as well as increased airway responsiveness to methacholine. The exacerbated response was indeed dependent on virus replication. Virus replication in turn was influenced by the allergic response, with persistence in the noses for 2 days longer in animals challenged with allergen. This diminished clearance corresponded to decreased induction of mRNA for IFN-γ, a Th1-type cytokine that is characteristic of viral infection. Treatment of RSV-infected Af-challenged animals with recombinant IFN-γ reduced the allergic inflammatory response as well as the relative levels of Th1 and Th2 cytokine mRNA. However, this treatment did not reduce airway reactivity, showing that these pathologic and physiologic measures of exacerbated disease are independent. We speculate that the reciprocal effect of the allergic response on viral immunity may benefit the host by limiting exacerbation of physiologic responses that are IFN-γ-dependent.

Keywords: fungus, virus, allergy, lung, IFN-γ

Introduction

Respiratory syncytial virus (RSV) is a common cause of infant pneumonia in winter [1]. Most children are infected for the first time by age 2, but because immunity is incomplete, there is a high frequency of re-infection [2,3], resulting in mild, cold-like symptoms in all age groups. RSV has been associated with the development of asthma [4] and allergy [5] as well as exacerbation of wheezing in asthmatic children [6]. The clinical association between RSV and asthma is supported by studies in allergen-sensitized mice: when challenged intranasally with allergen during RSV infection, mice experience increased airway reactivity, mucus production and eosinophilia [7,8].

In order to examine the reciprocal effects of RSV and allergen we examined responses in cotton rats, a species that has been used extensively to examine RSV disease pathogenesis and treatment strategies [9–12]. As allergen, we used extracts of Aspergillus fumigatus (Af), a common indoor mould that can result in hypersensitivity pneumonitis (also known as extrinsic allergic alveolitis) following repeated inhalation of Af spores. This response is largely a Type IV delayed-type hypersensitivity reaction characterized by recruitment of inflammatory cells to the alveoli (alveolitis) and formation of granulomas in the distil airways [13,14].

An acute disease sign in asthmatics or persons experiencing an allergic response in the airways is difficulty in breathing due to bronchoconstriction. This contraction of airway smooth muscle results from receptor-mediated signalling following exposure to allergens or other stimulants. In small animal models, the time taken to expel the final 36% of air from the airways and the ratio of expiratory and inspiratory air flow rates are used to calculate enhanced pause (Penh), a measure of the degree of bronchoconstriction or airway obstruction. Constriction of bronchioles can be induced by exposure to methacholine (MCh), with reactivity to low doses of MCh used as a measure of airway hyper-reactivity (AHR).

Using cockroach allergen to sensitize mice, it was established that animals infected with RSV 21 days previously had exacerbated signs of asthma. This included increased AHR, greater peribronchiolar eosinophilia and greater amounts of IL-13 in lung homogenates than uninfected animals [15]. The increase in AHR but not eosinophilia is prevented when IL-13 is neutralized. IL-13-dependent AHR is also observed in the mouse model of asthma that uses ovalbumin as allergen [16]. In contrast, mice infected with RSV at the time of (or soon after) allergen challenge have increased AHR without increases in Th2-type cytokine expression [17]. Under these conditions the exacerbated AHR is IL-13-independent [18]. The mechanisms that contribute to RSV-exacerbated airway disease during acute infection are therefore distinct from IL-13-dependent AHR, and need to be clarified in order to design effective treatment strategies that are likely to prevent RSV-exacerbated asthma.

In this report we sensitize cotton rats to Af and demonstrate for the first time that the allergic response has an effect on viral pathogenesis. This is not altogether unexpected: the allergen-specific response is characteristically a Th2-type response, with induction of cytokines known to influence the expression of Th1-type cytokines, including IFN-γ, an important mediator of the host's defence against RSV [19]. Reduced expression of mRNA for IFN-γ was indeed observed, with consequent delay of viral clearance.

Methods

Animals

Inbred cotton rats (Sigmodon hispidus) of both sexes were obtained from the breeding colony at Virion Systems, Inc. and used at 4–10 weeks of age. Animals were housed in standard polycarbonate rat cages and fed rodent chow and water. Sentinel cotton rats were monitored for common rodent pathogens and remained pathogen-free. All experiments were performed according to protocols following federal guidelines and approved by the institutional Animal Care and Use Committee. The cotton rats were sacrificed by CO2 asphyxiation before obtaining tissue samples.

Sensitization and challenge with Af extract

To sensitize cotton rats to Af, each animal was sedated with 3% isoflurane and inoculated intraperitoneally (i.p.) with 1 mg of an Af allergenic extract (Hollister-Steir, Spokane, WA, USA) in 0·3 ml of saline solution. Two weeks following sensitization, cotton rats were infected or treated with control ‘mock’ preparations of virus. Two days later the animals were sedated and challenged intranasally (i.n.) with Af extract (0·1 mg per 100 g animal).

Virus preparation, infection and titration

RSV-A2 was grown and titrated on HEp-2 cell monolayers. The virus stock contained 106·5 plaque-forming units (pfu) per ml and was used at a 1/10 dilution in normal saline solution. A mock antigen preparation consisting of the supernatant of Hep-2 cells that had not been inoculated with virus was used at the same dilution. Sedated animals were inoculated i.n. with 100 μl of a 1/10 dilution of virus stock or mock preparation per 100 g cotton rat (final dose of 104·5 pfu/100 g). To titrate virus in lung samples, tissue was homogenized in 3 ml Hanks buffered saline solution (Biofluids, Gaithersburg, MD, USA) containing 10% SPG (0·218 M sucrose, 4·4 mM glutamate, 3·8 mM KH2PO4 and 7·2 mM K2HPO4). The cellular debris was removed by centrifugation and the supernatants snap-frozen and stored at − 70°C. Ten-fold dilutions of each homogenate or virus stock were used to inoculate HEp-2 monolayers in 24-well plates. After 1 h incubation at 37 °C, the inoculums were replaced with a solution of DMEM-1%FCS containing 2·7% methylcellulose. The plates were incubated for 4 days, the methylcellulose overlay removed and the cells stained with a 0·08% crystal violet in 10% glutaraldehyde. Plaques were counted and are reported as the number of pfu per ml of homogenate.

Administration of antiviral and anti-inflammatory therapies

Recombinant cotton rat IFN-γ (R & D Systems, Minneapolis, MN, USA) was administered by intraperitoneal injection at 12-h intervals on days 2 and 3 post-infection to give 1 μg IFN-γ per 100 g of animal per day (0·25 ml of 2 µg/ml solution per inoculation). Palivizumab (Synagis®), a humanized monoclonal antibody (mAb) with specificity for the F protein of RSV was kindly provided by MedImmune Inc. (Gaithersburg, MD, USA), and 1·5 mg of this preparation administered intramuscularly (i.m.) per 100 g animal on day 2 post-infection. Methylprednisolone (Solumedrol®; Pharmacia and Upjohn, Kalamazoo, MI, USA) was administered i.p. on days 2 and 3 post-infection. The short half-life of this steroid required that a dose of 0·1 mg/100 g animal be administered every 6 h to give a final dose of 0·4 mg/100 g cotton rat per day.

Study protocol

The study protocol is shown in Fig. 1. Cotton rats were divided into groups that were: (i) sensitized and then challenged with allergen; (ii) sensitized and infected (or inoculated with mock or inactivated virus preparations) prior to challenge with allergen; or (iii) sensitized and infected with RSV prior to allergen challenge with treatments initiated at the time of allergen challenge. Sensitization to Af took place 14 days before infection and animals were challenged 2 days after infection. Four to six mice from each group underwent methacholine challenge and analysis of pathology and cytokine mRNA expression on day 2 after allergen challenge. This is equivalent to day 4 post-infection.

Fig. 1.

Fig. 1

Study protocol time line. Day 0 is shown as the day of infection with RSV. In sensitized groups of animals, Af was administered at day 14 and challenged intranasally with Af 16 days later (i.e. 2 days after RSV infection). Respiratory, pathologic and cytokine measurements were made on day 4 post-infection (i.e. 2 days following Af challenge). Treatment with Palivizumab (shown as ‘P’) was by i.m. inoculation on day 2 post-infection; treatment with steroid (methylprednisolone, shown as ‘S’) was by i.p. inoculation at 6-h intervals starting on day 2 post-infection; treatment with IFN-γ (shown is ‘I’) was by i.p. inoculation at 12-h intervals starting on day 2 post-infection.

Histopathology

Lungs were inflated with 10% formalin and stored in the same fixative for at least 24 h prior to paraffin-embedding. Five to seven micron sections were stained with haematoxylin and eosin (H&E) for routine light microscopic evaluation. Granulomas were identified as a cluster of six or more macrophages and the number counted manually in a section of the lower right lung lobe. The average number of granulomas in six individual animals is reported for each group. The amount of alveolitis (inflammatory cells in alveoli) was scored on a scale of 0–4, with 0 being no inflammation and 4 being extensive inflammation throughout the entire section. As the number of granulomas was proportional to the severity of other inflammatory changes, the mean numbers of granulomas per section were used as a quantitative measure of disease severity. The number of mucin-producing cells was evaluated in periodic-acid Schiff (PAS)-stained sections. Hemosiderosis was evaluated in sections stained with Prussian blue. All sections were stained by Histoserv (Rockville, MD, USA). Slides were evaluated in a blinded manner.

Airway measurements

Animals underwent unrestrained whole-body flow plethysmography (Buxco Electronics Inc., Wilmington, NC, USA) while challenged with increasing concentrations (0, 5, 10 and 20 mg/ml) of MCh (Sigma, St Louis, MO, USA) that was delivered as aerosol over 2 min using ultrasonic nebulization. Airway measurements taken over the subsequent 5 min included respiratory rates, lung volumes, flow rates and pause, a calculated measure of the time it takes to expire the remaining 36% of the total expiratory flow. In addition, enhanced pause (Penh, the product of pause and ratio of expiratory and inspiratory flow rates) was recorded. The average of each value over the 5-min period was used to calculate the percentage increase in Penh from baseline reading (response to saline solution that is used as the diluent for MCh), i.e. percentage increase in Penh = (PenhMCh-Penhsaline)/Penhsaline. The percentage increase in Penh therefore reflects general difficulty in breathing that includes airway constriction.

Cytokine analysis

The lingular lobe of each lung was snap-frozen in liquid N2 and stored at − 70°C until ready for RNA isolation. Total RNA was isolated from homogenized samples using the RNeasy system (Qiagen, Germantown, MD, USA) according to the manufacturer's instructions. First strand cDNA synthesis utilized 1 μg of total RNA, oligo dT primer and Superscript II RNase H- reverse transcriptase (Invitrogen, Carlsbad, CA, USA). Subsequent PCR reactions were performed using 3 μl of cDNA in a 25 μl total reaction volume with primers that amplify β-actin, IL-4, IL-5, IL-10, IL12p35, IL12p40, IP-10 and IFN-γ-specific sequences described previously [20,21]. IL-13 amplification over 33 cycles used forward primer AGTCTTCAGTTTAAGCCA GCTTAC and reverse primer TTTTCAATGGAAGGTACCACAGCGG at an annealing temperature of 56 °C. Following amplification, PCR products were separated by 1% agarose gel electrophoresis at 80 V, transferred to Hybond N+ nylon membrane (Amersham Pharmacia, Piscataway, NJ, USA), and immobilized by UV cross-linking. Hybridization and washing of the Southern Blots was performed according to the manufacturer's recommendations and used fluorescein-conjugated DNA probes. These probes were made using primers previously described [20,21] and an IL-13-specific primer CAATGAGACGGTGAGGCTTCCTGTTCC. PCR products were visualized by autoradiography using an antifluorescein horseradish peroxidase-conjugated antibody and ECL substrate system (Amersham Pharmacia). The RNA content in the samples was normalized by comparing signals generated by amplification of β-actin and the corrected intensity of each band used as a semiquantitative measure of the amount of mRNA present for each cytokine.

Statistical analysis

Histopathological pulmonary changes were scored based upon the average number of granulomas per standard section of right lung lobe within a treatment group. Statistical significance of group means was determined using an independent samples Student's t-test. Differences in virus titre between groups were assessed by comparing the logarithmic transformed number of pfu/ml in a Student's t-test. The effect of virus infection and each treatment on airway measurements and relative amounts of cytokines present was analysed by paired samples t-tests. The proportions of animals infected in different groups were compared using the chi-squared test. Statistically significant differences had P < 0·05.

Results

Allergic response to Af in cotton rats

Cotton rats were sensitized by i.p. exposure to a single dose of 1 mg Af allergen extract in the absence of adjuvant. Sixteen days later the animals were challenged intranasally (i.n.) with 100 μg allergen and local pathology and cytokine responses examined 2 days later. H/E stained lung sections showed the formation of granulomas in terminal and respiratory bronchioles, and infiltration of eosinophils in alveoli and parenchymal regions associated with the granulomas (Fig. 2). This type of granuloma formation is characteristic of Type IV delayed-type hypersensitivity reactions observed after A. fumigatus inhalation [14]. Peribronchiolar and perivascular accumulation of lymphocytes and eosinophils was minimal to absent. Analysis of the types of cytokine mRNA expression induced in the lungs of these animals demonstrated statistically significant increases in the amounts of mRNA for Th2-type cytokines IL-4, IL-5 and IL-13 (Fig. 3). Changes in IL-10 and IFN-γ mRNA levels were not significantly different from naïve animals.

Fig. 2.

Fig. 2

Histopathology in Af-challenged cotton rats. Photomicrographs of H&E-stained lung sections from (a) non-sensitized animals, (b) animals sensitized to and challenged with Af, and (c) sensitized animals challenged with Af and infected with RSV. Lesions in (b) include granuloma formation (arrow) in association with terminal and respiratory bronchioles and infiltration of alveoli with eosinophils. Minimal perivascular and peribronchiolar accumulations of lymphocytes and eosinophils are observed. Inflammation was significantly enhanced by RSV infection (c), with increased granuloma formation and increased eosinophilic infiltration of alveoli. In addition, increased perivascular and peribronchiolar accumulation of lymphocytes and eosinophils was observed. The bar length represents 130 μm.

Fig. 3.

Fig. 3

Induction of Th2 type cytokines in Af-challenged cotton rats. Average cytokine mRNA levels (with SE) in the lungs of cotton rats that were either not sensitized and challenged (0), or sensitized with Af and challenged 2 weeks later (Af). Animals were sacrificed 2 days after i.n. challenge with Af and the lingular lobe dissected for preparation of RNA. Statistically significant increases in cytokine mRNA induced in Af-responding animals compared with naïve animals are marked with *. Four animals per group were used in this experiment. Results of two repeat experiments were similar.

Responses to Af are exacerbated by RSV infection

Airway hyper-reactivity (AHR) was not significant with the Af sensitization/challenge conditions used; only small increases in enhanced pause (Penh) were measured by plethysmography after exposure to MCh. However, when challenged with Af during RSV infection, the percentage increase in Penh was consistently increased (Fig. 4), showing exacerbated airway reactivity. This increased responsiveness was dependent on virus replication as UV-inactivated virus did not exacerbate the response, but was also allergen-dependent as RSV-infected animals that had not been challenged with allergen showed no increase in airway reactivity (Fig. 4).

Fig. 4.

Fig. 4

RSV infection exacerbates the allergic response in Af-sensitized cotton rats. Groups of four animals were sensitized to Af, infected with RSV or treated with a control ‘mock’ preparation or UV-inactivated RSV. An RSV-infected group that was not sensitized to Af was also set up. Two days after virus infection the cotton rats were challenged with Af and airway reactivity to 0, 5, 10 and 20 mg/ml MCh measured by whole body flow plethysmography at 4 days post-infection. The results are shown as the average percentage increase in enhanced pause (Penh) at 10 mg/ml MCh with SEM shown for each group. Repeat experiments showed similar results. The percentage increase in Penh was statistically significant (P≤ 0·05) for the Af-sensitized RSV-infected group (marked with*) compared with any of the other Af-sensitized groups as well as the non-sensitized RSV-infected group.

In addition to increased airway reactivity, RSV-infection also exacerbated the allergic inflammatory response. As in previous studies [22], granuloma formation was not evident and peribronchiolitis was mild in non-sensitized RSV-infected cotton rats (results not shown). The number of granulomas formed in the terminal and respiratory bronchioles was greater in Af-challenged animals that were infected with RSV than in those that were Af-challenged but not infected (Fig. 2). In addition to increased numbers of granulomas, the severity of alveolar eosinophilic infiltration, and the magnitude of peribronchiolar and perivascular accumulation of lymphocytes and eosinophils, was increased in RSV-infected cotton rats (Fig. 2c, 5b, c). Greater production of mucin was evident in the small airways after Af challenge in RSV-infected than uninfected animals (results not shown). The severity of RSV-enhanced inflammation was accompanied by the unique expression of sporadic intra-alveolar haemorrhage with erythrophagocytosis by alveolar macrophages (Fig. 5d).

Fig. 5.

Fig. 5

Features of histopathology in lungs of Af-sensitized animals that were challenged with allergen during RSV infection. (a) Granulomatous lesion at the terminal bronchiole. The bar length is equivalent to 60 μm. (b) Eosinophilic infiltration of bronchiolar epithelium and surrounding adventitia. The bar length is equivalent to 30 μm. (c) Eosinophilic alveolar infiltrates in pulmonary parenchyma associated with granulomas (upper right and lower left). The bar length is 30 μm. (d) Alveolar haemorrhage with erythophagocytosis by alveolar macrophages (arrows). The bar length is equivalent to 25 μm.

The presence of replicating RSV did not alter relative levels of the allergen-induced IL-4 and IL-5 mRNA, but did increase the level of IL-13 mRNA during Af challenge (Fig. 6). However, this increase was not statistically significant.

Fig. 6.

Fig. 6

Cytokine mRNA induced in the lungs of Af-sensitized animals that are either not infected, infected with RSV, treated with UV-inactivated RSV or a mock preparation of virus. Non-sensitized uninfected and infected controls are also shown. The results shown are the average relative quantity of cytokine mRNA in the lingular lung lobe of four animals/group. A repeat experiment showed similar cytokine mRNA induction. The relative amount of IFN-γ induced in RSV-infected Af-challenged CR was statistically greater than in uninfected Af-challenged animals, but less than the amount detected in RSV infected animals that were not responsive to allergen (*, P < 0·05).

RSV infection is prolonged during allergen challenge

Virus titres were measured in the noses and lungs of animals on day 4 post-infection with or without challenge with Af. No statistical differences in RSV titres were measured in either lungs or noses of non-sensitized and Af-challenged infected animals. However, when the kinetics of virus clearance was followed, it was clear that virus replication was prolonged in the noses of animals that had been challenged with Af (Table 1): virus was isolated from the noses of 33% of animals that were not sensitized to Af on day 5 and from none of the nose samples in this group on day 6 post-infection. In contrast, all animals challenged with Af retained virus on day 5 and 66% had virus isolated from nose homogenates on day 6 post-infection. Complete clearance of virus in all Af-challenged animals was not observed until day 7 post-infection. The number of allergen-challenged animals with virus present in nose homogenates on either day 5 or 6 was statistically greater than in animals that were not challenged with allergen (P < 0·05, chi-squared test).

Table 1.

Virus titres and clearance from noses of cotton rats infected with RSV in the presence or absence of an allergic response.

GMT (log10pfu/ml)b of virus in groups exposed to Percentage of animalsc with virus in groups exposed to


Day post-infectiona 0/RSV/0 Af/RSV/Af 0/RSV/0 Af/RSV/Af
4 3·7 ± 0·4 3·3 ± 0·4 100 100
5 3·0 ± 0·0 3·6 ± 0·4 33 100
6 0 2·2 ± 0·2 0 66
7 0 0 0 0
a

Groups of animals were infected with RSV without sensitization and challenge (0/RSV/0) or sensitized with Af, infected with RSV 14 days later and then challenged with Af 2 days later (Af/RSV/Af).

b

Geometric mean titres are shown as log10 pfu/ml. Each nose preparation includes nasal turbinates and associated tissue that was ground and suspended in 3 ml HBSS containing 10% SPG. The cellular and bony debris was pelleted and only the supernatant was used in the plaque assay.

c

Six animals were used at each time point.

Animals infected with RSV demonstrated a typical Th1-type cytokine response, with prominent induction of IFN-γ mRNA (Fig. 6). Challenge of the RSV-infected group with Af resulted in induction of less IFN-γ mRNA than in animals without a concomitant allergic response. The reduced IFN-γ mRNA in RSV-infected Af-challenged animals suggested that the allergen-specific Th2 type milieu suppresses the Th1-type response, and correlates with the slower clearance of RSV in Af-challenged animals.

Addition of recombinant IFN-γ relieves RSV-exacerbated allergic inflammation but not airway hyper-reactivity

As exacerbation of airway reactivity required RSV replication, we hypothesized that treatments to limit the amount of virus present would reduce airway reactivity and alveolitis. Palivizumab is a monoclonal antibody preparation that inhibits virus infection when administered either prophylactically or therapeutically [11]. A group of RSV-infected cotton rats that was treated with palivizumab 2 days after infection, and then challenged with Af, did not show signs of exacerbated disease on day 4 post-infection: virus titres were significantly reduced, responsiveness to MCh was significantly less than in the RSV-infected untreated allergic animals, and although the number of granulomas was greater than uninfected allergic animals, there were significantly fewer than in untreated RSV-infected animals (Fig. 7). AHR was dependent on the inflammatory response and not a direct consequence of virus itself as treatment with a steroid that significantly reduced the cellular infiltrate but did not reduce virus replication, prevented exacerbation of AHR in RSV-infected Af-challenged animals (Fig. 7). Interestingly, the remaining granulomas in the steroid-treated group demonstrated haemosiderosis (not shown). Treatment with both the antiviral and anti-inflammatory agent clearly reduced all parameters of disease: virus titres, inflammation and AHR. Significant reduction in PAS-staining was only evident when cotton rats were treated with a combination of antiviral and steroid agents (results not shown).

Fig. 7.

Fig. 7

Measurement of (a) virus titres, (b) inflammation and (c) airway reactivity in RSV-infected Af-challenged animals that were treated with monoclonal antibody palivizumab (mAb), methylprednisolone (steroid), a combination of mAb and steroid, or recombinant IFN-γ. Groups of Af-sensitized animals (six cotton rats per group) were: not infected (inoculated with a mock preparation) and left untreated; not infected and treated with IFN-γ; infected with RSV and left untreated, RSV-infected and treated with mAb; RSV-infected and treated with steroid; RSV-infected and treated with a combination of mAb and steroid; RSV-infected and treated with IFN-γ. All groups (including those not infected) were challenged with Af. (a) Virus titres (average plaque-forming units (pfu) per ml in six infected animals) are shown for homogenates of lungs (filled bars) and noses (open bars). Virus was recovered from all animals except those treated therapeutically with mAb (alone or in combination with steroid). (b) Numbers of granulomatous lesions in each group. The number of granulomas counted in one right lung lobe is presented as the average number per lobe from a group of six cotton rats. (c) Airway reactivity in RSV-infected Af-challenged animals in each treatment group. The results show the average percentage increase in Penh after exposure to MCh at 20 mg/ml from baseline (exposure to saline solution) for six animals per group. Standard error bars are shown.

As it is known that IFN-γ contributes to control of RSV replication [19], it seemed likely that the suppression of the Th1-type response during the allergic response might in fact worsen disease by causing prolonged virus replication. We therefore supplemented the amount of IFN-γ available during the response by administering recombinant cytokine to infected animals, and examined the degree of inflammation and responsiveness to MCh in these animals following Af-challenge. Virus titres in lung homogenates prepared on day 4 post-infection were not significantly different in IFN-γ-treated and untreated animals. However, the inflammation observed in the lungs of treated animals was significantly less than untreated animals (Fig. 7b). Surprisingly, even though inflammation and relative Th2-type mRNA cytokine levels were similar to those observed in palivizumab-treated animals, RSV-exacerbated airway reactivity was not diminished by IFN-γ treatment (Fig. 7c).

Reduced levels of mRNA for Th2-type cytokines correlate with reduced allergic inflammation but not AHR

To further our understanding of mechanisms that may contribute to RSV-exacerbated inflammation and AHR, we measured mRNA levels of cytokines in lungs (six animals per group) by semiquantitative RT-PCR. We compared expression levels of mRNA for IL-4, IL-5, IL-10, IL-12, IL-13, IFN-γ and IFN-γ-inducible protein 10 (IP-10 or CXCL10) in infected animals that had been treated with either antiviral, steroid, combined antiviral and steroid or recombinant IFN-γ (Fig. 8). IL-4 mRNA levels were not altered by any of the treatments (results not shown). Each of the therapies had reduced levels of mRNA for Th2-type cytokines IL-5 and IL-13, raising the possibility that these may contribute to RSV-exacerbated inflammation. This role may, however, be small as the inflammatory response in RSV-infected animals treated with palivizumab or IFN-γ was still greater than uninfected animals, suggesting that chemokines and cytokines induced at the time of infection (prior to antiviral treatment) were sufficient to recruit and activate inflammatory cells.

Fig. 8.

Fig. 8

Cytokine mRNA induction in Af-challenged animals following treatment with palivizumab (mAb) and methylprednisolone (steroid). Groups of Af-sensitized animals (six cotton rats per group) were: not infected (inoculated with a mock preparation) and left untreated; not infected and treated with recombinant IFN-γ; infected with RSV and left untreated, RSV-infected and treated with mAb; RSV-infected and treated with steroid; RSV-infected and treated with a combination of mAb and steroid; RSV-infected and treated with recombinant IFN-γ. All groups (including those not infected) were challenged with Af. The relative levels of cytokine mRNA were measured as described in the Methods.

The inflammatory response in the IFN-γ-treated group of animals was reduced to a similar level as in the palivizumab-treated group, but continued to exhibit exacerbated AHR. This shows that increased AHR was not dependent on the level of Th2-type or degree of inflammation; hence, other mechanisms must control the increased responsiveness to MCh. This increase did not correlate with increased induction of any one particular cytokine mRNA, but instead coincided with the presence of IFN-γ that was induced by virus infection or administered as recombinant protein. Evidence of biologically active IFN-γ in cotton rats treated with IFN-γ was clear from the dramatic suppression of cytokines IL-10 and IL-12p40 that are regulated by it (Fig. 8).

Discussion

The immune response to primary RSV infection fails to prevent re-infection, and therefore this virus continues to cause illness throughout life that is a direct consequence of infection or the subsequent host response. In this report, we demonstrate for the first time that the allergic response has a negative effect on viral pathogenesis: virus-dependent IFN-γ was reduced and virus clearance delayed.

The diminished virus-specific Th1-type response was not altogether unexpected: the allergen-specific response is characteristically a Th2-type response, with induction of cytokines known to suppress the induction of Th1 type cytokines. This was indeed the case for the allergic response to Af: mRNA for Th2-type cytokines IL-5 and IL-13 were induced in the lungs within 2 days of allergen challenge. In the allergen-challenged animals, inflammatory responses in the lower respiratory tract included granuloma formation and eosinophilic infiltration, characteristics of inflammation observed in patients with hypersensitivity pneumonitis [23,24] and in a murine model of hypersensitivity pneumonitis that uses Saccharapolyspora rectivirgula as antigen [25]. In our model, granulomas were not observed in non-sensitized, RSV-infected cotton rats, showing that this was indeed an Af-driven response.

Both airway reactivity to MCh and the inflammatory response to Af were exacerbated when animals were infected with RSV. These increases corresponded with virus replication, and coincided with increased induction of mRNA for IFN-γ during virus infection. Importantly, there was a reciprocal effect of the allergic response on virus, resulting in reduced virus clearance. This most likely occurred through down-regulation of the virus-specific IFN-γ response by the allergen-specific Th2-type response.

In a mouse model of asthma, IL-13 that is produced by either antigen-specific T cells or natural killer T cells is sufficient to induce airway reactivity [26]. In our model, IL-13 may very well play a role in the increased inflammatory response that is observed following RSV-infection as antiviral or steroid treatment that reduced inflammation also reduced IL-13 mRNA levels. However, it is unlikely to be the sole contributor to the enhanced inflammatory response: while inflammation was dramatically reduced by steroid treatment, the reduction in the number of granulomas in palivizumab-treated animals, despite having no virus replication and reduced IL-13 mRNA, was still significantly greater than uninfected animals undergoing an allergic response. Prior studies show that palivizumab effectively prevents disease when administered before infection but does not prevent inflammation when administered therapeutically [11,12], suggesting that chemokines induced early after infection are sufficient to support the inflammatory response. In the experiments described in this report, palivizumab was administered 2 days following infection and therefore it is not surprising that much of the inflammatory response is retained.

While IL-13 may contribute to inflammation, it is not likely to contribute to exacerbated airway reactivity in the RSV-infected Af-challenged cotton rats as supplementation with an exogenous source of IFN-γ retained increased AHR despite reduced IL-13 mRNA levels. This idea is supported by studies of allergen-induced AHR in RSV-infected mice where physiologic changes are not prevented by treatment with an IL-13 inhibitor [18]. In contrast, AHR that is measured during primary RSV infection of very young mice is IL-13 dependent [27]. This reflects age-dependent differences in the size of the airways: the smaller airways of neonates are more easily obstructed by inflammatory cells and mucus. IL-13-dependent AHR is also observed following secondary infection of mice that were first exposed to RSV as neonates; this may reflect the virus-specific Th2-type response induced in very young animals. Clearly different treatment strategies that target the relevant aetiology need to be designed for RSV-exacerbated asthma.

Our study shows that the inflammatory response and AHR are independent responses. This is not the first study to suggest that these are independent processes: both clinical [28] and animal studies [29] have demonstrated that this is the case. What supports exacerbation of AHR in the absence of inflammation? In our model, the presence of IFN-γ correlates with AHR: even though the relative amount of IFN-γ mRNA present after virus infection was reduced by the allergen-specific response, the most profound and reproducible difference between uninfected and RSV-infected Af-challenged animals was the presence of increased amounts of IFN-γ mRNA in the lungs of infected animals. In addition, both AHR and IFN-γ mRNA levels were reduced following treatment with either antiviral or steroid, but AHR was not reduced in animals that were treated with recombinant IFN-γ.

Our report does not address the mechanism by which IFN-γ supports AHR. It may have a direct effect, as IFN-γ receptors are present on airway smooth muscle. These can signal the release of factors that play a role in contraction [30], or induce increased expression of leukotriene receptors that influence muscle response [31]. Alternatively, IFN-γ may contribute indirectly through the down-regulation of IL-12 that has a protective effect on AHR [32], or suppression of IL-10; its anti-inflammatory properties are known to reduce the severity of hypersensitivity pneumonitis in mice [33]. When such protective cytokines are absent, other cytokines or chemokines that have sustained expression may facilitate increased airway reactivity. Examples of soluble mediators that have sustained expression in our model are IL-4 and IP-10, an interferon-inducible chemokine that is known to contribute to airway reactivity [34]. However, it is unlikely that either IL-4 or IP-10 are the sole factors responsible for exacerbated AHR in this system as animals treated with steroid have decreased AHR but retain induction of both IL-4 and IP-10 mRNA. While the reduced IFN-γ response in allergen-challenged animals probably results in a delay in viral clearance, our results suggest that this suppression may benefit the host by limiting the IFN-γ-dependent increase in AHR.

In summary, we describe a model of RSV-exacerbated allergen-induced inflammation and AHR in cotton rats. We demonstrate that the host responses to virus and allergen have reciprocal effects on one another, with virus-induced IFN-γ correlating with exacerbated inflammation and AHR, and allergen-induced Th2-type milieu coinciding with reduced IFN-γ mRNA induction and reduced viral clearance. Further experiments to define the mechanisms responsible for RSV-exacerbated airway reactivity may lead to treatments that protect asthmatics against acute episodes of virus-induced disease.

Acknowledgments

We thank Jorge Blanco, Luba Pletneva and Marina Boukhvalova, who established conditions for amplication of cotton rat cytokine genes, and Sally Hensen, Charles Smith, Fredy Rivera and Lorraine Ward for technical support. A.H. appreciates mentoring from Barbara Hoberman and Ken Weiner at Montgomery County College. These studies were supported by corporate funds from Virion Systems Inc. A.H. was supported by NIH Bridges Grant R25 G063993-02.

References

  • 1.Glezen P, Denny FW. Epidemiology of acute lower respiratory disease in children. N Engl J Med. 1973;288:498–505. doi: 10.1056/NEJM197303082881005. [DOI] [PubMed] [Google Scholar]
  • 2.Hall CB, Walsh EE, Long CE, Schnabel KC. Immunity to and frequency of reinfection with respiratory syncytial virus. J Infect Dis. 1991;163:693–8. doi: 10.1093/infdis/163.4.693. [DOI] [PubMed] [Google Scholar]
  • 3.Henderson FW, Collier AM, Clyde WA, Jr, Denny FW. Respiratory-syncytial-virus infections, reinfections and immunity. A prospective, longitudinal study in young children. N Engl J Med. 1979;300:530–4. doi: 10.1056/NEJM197903083001004. [DOI] [PubMed] [Google Scholar]
  • 4.Sigurs N, Bjarnason R, Sigurbergsson F, Kjellman B. Respiratory syncytial virus bronchiolitis in infancy is an important risk factor for asthma and allergy at age 7. Am J Respir Crit Care Med. 2000;161:1501–7. doi: 10.1164/ajrccm.161.5.9906076. [DOI] [PubMed] [Google Scholar]
  • 5.Frick OL, German DF, Mills J. Development of allergy in children. I. Association with virus infections. J Allergy Clin Immuno. 1979;63:228–41. doi: 10.1016/0091-6749(79)90106-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.McIntosh K, Ellis EF, Hoffman LS. The association of viral and bacterial respiratory infections with the exacerbation of wheezing in young asthmatic children. J Pediatr. 1973;82:578–90. doi: 10.1016/S0022-3476(73)80582-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Schwarze J, Hamelmann E, Bradley KL, Takeda K, Gelfand EW. Respiratory syncytial virus infection results in airway hyperresponsiveness and enhanced airway sensitization to allergen. J Clin Invest. 1997;100:226–33. doi: 10.1172/JCI119516. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Schwarze J, Cieslewicz G, Joetham A, Ikemura T, Makela MJ, Dakhama A, et al. Critical roles for interleukin-4 and interleukin-5 during respiratory syncytial virus infection in the development of airway hyperresponsiveness after airway sensitization. Am J Respir Crit Care Med. 2000;162:380–6. doi: 10.1164/ajrccm.162.2.9903057. [DOI] [PubMed] [Google Scholar]
  • 9.Prince GA, Jenson AB, Horswood RL, Camargo E, Chanock RM. The pathogenesis of respiratory syncytial virus infection in cotton rats. Am J Pathol. 1978;93:771–91. [PMC free article] [PubMed] [Google Scholar]
  • 10.Prince GA, Hemming VG, Horswood RL, Chanock RM. Immunoprophylaxis and immunotherapy of respiratory syncytial virus infection in the cotton rat. Virus Res. 1985;3:193–206. doi: 10.1016/0168-1702(85)90045-0. [DOI] [PubMed] [Google Scholar]
  • 11.Prince GA, Mathews A, Curtis SJ, Porter DD. Treatment of respiratory syncytial virus bronchiolitis and pneumonia in a cotton rat model with systemically administered monoclonal antibody (Palivizumab) and glucocorticosteroid. J Infect Dis. 2000;182:1326–30. [Google Scholar]
  • 12.Ottolini MG, Curtis SJ, Porter DD, Mathews A, Richardson JY, Hemming VG, et al. Comparison of corticosteroids for treatment of respiratory syncytial virus bronchiolitis and pneumonia in cotton rats. Antimicrobial Agents Chemotherapy. 2002;46:2299–302. doi: 10.1128/AAC.46.7.2299-2302.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Yocum MW, Saltzman AR, Strong DM, et al. Extrinsic allergic alveolitis after Aspergillus fumigatus inhalation. Evidence of a type IV immunologic pathogenesis. Am J Med. 1976;61:939–45. doi: 10.1016/0002-9343(76)90419-8. [DOI] [PubMed] [Google Scholar]
  • 14.Salvaggio JE. Recent advances in pathogenesis of allergic alveolitis. Clin Exp Allergy. 1990;20:137–44. doi: 10.1111/j.1365-2222.1990.tb02658.x. [DOI] [PubMed] [Google Scholar]
  • 15.Lukacs NW, Tekkanat KK, Berlin A, et al. Respiratory syncytial virus predisposes mice to augmented allergic airway responses via IL-13-mediated mechanisms. J Immunol. 2001;167:1060–5. doi: 10.4049/jimmunol.167.2.1060. [DOI] [PubMed] [Google Scholar]
  • 16.Wills-Karp M, Luyimbazi J, Xu X, et al. Interleukin-13: central mediator of allergic asthma. Science. 1998;282:2258–61. doi: 10.1126/science.282.5397.2258. [DOI] [PubMed] [Google Scholar]
  • 17.Peebles RS, Sheller JR, Collins RD, et al. Respiratory syncytial virus infection does not increase allergen-induced type 2 cytokine production, yet increases airway hyperresponsiveness in mice. J Med Virol. 2001;63:178–88. [PubMed] [Google Scholar]
  • 18.Park JW, Taube C, Yang ES, et al. Respiratory syncytial virus-induced airway hyperresponsiveness is independent of IL-13 compared with that induced by allergen. J Allergy Clin Immunol. 2003;112:1078–87. doi: 10.1016/j.jaci.2003.08.046. [DOI] [PubMed] [Google Scholar]
  • 19.van Schaik SM, Obot N, Enhorning G, et al. Role of interferon gamma in the pathogenesis of primary respiratory syncytial virus infection in BALB/c mice. J Med Virol. 2000;62:257–66. doi: 10.1002/1096-9071(200010)62:2<257::aid-jmv19>3.0.co;2-m. [DOI] [PubMed] [Google Scholar]
  • 20.Blanco JCG, Richardson JY, Darnell MER, et al. Cytokine and chemokine gene expression after primary and secondary respiratory syncytial virus infection in cotton rats. J Infect Dis. 2002;185:1780–5. doi: 10.1086/340823. [DOI] [PubMed] [Google Scholar]
  • 21.Blanco JCG, Pletneva L, Boukhvalova M, Richardson JY, Harris KA, Prince GA. The cotton rat. An underutilized animal model for human infectious diseases can now be exploited using specific reagents to cytokines, chemokines, and interferons. J Interferon Cytokine Res. 2004;24:21–8. doi: 10.1089/107999004772719873. [DOI] [PubMed] [Google Scholar]
  • 22.Prince GA, Prieels JP, Slaoui M, Porter DD. Pulmonary lesions in primary respiratory syncytial virus infection, reinfection, and vaccine-enhanced disease in the cotton rat (Sigmodon hispidus) Laboratory Invest. 1999;79:1385–92. [PubMed] [Google Scholar]
  • 23.Coleman A, Colby TV. Histologic diagnosis of extrinsic allergic alveolitis. Am J Surg Pathol. 1988;12:514–8. doi: 10.1097/00000478-198807000-00002. [DOI] [PubMed] [Google Scholar]
  • 24.Cheung OY, Muhm JR, Helmers RA, et al. Surgical pathology of granulomatous interstitial pneumonia. Ann Diag Path. 2003;7:127–38. doi: 10.1053/adpa.2003.50018. [DOI] [PubMed] [Google Scholar]
  • 25.Denis M, Cornier Y, Laviolette M. Murine hypersensitivity pneumonitis. a study of cellular infiltrates and cytokine production and its modulation by cyclosporine A. Am J Respir Cell Mol Biol. 1992;6:68–74. doi: 10.1165/ajrcmb/6.1.68. [DOI] [PubMed] [Google Scholar]
  • 26.Meyer EH, Goya S, Akbari O, et al. Glycolipid activation of invariant T cell receptor+ NK T cells is sufficient to induce airway hyperreactivity independent of conventional CD4+ T cells. Proc Natl Acad Sci USA. 2006;103:2782–7. doi: 10.1073/pnas.0510282103. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Dakhama A, Park J-W, Taube C, et al. The enhancement or prevention of airway hyperresponsiveness during reinfection with respiratory syncytial virus is critically dependent on the age at first infection and IL-13 production. J Immunol. 2005;175:1876–83. doi: 10.4049/jimmunol.175.3.1876. [DOI] [PubMed] [Google Scholar]
  • 28.Crimi E, Spanevello A, Neri M, Ind PW, Rossi GA, Brusasco B. Dissociation between airway inflammation and airway hyperresponsiveness in allergic asthma. Am J Respir Crit Care Med. 1998;157:4–9. doi: 10.1164/ajrccm.157.1.9703002. [DOI] [PubMed] [Google Scholar]
  • 29.Poynter ME, Cloots R, van Woerkom T, et al. NF-kB activation in airways modulates allergic inflammation but not hyperresponsiveness. J Immunol. 2004;173:7003–9. doi: 10.4049/jimmunol.173.11.7003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Chen H, Munakata M, Amishima M, Ukita H, Masaki YY, Homma Kawakami Y. Gamma-interferon modifies guinea pig airway functions in vitro. Eur Respir J. 1994;7:74–80. doi: 10.1183/09031936.94.07010074. [DOI] [PubMed] [Google Scholar]
  • 31.Amrani Y, Moore PE, Hoffman R, Shore SA, Panettieri RA., Jr Interferon-gamma modulates cysteinyl leukotriene receptor-1 expression and function in human airway myocytes. Am J Respir Crit Care Med. 2001;164:2098–101. doi: 10.1164/ajrccm.164.11.2108005. [DOI] [PubMed] [Google Scholar]
  • 32.Gavett SH, O'Hearn DJ, Li X, Huang S-K, Finkelman FD, Wills-Karp M. Interleukin 12 inhibits antigen-induced airway hyperresponsiveness, inflammation, and Th2 cytokine expression in mice. J Exp Med. 1995;182:1527–36. doi: 10.1084/jem.182.5.1527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Gudmundsson G, Bosch A, Davidson BL, Berg DJ, Hunninghake GW. Interleukin-10 modulates the severity of hypersensitivity pneumonitis in mice. Am J Respir Cell Mol Biol. 1998;19:812–8. doi: 10.1165/ajrcmb.19.5.3153. [DOI] [PubMed] [Google Scholar]
  • 34.Medoff BD, Sauty A, Tager AM, et al. IFN-gamma-inducible protein 10 (CXCL10) contributes to airway hyperreactivity and airway inflammation in a mouse model of asthma. J Immunol. 2002;168:5278–86. doi: 10.4049/jimmunol.168.10.5278. [DOI] [PubMed] [Google Scholar]

Articles from Clinical and Experimental Immunology are provided here courtesy of British Society for Immunology

RESOURCES