Correction for Narasimha Prasad et al., Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.)

AGRICULTURAL SCIENCES. For the article “Characterization of capsaicin synthase and identification of its gene (csy1) for pungency factor capsaicin in pepper (Capsicum sp.),” by B. C. Narasimha Prasad, Vinod Kumar, H. B. Gururaj, R. Parimalan, P. Giridhar, and G. A. Ravishankar, which appeared in issue 36, September 5, 2006, of Proc Natl Acad Sci USA (103:13315–13320; first published August 28, 2006; 10.1073/pnas.0605805103), the authors note that on page 13318, right column, in Assay of CS, line 4, “1 ml of enzyme extract in 1 ml of reaction mixture” should instead read: “0.1 ml of enzyme extract in 1 ml of reaction mixture.” In addition, on page 13320, left column, in Heterologous Expression of csy1, line 6, “The forward primer ATGTTGCTGGAAATCAGTTGTCCG3 encoding MIFILTVN” should instead read: “The forward primer 5′-ATGATCTTCATTTTGACCGTAAAC-3′ encoding MIFILTVN.” Also on page 13320, in the same section, right column, first line, “transformed to DH 5α” should instead read: “transformed to BL 21.” These errors do not affect the conclusions of the article.