Regulation of the murine renal vitamin D receptor by 1,25-dihydroxyvitamin D₃ and calcium

Abstract

Renal vitamin D receptor (VDR) is required for 1,25-dihydroxyvitamin D₃-[1,25(OH)₂D₃]-induced renal reabsorption of calcium and for 1,25(OH)₂D₃-induced 1,25(OH)₂D₃ 24-hydroxylase. The long-term effect of vitamin D and dietary calcium on the expression of renal VDR was examined in the nonobese diabetic mouse. Vitamin D-deficient and vitamin D-replete mice were maintained on diets containing 0.02%, 0.25%, 0.47%, and 1.20% calcium with or without 50 ng of 1,25(OH)₂D₃ per day. Vitamin D-replete mice on a 1.20% calcium diet had renal VDR levels of 165 fmol/mg protein. Calcium restriction caused renal VDR levels to decrease to <30 fmol/mg protein in vitamin D-deficient mice and to ≈80 fmol/mg protein in vitamin D-replete mice. When dietary calcium was present, 50 ng of 1,25(OH)₂D₃ elevated the VDR levels 2- to 10-fold, depending on vitamin D status and the level of calcium. In the absence of either vitamin D or calcium, the VDR mRNA was expressed at a basal level. 1,25(OH)₂D₃ supplementation caused relative VDR mRNA to increase 8- to 10-fold in the vitamin D-deficient mouse when dietary calcium was available. This increase was completely absent in the calcium-restricted mice. This in vivo study demonstrates that 1,25(OH)₂D₃ and calcium are both required for renal VDR mRNA expression above a basal level, furthering our understanding of the complex regulation of renal VDR by 1,25(OH)₂D₃ and calcium.

The vitamin D receptor (VDR) is a nuclear protein responsible for mediating the biological actions of vitamin D. 1,25-Dihydroxyvitamin D₃ [1,25(OH)₂D₃], the functional metabolite of vitamin D, exerts its actions by binding to the VDR and altering the transcriptional rate of target genes. The protein products of these genes then carry out the functions of vitamin D, including the maintenance of serum calcium and phosphorus homeostasis, regulation of cellular proliferation and differentiation, and modulation of the immune system (1).

Studies both in vivo and in vitro have shown that the biological response to 1,25(OH)₂D₃ is directly related to the VDR content of target tissues (2, 3). Thus, understanding the regulation of the VDR is critical to our understanding of the vitamin D endocrine system. The receptor is developmentally regulated, expressed in a tissue-specific manner, and regulated by a variety of physiological factors and hormones, including calcium and 1,25(OH)₂D₃ (4).

The mechanism by which calcium and 1,25(OH)₂D₃ regulate the VDR is not known. In vitro experiments in pig kidney cells (LLC-PK1), mouse fibroblasts (3T6), rat osteosarcoma cells (Ros 17/2.8), and several human osteosarcoma cell lines (MG-63, SaOs-2, and U2-Os) have demonstrated that 1,25(OH)₂D₃ up-regulates the VDR at least partially through the activation of gene expression (5–8). Experiments studying the autoregulation of the VDR in LLC-PK1, 3T6, Ros 17/2.8, and rat intestinal epithelial (IEC-6) cells concluded that 1,25(OH)₂D₃ increases VDR content primarily through stabilization of the receptor, because little or no increase in VDR mRNA was observed (9–11). The ability of 1,25(OH)₂D₃ to increase VDR content in vivo was first demonstrated by Costa and Feldman (12), who noted that s.c.-injected 1,25(OH)₂D₃ significantly up-regulated renal VDR, while having minimal effect on duodenal VDR. Subsequent experiments have demonstrated that whereas 1,25(OH)₂D₃ and calcium do not impact expression of the VDR in the intestine, they do regulate VDR expression in the parathyroid gland and kidney (10, 13–15). In rat kidney, vitamin D₃ or 1,25(OH)₂D₃ supplementation has been shown to increase VDR content up to 5-fold, as long as dietary calcium is present (14, 16, 17). Whereas multiple reports have concluded that renal VDR mRNA is not altered by 1,25(OH)₂D₃ (10, 13), Brown et al. (18) observed a modest induction of VDR mRNA in rats fed a high-calcium diet.

Expression of renal VDR is required for 1,25(OH)₂D₃-mediated renal reabsorption of calcium, an important mechanism in the regulation of serum calcium. Additionally, the metabolism of 1,25(OH)₂D₃ is influenced by renal VDR expression. This article describes a study on the long-term effects of vitamin D status and dietary calcium on renal VDR expression in mice.

Materials and Methods

Chemicals. 1,25(OH)₂D₃ was acquired from Tetrionics (Madison, WI). 1,25(OH)₂[26,27-³H]D₃ was purchased from Perkin–Elmer (Boston).

Mice and Diets. Nonobese diabetic mice were obtained from The Jackson Laboratory. Diabetic mice (serum glucose >300 mg/dl) were excluded from this study, although diabetes incidence did not affect the parameters studied. Breeding pairs were maintained on LabDiet mouse diet 5015 (PMI Nutrition International, St. Louis). For vitamin D-deficiency studies, visibly pregnant females were transferred into separate housing in which all fluorescent lighting was shielded, preventing the endogenous production of vitamin D₃. These females were fed a 1.20% calcium diet lacking vitamin D. Male and female offspring were randomly weaned onto purified diet that contained 0.02%, 0.25%, 0.47%, or 1.20% calcium. This diet was fortified with Wesson oil containing vitamins A, E, and K. For each dietary calcium level, there was a control group that did not receive dietary 1,25(OH)₂D₃, and an experimental group that received 50 ng of 1,25(OH)₂D₃ daily, based on consumption of 3.5 g per mouse per day. Vitamin D-replete mouse studies were conducted with mice that were housed under fluorescent lighting. The purified diet in these studies [0.02%, 0.25%, 0.47%, and 1.20% calcium with or without 50 ng of 1,25(OH)₂D₃] was fortified with oil containing vitamins A, D, E, and K. Mice were maintained on purified diets for 200 days, except for the calcium-restricted, vitamin D-deficient mice, which were killed after 3 weeks on purified diet to prevent death by hypocalcemic tetany. Experimental protocols were reviewed and approved by the Research Animal Resources Center (University of Wisconsin, Madison).

Serum Analysis. Mice were bled biweekly and serum calcium was determined by atomic absorption spectrometry. At death, serum was isolated and 1,25(OH)₂D₃ levels were determined by a competitive binding assay (19) optimized for mouse serum. Briefly, 0.2 ml of mouse serum was extracted with ethyl acetate. After removal of the ethyl acetate, the residue was resuspended in 4% 2-propanol in hexane. The extract was applied to a Sep-Pak Plus silica cartridge (Waters), and was washed with 5% 2-propanol in hexane to remove the 25-hydroxyvitamin D₃ and 24,25-dihydroxyvitamin D₃. The 1,25(OH)₂D₃ was eluted with 8% 2-propanol in hexane, dried, and resuspended in ethanol. This sample was then used in a competitive binding assay performed with a fixed amount of 1,25(OH)₂[26,27-³H]D₃ and recombinant rat VDR. Serum samples spiked with 1,25(OH)₂[26,27-³H]D₃ were processed and used to determine the percentage recovery.

Kidney Homogenate Preparation. Kidney whole-cell extract was prepared by a modified method of Pierce et al. (20) and Sandgren and DeLuca (16). All steps were performed on ice or at 4°C. Kidneys were minced with a razor blade and washed twice with Tris·HCl ethylenediamine-tetraacetic acid dithiothreitol (TED)Na₁₅₀ containing a panel of protease inhibitors. The buffer was decanted and replaced with one volume (vol/vol) of TED plus inhibitors. After homogenization with a Tissue Tearor (Biospec Products, Bartlesville, OK), one volume of TEDK₆₀₀Mg₂₀ was added and homogenization was repeated. Samples were centrifuged at 20,000 × g for 1 h. Supernatant was divided into aliquots, frozen under liquid nitrogen, and stored at –80°C until analysis. The buffers contained the following: 50 mM Tris·HCL, pH 7.4/1.5 mM EDTA/5 mM DTT; 150 mM NaCl or 600 mM KCl/20 mM MgCl₂ was added where appropriate. The panel of protease inhibitors (Sigma) consisted of 150 μM aprotinin, 130 μM bestatin, 10 μM leupeptin, 1 μM pepstatin A, and 1 mM phenylmethylsulfonyl fluoride.

Analysis of Kidney Homogenate. VDR content was determined by an ELISA developed in this laboratory (21). The protein concentration of the homogenates was determined by the method of Bradford (22), using BSA as a standard.

RNA Isolation. Total RNA was isolated from mouse kidney with Tri reagent (Molecular Research Center, Cincinnati) according to the manufacturer's protocol.

Quantitative RT-PCR. RNA was DNase-treated (RQ-1 RNaseFree Dnase, Promega) and then reverse transcribed by using the SuperScript First-Strand Synthesis System for RT-PCR (Invitrogen). Real-time PCR was performed in a LightCycler (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's recommendations. SYBR green dye was used for quantification of dsDNA after every cycle. The sequence of primers designed for the quantification of β-actin, VDR, 25-hydroxyvitamin D₃-1α-hydroxylase (1α-hydroxylase), and 25-hydroxyvitamin D₃-24-hydroxylase (24-hydroxylase) follows: β-actin (F/R; 5′-3′) TGGAATCCTGTGGCATCCATGAAAC/TAAAACGCAGCTCAGTAACAGTCCG; VDR CTCCTCGATGCCCACCACA AGACCTACG/GTGGGGCAGCATGGAGAGCGGAGACAG; 1α-hydrox ylase CCGCGGGCTATGCTGGA AC/CTCTGGGCA A AGGCAAACATCTGA; and 24-hydroxylase TGGGAAGATGATGGTGACCC/ACTGTTCCTTTGGGTAGCGT. All amplicons were 200–500 bp and were sequenced to confirm specificity of amplification. Throughout real-time PCR analysis, product identities were confirmed by melting curve analysis. The quantification of each gene was relative to a standard curve generated from a serially diluted sample. The relative amount of each experimental gene was then normalized to the abundance of the housekeeping gene β-actin. These values were standardized such that a maximum value of 1.0 was assigned to the group with the highest gene expression.

Statistical Analysis. The two-tailed Student's t test was used to quantify statistical differences between experimental groups. Results are expressed as mean ± SE.

Results

Serum Analysis. To study the effects of 1,25(OH)₂D₃ and calcium on renal VDR expression, vitamin D-deficient and vitamin D-replete mice were placed pairwise on diets containing four levels of calcium with or without 50 ng of 1,25(OH)₂D₃ per day. As indicated in Table 1, the vitamin D-deficient mice on the 0.02% calcium diet had the lowest serum calcium. Dietary supplementation of 50 ng of 1,25(OH)₂D₃ per day was insufficient to raise serum calcium in these mice, whereas 50 ng of 1,25(OH)₂D₃ caused a significant increase in serum calcium in all mice that had dietary calcium of at least 0.25%. This finding suggests that a daily dietary intake of 50 ng of 1,25(OH)₂D₃ is sufficient for vitamin D-induced intestinal calcium uptake, but is insufficient for 1,25(OH)₂D₃-induced mobilization of calcium from bone. Similar observations were made with the vitamin D-replete mice, although the vitamin D-replete mice on the 0.02% calcium diet had significantly higher serum calcium values than did the calcium-restricted, vitamin D-deficient mice. Because the only source of calcium appearing in the blood of these mice is bone (23), this result demonstrates that vitamin D-replete mice on a calcium-restricted diet can produce sufficient endogenous 1,25(OH)₂D₃ to mobilize calcium from bone. The serum 1,25(OH)₂D₃ values suggest that a sufficient amount of 1,25(OH)₂D₃ to mobilize calcium from bone is ≈250 pg/ml, which is well above the amount detected in vitamin D-deficient mice supplemented daily with 50 ng of 1,25(OH)₂D₃.

Table 1. Dietary groups, serum calcium, and serum 1,25(OH)₂D₃ levels.

Diet		Serum biochemistry
Calcium, %	1,25(OH)2D3, ng/day	Calcium, mg/dl	1,25(OH)2D3, pg/ml
	Vitamin D-deficient group
0.02	0	5.5 ± 0.3	ND
	50	6.0 ± 0.2	169 ± 78
0.25	0	6.0 ± 0.1	ND
	50	12.6 ± 0.4*	68 ± 10
0.47	0	7.5 ± 0.3	ND
	50	11.2 ± 0.3*	151 ± 9
1.20	0	9.5 ± 0.2	ND
	50	15.8 ± 1.1*	72 ± 32
	Vitamin D-replete group
0.02	0	8.3 ± 0.1†	246 ± 39
	50	8.6 ± 0.1†	419 ± 56
0.25	0	8.6 ± 0.2	195 ± 40
	50	11.3 ± 0.2*	72 ± 11
0.47	0	8.9 ± 0.4	159 ± 16
	50	10.9 ± 0.1*	121 ± 24
1.20	0	9.2 ± 0.3	46 ± 8
	50	12.0 ± 0.2*	124 ± 22

Nonobese diabetic mice were fed a purified diet that contained 0.02%, 0.25%, 0.47%, or 1.20% calcium with or without 50 ng of 1,25(OH)₂D₃ per mouse per day. Study length was 3 weeks for vitamin D-deficient, calcium-restricted mice and 200 days for all other groups. Serum calcium was determined weekly by atomic absorption spectrometry (n = 4). At death, serum was collected and pooled, and the 1,25(OH)₂D₃ values were determined by a competitive binding assay (n = 2-4). All values are reported as the mean ± SEM. ND, not detectable. *, significance at P < 0.001 vs. 0 ng groups. †, significance at P < 0.001 vs. vitamin D-deficient, 0.02% calcium groups.

Dietary 1,25(OH)₂D₃ Increases Renal VDR When Dietary Calcium Is Present. In both vitamin D-deficient and vitamin D-replete mice, daily dietary intake of 50 ng of 1,25(OH)₂D₃ was sufficient to significantly increase renal VDR when at least 0.25% calcium was present in the diet (Fig. 1). These recorded increases ranged from 1.7-fold for the vitamin D-replete, 1.20% dietary calcium mice to 10.3-fold for the vitamin D-deficient, 0.25% calcium group. Daily consumption of 50 ng of 1,25(OH)₂D₃ did not increase renal VDR in mice fed a calcium-restricted diet. In fact, the mice on the 0.02% calcium diets had reduced levels of VDR expression. Vitamin D-deficient mice on a calcium-restricted diet had renal VDR values of 19–27 fmol/mg protein, whereas vitamin D-replete mice on the calcium-restricted diet had renal VDR values of 81–85 fmol/mg protein. These studies demonstrate that both 1,25(OH)₂D₃ and calcium regulate mouse renal VDR expression.

Fig. 1.

Regulation of renal VDR by calcium and 1,25(OH)₂D₃. Mice were fed a purified diet that contained 0.02%, 0.25%, 0.47%, or 1.20% calcium with or without 50 ng of 1,25(OH)₂D₃ per mouse per day. One kidney per mouse was harvested into isotonic buffer, whole-cell extract was prepared, and VDR content was determined by ELISA and standardized to total protein, as described in Materials and Methods. (A) Vitamin D-deficient mice, housed under incandescent lighting without dietary intake of vitamin D₃.(B) Vitamin D-replete mice, housed under fluorescent lighting and receiving dietary supplementation of vitamin D₃. Each group contained four to six mice. The values represent the mean ± SEM. *, significance at P ≤ 0.01.

1,25(OH)₂D₃ and Calcium Are Required to Activate VDR Transcription. To further our understanding of the regulation of renal VDR by 1,25(OH)₂D₃ and calcium, we performed real-time PCR experiments to quantify relative VDR mRNA between dietary groups. The VDR mRNA in vitamin D-deficient mice was expressed at a low basal level, regardless of dietary calcium (Fig. 2). Vitamin D-deficient mice supplemented with 50 ng of 1,25(OH)₂D₃ showed a dramatic 8- to 10-fold increase in renal VDR transcript levels when at least 0.25% calcium was present in the diet. 1,25(OH)₂D₃ supplementation did not increase renal VDR mRNA in mice fed the calcium-restricted diet. Combined, these studies demonstrate that both 1,25(OH)₂D₃ and calcium are required for expression of renal VDR mRNA above basal levels.

Fig. 2.

Regulation of renal VDR mRNA by calcium and 1,25(OH)₂D₃. Mice were fed a purified diet that contained 0.02%, 0.25%, 0.47%, or 1.20% calcium with or without 50 ng of 1,25(OH)₂D₃ per mouse per day. One kidney per mouse was harvested into Tri reagent and total RNA was prepared. After reverse transcription, VDR mRNA was quantified by means of real-time PCR and standardized to β-actin mRNA. Values are expressed as relative mRNA with a maximal value of one. (A) Vitamin D-deficient mice, housed under incandescent lighting without dietary intake of vitamin D₃. (B) Vitamin D-replete mice, housed under fluorescent lighting and receiving dietary supplementation of vitamin D₃. Each group contained four mice. The values represent the mean ± SEM. *, significance at P ≤ 0.01.

In vitamin D-replete mice, the VDR mRNA levels were lowest in the 0.02% calcium group, confirming the requirement of calcium for renal VDR mRNA expression. In the calcium-restricted mice, supplementation with 1,25(OH)₂D₃ did not significantly increase the abundance of VDR transcript, likely because of the lack of calcium. Mice fed calcium-fortified diets expressed consistently high levels of relative VDR transcript because of their endogenous production of 1,25(OH)₂D₃ and consumption of calcium. This study further suggested that 1,25(OH)₂D₃ and calcium are required to activate VDR transcription and increase the relative VDR mRNA.

The 1α-Hydroxylase and 24-Hydroxylase Are Reciprocally Regulated. To further characterize the metabolic status of the mice in this study, the transcript levels of the two primary vitamin D metabolism enzymes were quantified. The 1α-hydroxylase is responsible for the conversion of 25-hydroxyvitamin D₃ to 1,25(OH)₂D₃. This enzyme is primarily expressed in the kidney, and is stimulated by parathyroid hormone (PTH), and suppressed by 1,25(OH)₂D₃ (24, 25). As was expected, the 1α-hydroxylase transcript levels were highest in the vitamin D-deficient mice, and in the mice fed the calcium-restricted diets

(Fig. 3). These mice had the lowest serum calcium values, and likely expressed high amounts of PTH, because PTH expression is inversely related to serum calcium (26). In the vitamin D-deficient study, 50 ng of 1,25(OH)₂D₃ nearly completely abolished 1α-hydroxylase expression in mice consuming dietary calcium. It is difficult to separate the direct effects of 1,25(OH)₂D₃ on repression of the 1α-hydroxylase gene from the secondary effects of increased serum calcium and decreased PTH. In the vitamin D-replete study, 50 ng of 1,25(OH)₂D₃ had minimal impact on relative 1α-hydroxylase mRNA in mice consuming dietary calcium, because the 1α-hydroxylase expression was consistently low due to endogenous production of 1,25(OH)₂D₃.

Fig. 3.

Regulation of renal 1α-hydroxylase mRNA by calcium and 1,25(OH)₂D₃. Mice were fed a purified diet that contained 0.02%, 0.25%, 0.47%, or 1.20% calcium with or without 50 ng of 1,25(OH)₂D₃ per mouse per day. One kidney per mouse was harvested into Tri reagent, and total RNA was prepared. After reverse transcription, 1α-hydroxylase mRNA was quantified by means of real-time PCR and standardized to β-actin mRNA. Values are expressed as relative mRNA with a maximal value of one. (A) Vitamin D-deficient mice, housed under incandescent lighting without dietary intake of vitamin D₃.(B) Vitamin D-replete mice, housed under fluorescent lighting and receiving dietary supplementation of vitamin D₃. Each group contained four mice. The values represent the mean ± SEM. *, significance at P ≤ 0.01.

The 24-hydroxylase is the major catabolic enzyme responsible for the degradation of 1,25(OH)₂D₃. The 24-hydroxylase promoter contains two vitamin D-response elements and has been well characterized as a target gene for activation by 1,25(OH)₂D₃ (27, 28). 24-Hydroxylase mRNA was undetectable in vitamin D-deficient mice, further confirming the vitamin D-deficient status of these mice (Fig. 4). Vitamin D-deficient mice receiving 50 ng of 1,25(OH)₂D₃ produced significant amounts of 24-hydroxylase mRNA only if they were consuming dietary calcium. This finding was almost certainly due to the fact that up-regulation of the 24-hydroxylase by 1,25(OH)₂D₃ is receptor dependent, and, as was shown in Fig. 1, the VDR expression in the vitamin D-deficient, calcium-restricted mice was very low. In the calcium-restricted, vitamin D-replete mice, 24-hydroxylase transcript was low yet detectable because of the very high levels of 1,25(OH)₂D₃ (Table 1) and low but sufficient expression of VDR. When at least 0.25% calcium was present in the diet, supplementation with 1,25(OH)₂D₃ resulted in a significant increase in the 24-hydroxylase mRNA. This increase was not significant for the vitamin D-replete 1.20% calcium group, because these mice had elevated serum calcium values and, thus, had relatively high 24-hydroxylase mRNA levels without supplementation of 1,25(OH)₂D₃. The reciprocal regulation of the renal 1α-hydroxylase and 24-hydroxylase observed in this study further demonstrates the influence of 1,25(OH)₂D₃ and calcium on the regulation of vitamin D hormone levels.

Fig. 4.

Regulation of renal 24-hydroxylase mRNA by calcium and 1,25(OH)₂D₃. Mice were fed a purified diet that contained 0.02%, 0.25%, 0.47%, or 1.20% calcium with or without 50 ng of 1,25(OH)₂D₃ per mouse per day. One kidney per mouse was harvested into Tri reagent, and total RNA was prepared. After reverse transcription, 24-hydroxylase mRNA was quantified by means of real-time PCR and standardized to β-actin mRNA. Values are expressed as relative mRNA with a maximal value of one. (A) Vitamin D-deficient mice, housed under incandescent lighting without dietary intake of vitamin D₃.(B) Vitamin D-replete mice, housed under fluorescent lighting and receiving dietary supplementation of vitamin D₃. Each group contained four mice. The values represent the mean ± SEM. ND, not detectable. *, significance at P ≤ 0.01.

Discussion

We have conducted a comprehensive, long-term study examining the effects of 1,25(OH)₂D₃ and dietary calcium on mouse renal VDR expression. In this study we have shown that 50 ng of 1,25(OH)₂D₃ can cause a 10-fold increase in the expression of renal VDR in a vitamin D-deficient mouse. Previous studies (12, 14, 17) in vitamin D-deficient rats have shown a 2- to 4-fold increase in renal VDR content in response to 1,25(OH)₂D₃. The more dramatic increase observed in this study may be due to species differences, variances in dosage and administration (dietary versus injection or osmotic pump), or the significantly greater length of this 200-day study. In vitamin D-deficient rats, Uhland-Smith and DeLuca (17) did observe a greater increase in VDR expression after 8 weeks of 1,25(OH)₂D₃ treatment (4-fold increase versus controls) than after 4 weeks (2-fold increase versus controls) of 1,25(OH)₂D₃ treatment.

In the absence of dietary calcium, VDR levels are diminished to <30 fmol/mg protein in the vitamin D-deficient mouse and 1,25(OH)₂D₃ supplementation did not increase expression. In vitamin D-deficient rat studies, calcium restriction caused renal VDR content to decrease to 50–100 fmol/mg protein, and 1,25(OH)₂D₃ could not increase VDR expression (16, 17).

To investigate the extent to which 1,25(OH)₂D₃ and calcium regulate renal VDR at the transcriptional level, VDR mRNA was quantified by real-time PCR. Because the VDR mRNA is of relative low abundance and comigrates with ribosomal RNA during gel electrophoresis, quantification of the transcript by Northern analysis can be difficult. Real-time PCR is sensitive, as well as quantitative, for a large number of samples. Analysis demonstrated that the VDR mRNA is expressed at a low basal level in the absence of either 1,25(OH)₂D₃ or calcium. The addition of 50 ng of 1,25(OH)₂D₃ to the diet of a vitamin D-deficient mouse resulted in an 8- to 10-fold increase in the amount of VDR mRNA when calcium was present in the diet. This increase was completely absent in mice fed a calcium-restricted diet, clearly demonstrating that both 1,25(OH)₂D₃ and calcium are required for VDR mRNA expression above a basal level in mouse kidney. Whereas previous reports have concluded that 1,25(OH)₂D₃ can increase VDR mRNA in the parathyroid gland of vitamin D-deficient chickens and rats, little or no change has been observed in kidney VDR mRNA (10, 13, 18). The studies that examined changes in renal VDR mRNA in response to 1,25(OH)₂D₃ administration ranged from a single i.p. injection (10) to daily injections for one week (13). Because the half-life of 1,25(OH)₂D₃ is <6 h in the mouse (29), it is possible that daily injections of 1,25(OH)₂D₃ did not alter the transcript level, or caused a temporal increase that was not detected by the Northern analysis. In the longer term studies that explored the regulation of rat renal VDR by 1,25(OH)₂D₃ and calcium, VDR mRNA values were not reported (14, 17).

The kidney is a vitamin D target tissue critical in the reabsorption of urinary calcium. The increase in renal VDR caused by 1,25(OH)₂D₃ is most likely a result of increased transcription and ligand-induced stabilization, and could serve as a means of signal amplification. The kidney is also an important tissue for the regulation of the metabolism of 1,25(OH)₂D₃, because both the 1α-hydroxylase and 24-hydroxylase are expressed in the renal proximal tubular cells. Down-regulation of renal VDR in response to hypocalcemia may be a protective measure to block 1,25(OH)₂D₃-mediated suppression of the 1α-hydroxylase and induction of the 24-hydroxylase, resulting in a net increase in serum 1,25(OH)₂D₃ levels (15).

The molecular mechanism by which 1,25(OH)₂D₃ and calcium regulate renal VDR expression remains unclear. These experiments demonstrate that 1,25(OH)₂D₃ and calcium are both required to increase renal VDR mRNA levels. Sequence analysis of the mouse and human VDR promoters does not reveal any vitamin D response elements, and no response to 1,25(OH)₂D₃ has been detected during reporter-gene analysis, suggesting that 1,25(OH)₂D₃ does not directly activate expression of its receptor (30–32). Further experiments must be performed to discern the extent of transcriptional and posttranscriptional regulation, identify regulatory pathways and signaling molecules, and elucidate the mechanism behind the tissue specificity of this regulation.